Application of NOX4 and tumor-associated neutrophil in prediction of gastric cancer immunotherapy effect

Abstract

The invention provides an application of NOX4 and tumor-associated neutrophil in prediction of gastric cancer immune efficacy. The invention innovatively discovers that NOX4 in gastric cancer cells can recruit peripheral blood neutrophil to chemotaxis into a tumor microenvironment, the chemotaxis neutrophil generates increase of serine and asparagine anabolism in the tumor microenvironment, and then formation of a tumor immunosuppression microenvironment is caused. A gastric cancer patient with high expression of tumor cells NOX4 and increased TAN infiltration shows obvious immunotherapy resistance. The key effects and mechanisms of NOX4 and TAN in gastric cancer immune escape are excavated from the perspective of immune escape, and a new perspective is provided for searching new gastric cancer targeted combined immunotherapy targets.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and relates to the application of NOX4 and neutrophils as diagnostic markers, and specifically to the application of NOX4 and tumor-associated neutrophils in predicting the immunotherapy effect of gastric cancer. Background Art

[0002] In the context of basic diseases such as Helicobacter pylori and Epstein-Barr virus infection, gastric cancer is called a typical "microenvironment-related tumor". In recent years, tumor immunotherapy represented by immune checkpoint blockade (ICB) has made important breakthroughs in some solid tumors such as melanoma, breast cancer, and lung cancer. However, multiple clinical studies including KEYNOTE-059 and ATTRACTION-2 have reported that the objective response rate of PD-1 antibodies in the second-line treatment of gastric cancer patients is only about 12%. At present, the biomarkers guiding the clinical decision-making of PD-1 antibodies for immunotherapy of advanced gastric cancer mainly include: programmed death ligand 1 (PD-L1) expression, microsatellite instability (MSI), Epstein-Barr virus (EBV), tumor mutation load TMB, and tumor infiltrating lymphocytes TIL. However, there is currently no effective biomarker to pre-screen gastric cancer patients who respond to immunity.

[0003] Immune escape is a key clinical event that affects the prognosis of gastric cancer patients and has become a major challenge in the treatment of gastric cancer. In the field of immune regulation, tumor-associated neutrophils can mediate immunosuppression by inhibiting T cell activity, recruiting tumor-associated macrophages (TAMs), and inhibiting the proliferation of CD8+T cells. At the same time, increased neutrophil infiltration has been observed in a variety of tumor tissues in clinical practice, while cancer patients with a significant increase in peripheral blood leukocytes often have poor treatment effects. The above phenomena all indicate that the number and function of neutrophils in both tumor tissues and peripheral blood of patients have changed, but the specific mechanism remains to be explored.

[0004] Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 4 (NOX4) is an important metabolic enzyme that generates reactive oxygen species (ROS) and plays an important role in signal transduction, cell differentiation, and tumor proliferation. However, existing studies have not yet clarified the correlation between NOX4 and immune efficacy.

[0005] Therefore, based on the above research needs and blind spots, it is particularly important to deeply explore the mechanism of action of NOX4 and tumor-associated neutrophils in the immune escape of gastric cancer. Summary of the invention

[0006] The present invention aims to address the above-mentioned problems and explores the key roles and mechanisms of NOX4 and TAN in gastric cancer immune escape from the perspective of immune escape, providing a new perspective for exploring new targets for gastric cancer targeted combined immunotherapy.

[0007] The present invention innovatively discovered that NOX4 in gastric cancer cells can recruit peripheral blood neutrophils to the tumor microenvironment, where the chemotactic neutrophils undergo increased serine and asparagine anabolism, leading to the formation of a tumor immunosuppressive microenvironment. Gastric cancer patients with high expression of NOX4 in tumor cells and increased TAN infiltration show obvious resistance to immunotherapy.

[0008] Based on the above findings, the specific technical solutions of the present invention are as follows:

[0009] In a first aspect, the present invention provides the use of NOX4 and neutrophils as markers for predicting the immunotherapy efficacy of gastric cancer.

[0010] The second aspect of the present invention provides the use of NOX4 and neutrophils in the preparation of a gastric cancer immune efficacy prediction kit.

[0011] Preferably, the kit comprises reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration in a biological sample.

[0012] More preferably, the reagent for detecting NOX4 expression level in biological samples is selected from reagents for detection by immunohistochemistry, PCR, gene sequencing, and biochip. Any method in the prior art that can detect gene expression level is applicable to the present invention.

[0013] The reagent for detecting the degree of neutrophil infiltration in the biological sample is selected from the reagent for detection by immunohistochemistry method.

[0014] Preferably, the biological sample is selected from gastric cancer tissue.

[0015] In a third aspect, the present invention provides a gastric cancer immunotherapy efficacy prediction kit, comprising reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration in a biological sample.

[0016] Preferably, the diagnostic kit comprises reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration by immunohistochemistry, and can detect the NOX4 expression level and the degree of neutrophil infiltration at the same time.

[0017] The test results showed that high expression of NOX4 in gastric cancer was positively correlated with poor prognosis, and high expression of NOX4 promoted neutrophil infiltration into the tumor, significantly reducing the survival rate. Tumor-derived NOX4 recruited neutrophils into the tumor microenvironment through GM-CSF, thereby inhibiting the apoptosis of gastric cancer cells. Experiments have also confirmed that targeting neutrophil amino acid metabolism and tumor NOX4 can inhibit tumor growth in vivo.

[0018] Therefore, the fourth aspect of the present invention provides the use of an agent that inhibits or interferes with the activity or metabolic pathway of NOX4 in the preparation of a drug for treating gastric cancer.

[0019] Preferably, the substance that inhibits or interferes with NOX4 activity is selected from NOX4 shRNA, and the sequence is as follows:

[0020] The reagents that inhibit or interfere with the metabolic pathway are amino acid small molecule inhibitors PHGDH or ASNS.

[0021] In a fifth aspect, the present invention provides a pharmaceutical composition for treating gastric cancer, comprising an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient is selected from agents that inhibit or interfere with NOX4 activity or metabolic pathways, and the specific selection is as above.

[0022] The beneficial protection and effects of the present invention are as follows:

[0023] The present invention integrates cell function experiments, animal models, and serum and tissue sample verification from clinical gastric cancer patients. With the help of multi-omics technology, it depicts the immune microenvironment phenotype remodeled by NOX4 in gastric cancer cells, and explores the key mechanisms of metabolic reprogramming of neutrophils induced by NOX4 in gastric cancer cells and promoting immune escape of gastric cancer cells in multiple dimensions, providing a new theoretical basis for a better understanding of the immune escape mechanism of gastric cancer and the development of clinical treatment targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The conceptual diagram of the present invention is shown;

[0025] Figure 2 The results showed that NOX4 is highly expressed in gastric cancer and is positively correlated with poor prognosis: (A) RT-PCR was used to detect the expression of NOX4 mRNA in tumor and adjacent tissues of 30 pairs of gastric cancer patients from Ruijin Hospital, and the data were analyzed using the data set of GEPIA database; (B) Western blot analysis of NOX4 expression in gastric cancer tissues and adjacent tissues; (C, D) Representative images and statistical analysis of NOX4 immunohistochemical staining intensity in 203 paired gastric cancer tissues; (E, F) Kaplan-Meier overall survival curves of gastric cancer tissues with high and low NOX4 levels in two independent cohorts (Ruijin cohort, n=203; Kaplan-Meier Plotter database, n=875).

[0026] Figure 3Showing that tumor cell-derived NOX4 promotes neutrophil infiltration into tumors: (A) Western blot of NOX4 overexpression and underexpression in MKN45 gastric cancer cell line blot analysis; (B) Genetic or pharmacological interference with NOX4 expression and H2O2 generation; (CE) Tumor growth curves and tumor burden in immunodeficient nude mice subcutaneously injected with MKN45, MKN45 / shNOX4, or MKN45 / NOX4 cells (n=5); (F) Quantitative analysis of tumor-infiltrating neutrophils by flow cytometry in BALB / C nude mouse xenografts with different NOX4 expressions using CD11b and Ly6G surface markers; (G) Quantitative analysis of tumor-infiltrating neutrophils in BALB / C nude mice with different NOX4 expressions using immunofluorescence staining with CD11b and Ly6G surface markers; (H) Representative images of CD66b immunohistochemical staining intensity in 203 paired gastric cancer tissues; (I) Kaplan-Meier overall survival curves of 203 GC patients with high and low CD66b expression.

[0027] Figure 4 The results showed that multiple cytokines were involved in the recruitment of neutrophils: (A) Cytokine array of conditioned medium of neutrophils from healthy donors and MKN45 gastric cancer cells with different NOX4 expressions; (B) ELISA detection of the expression of NOX4, CD14, GM-CSF, VEGF, IL-15 and DKK-1 in the supernatant of co-culture of MKN45 with different NOX4 expressions and neutrophils from healthy donors; (C) ELISA detection of the levels of NOX4, CD14, GM-CSF, VEGF, IL-15 and DKK-1 in the serum of 30 newly diagnosed gastric cancer patients; (D, E) Conditioned medium of MKN45 gastric cancer cells overexpressing NOX4 was treated with anti-CD14 (20 μg / ml), anti-GM-CSF (20 μg / ml) or anti-DKK-1 (20 μg / ml), and the chemotactic ability of neutrophils was detected by transwell method.

[0028] Figure 5 Tumor-derived NOX4 recruits neutrophils into the tumor microenvironment via GM-CSF, thereby inhibiting apoptosis of gastric cancer cells: (AC) NOD / SCID mice (n=6 per group) were subcutaneously inoculated with MKN45GC cells overexpressing NOX4. When the tumor size reached 2 mm 3 When 5×10 neutrophils from healthy donors were added 6 / 200μL was pretreated with different chemokine neutralizing antibodies (anti-CD14, anti-GM-CSF and anti-DKK1) and then injected into the tail vein. Tumor growth curve (B) and tumor burden (C) were drawn based on the data measured every 4 days; (D) Tunel cell apoptosis detection kit was used to detect the apoptosis of gastric cancer cells in each group.

[0029] Figure 6 Figure 3 shows that tumor-derived NOX4 regulates neutrophil metabolic reprogramming: (A) KEGG pathway analysis in RNA sequencing results showed significant differences in neutrophil metabolic signaling pathways among groups; (B) 40 most significantly different genes in neutrophils co-cultured with NOX4 overexpression and knockdown gastric cancer cell conditioned medium; (C) qRT-PCR was used to verify the expression of the above 40 differentially expressed genes in neutrophils under different NOX4 expression gastric cancer cell conditioned medium conditions; (D) KEGG pathway enrichment.

[0030] Figure 7 Targeting neutrophil amino acid metabolism and tumor NOX4 inhibits tumor growth in vivo: (A, B) NOD / SCID mice (n=6 per group) were subcutaneously inoculated with NOX4-overexpressing MKN45 gastric cancer cells. 3 At 5 × 10 neutrophils from healthy donors 6 / 200μL and pretreated with amino acid small molecule inhibitors (PHGDH, ASNS and PLA2G3) and then injected into the tail vein; (B) Tumor growth curve, drawn based on data measured every 4 days; (C) Tunel cell apoptosis detection kit to detect apoptosis of gastric cancer cells in each group; (D) Immunofluorescence staining analysis of NOX4 expression and neutrophil infiltration in gastric cancer tumors receiving neoadjuvant immunotherapy, and the location of the primary tumor was determined by computed tomography in gastric cancer patients receiving anti-PD-1 treatment (carelizumab); (E) Schematic diagram of the idea. DETAILED DESCRIPTION

[0031] The implementation of the present invention is described in detail below in conjunction with the embodiments of the present invention. The following embodiments are implemented on the premise of the technical solution of the present invention, and provide detailed implementation methods and specific operating processes, but the protection scope of the present invention is not limited to the following embodiments.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0033] The present invention integrates cell function experiments, animal models, and serum and tissue sample verification from clinical gastric cancer patients. With the help of multi-omics technology, it depicts the immune microenvironment phenotype remodeled by NOX4 in gastric cancer cells, and explores the key mechanisms of NOX4-induced metabolic reprogramming of neutrophils in gastric cancer cells and promoting immune escape of gastric cancer cells in multiple dimensions.

[0034] Figure 1The conceptual diagram of the present invention is shown. High expression of NOX4 gene in gastric cancer cells leads to increased secretion of chemokine GM-CSF through a series of biological behaviors. Increased extracellular GM-CSF leads to chemotaxis of circulating blood neutrophils to the tumor site. Neutrophils chemotactic to the tumor microenvironment have increased intracellular serine and asparagine anabolism, and increased expression of PD-L1 on the cell surface, leading to polarization from the tumor suppressor N1 type to the cancer-promoting N2 type, thereby promoting the proliferation of gastric cancer. The specific experimental process is as follows:

[0035] Example 1 Detection of NOX4 expression level in gastric cancer and adjacent tissues

[0036] Thirty pairs of gastric cancer and adjacent tissue samples were collected and placed in a -80°C refrigerator. All cases did not receive radiotherapy or chemotherapy before surgery, and all patients signed informed consent forms. The experimental plan was approved by the ethics committee of this unit.

[0037] After total RNA was extracted from all tissues and the purity was verified, the RT-qPCR method was used to verify the expression difference of NOX4 in gastric cancer and adjacent tissues. The reverse transcription reaction system and qPCR reaction system were constructed according to the operating instructions of the kit; the primer sequences used in the determination of NOX4 content are shown in Table 1:

[0038] Table 1 Summary of NOX4 primer sequences

[0039]

[0040] All experiments were repeated three times, and the data were processed using SPSS16.0 and expressed as mean ± standard deviation. The paired comparison between cancer and adjacent tissues was performed using the t-test, and statistical differences were considered when p < 0.05. Compared with adjacent tissues of gastric cancer, the expression of NOX4 in cancer tissues was significantly upregulated, and the difference was statistically significant (P < 0.05). Similar results were obtained using the data set of the GEPIA database ( Figure 2 A).

[0041] 18 pairs of gastric cancer and adjacent tissue samples were randomly selected for Western blot analysis, and almost all pairs of samples showed high expression of NOX4 in gastric cancer tissues ( Figure 2 B); Immunohistochemistry was used to detect 203 paired gastric cancer tissues. The results showed that there was no significant change in the cell morphology of NOX4-high or low-expressing cells in adjacent tissues, but there was a significant difference in the cell morphology between NOX4-high-expressing and NOX4-low-expressing gastric cancer tissues ( Figure 2 C), the IHC score of NOX4 in gastric cancer tissues was also much higher than that in adjacent tissues ( Figure 2 D).

[0042] The above 203 gastric cancer paired tissues were used as the Ruijin cohort (n=203, 119 NOX4 high expression tissues, 84 low expression tissues), and 875 gastric cancer paired tissues were selected from the Kaplan-Meier Plotter database as the data set cohort (n=875, 401 NOX4 high expression tissues, 474 low expression tissues). The Kaplan-Meier overall survival curves of gastric cancer tissues with high and low NOX4 levels in two independent cohorts (Ruijin cohort, n=203; Kaplan-Meier Plotter database, n=875) were constructed. The results showed that the survival status of the NOX4 high expression group was significantly lower than that of the NOX4 low expression group ( Figure 2 E, 2F).

[0043] Example 2 Tumor cell-derived NOX4 promotes neutrophil infiltration into tumors

[0044] 1. Overexpression and / or knockdown of NOX4 gene in human gastric cancer cell line MKN45 to construct stable cell line

[0045] Three shRNAs for NOX4 were designed using an online shRNA design tool: shRNA-1, SEQ ID NO. 3 (5'GCTGTATATTGATGGTCCTTT3'); shRNA-2, SEQ ID NO. 4 (5'GCTAGGATTGTGTCTAAGCTT3'); and shRNA-3, SEQ ID NO. 5 (5'GAGAGCTTAGACACAATCCTA3').

[0046] The gastric cancer cell line MKN45 was divided into five groups, namely, blank control group (transfected with meaningless shRNA), MKN45 / shNOX4-1 group (transfected with shRNA-1), MKN45 / shNOX4-2 group (transfected with shRNA-2), MKN45 / shNOX4-3 group (transfected with shRNA-3), and MKN45 / NOX4 group (overexpressed NOX4). Western blot analysis was performed after shRNA or NOX4 transfection. shRNA can significantly reduce the expression level of NOX4 in cells. The expression level of NOX4 in the gastric cancer cell line MKN45 overexpressing NOX4 was significantly better than that in the blank control group ( Figure 3 A).

[0047] The NOX4 inhibitor GKT137831 and the antioxidant N-acetylcysteine ​​(NAC) were used to treat the blank gastric cancer cell line MKN45 and the gastric cancer cell line MKN45 overexpressing NOX4, respectively. The results showed that GKT137831 and NAC significantly reduced the expression level of NOX4 in gastric cancer cells ( Figure 3B).

[0048] 2. Establishment of a subcutaneous transplanted tumor model of gastric cancer in nude mice, and detection of differences in different immune cells infiltrating the tumor by flow cytometry

[0049] The experimental BALB / C nude mice were divided into four groups, with 5 mice in each group; MKN45, MKN45 / shNOX4-2 / 3 or MKN45 / NOX4 cells were subcutaneously injected to construct immune-deficient nude mice, and the tumor growth curve and tumor burden were analyzed. The results showed that the tumor volume and weight of mice with high NOX4 expression were significantly higher than those of mice in the MKN45 group, and the tumor volume and weight of mice with suppressed NOX4 expression were the lowest ( Figure 3 C, 3D, 3E).

[0050] Flow cytometry was used to quantitatively analyze tumor-infiltrating neutrophils in BALB / C nude mouse xenografts with different NOX4 expression using CD11b and Ly6G surface markers. The degree of neutrophil tumor infiltration in mice with high NOX4 expression was the highest, while the degree of neutrophil tumor infiltration in mice with suppressed NOX4 expression was the lowest ( Figure 3 F). Quantitative analysis of tumor-infiltrating neutrophils in tumors with different NOX4 expressions transfected into BALB / C nude mice using immunofluorescence staining for CD11b and Ly6G surface markers also showed the same results ( Figure 3 G). This suggests that NOX4 promotes neutrophil infiltration into tumors.

[0051] 3. Verification of the correlation between NOX4 expression differences and neutrophils using clinical samples

[0052] Tissue specimens from gastric cancer patients were selected, and CD66b, which indicates the degree of neutrophil infiltration, was used as a detection marker. Immunohistochemistry detection and bioinformatics platform analysis were used to perform CD66b immunohistochemistry staining on 203 paired gastric cancer tissues and adjacent tissues. Kaplan-Meier overall survival curves were drawn for tissue samples with high or low CD66b expression in GC patients to further verify the correlation between the immune microenvironment remodeled by NOX4 and neutrophils.

[0053] The results showed that the degree of neutrophil infiltration in gastric cancer tissue was significantly higher than that in adjacent tissues, and the survival status of patients with high CD66b expression was lower than that of patients with low CD66b expression in the first 50 months ( Figure 3 H, 3I).

[0054] Example 3 Exploration of the molecular mechanism of interaction between gastric cancer cells with different NOX4 expressions and neutrophils

[0055] 1. Effects of differentially expressed NOX4 in gastric cancer cells on the biological functions of neutrophils

[0056] Neutrophils from the peripheral blood of healthy people were extracted and co-cultured with gastric cancer cells with different MOX4 expressions. Based on the changes in neutrophil morphology, activity detection, changes in chemotaxis and adhesion ability, and differences in the expression of immunosuppressive molecules, gastric cancer cell NOX4 induced changes in neutrophil polarity. The results showed that the cytokine composition in the conditioned medium of neutrophils from healthy donors and MKN45 gastric cancer cells with different NOX4 expressions was the same ( Figure 4 A), Multiple cytokines are involved in neutrophil recruitment.

[0057] 2. Effects of polarized neutrophils on the biological functions of gastric cancer cells

[0058] The polarized neutrophils in the previous step were co-cultured with gastric cancer cells to conduct functional experiments such as gastric cancer cell cycle, apoptosis, and invasion.

[0059] 3. Study on the mechanism of NOX4 recruiting neutrophil infiltration in gastric cancer cells

[0060] Protein antibody chip technology was used to detect chemokines related to gastric cancer cell-induced neutrophil infiltration, and the correlation between NOX4 and related chemokines was verified by ELISA in the plasma of 30 gastric cancer patients. In vivo and in vitro intervention experiments with chemokine neutralizing antibodies were used to identify the key chemokines that NOX4 uses to attract neutrophils.

[0061] ELISA was used to detect the expression of NOX4, CD14, GM-CSF, VEGF, IL-15 and DKK-1 in the supernatant of co-culture of MKN45 with different NOX4 expression and neutrophils from healthy donors. At the same time, the levels of NOX4, CD14, GM-CSF, VEGF, IL-15 and DKK-1 in the serum of 30 newly diagnosed gastric cancer patients were detected. The results showed that GM-CSF is a granulocyte macrophage stimulating factor ( Figure 4 B, 4C). The conditioned medium of MKN45 gastric cancer cells overexpressing NOX4 was treated with anti-CD14 (20 μg / ml), anti-GM-CSF (20 μg / ml) or anti-DKK-1 (20 μg / ml), and the chemotaxis of neutrophils was detected by transwell assay. The anti-neutrophil chemotaxis of anti-GM-CSF and anti-DKK-1 was superior to that of anti-CD14 ( Figure 4 D, 4E).

[0062] 4. In vivo validation experiments

[0063] NOD / SCID mice (n=6 per group) were subcutaneously inoculated with MKN45 GC cells overexpressing nox4. 3 When 5×10 neutrophils from healthy donors were added 6 / 200μL was pretreated with different chemokine neutralizing antibodies (anti-CD14, anti-GM-CSF and anti-DKK1) and then injected into the tail vein. The actual size of gastric tumors in each group was measured ( Figure 5 A), and the tumor growth curve (5B) and tumor load (5C) were drawn based on the data measured every 4 days. The Tunel cell apoptosis detection kit was used to detect the apoptosis of gastric cancer cells in each group ( Figure 5 D) The results suggest that tumor-derived NOX4 recruits neutrophils into the tumor microenvironment via GM-CSF, thereby inhibiting the apoptosis of gastric cancer cells.

[0064] Example 4 Study on the characteristics of NOX4-induced neutrophil metabolic remodeling and its mechanism of promoting gastric cancer cell immune escape

[0065] (1) Clarifying the changes in neutrophil pathways induced by NOX4 from multiple perspectives

[0066] RAN-seq was used to detect the transcriptional level of neutrophils induced by gastric cancer cells with different NOX4 expressions, and the changes in key differential pathways (currently clearly defined as amino acid synthesis metabolism pathways) were analyzed by KEGG and GO. Metabolomics was used to detect the differences in metabolic pathways in polarized neutrophils.

[0067] To further identify differentially expressed genes, we focused on the comparison between NOX4 overexpression and knockdown groups, using the heat map ( Figure 6 A) and volcano map ( Figure 6 B) Combined with KEGG pathway enrichment ( Figure 6 D), we verified the RNA level of the 40 genes with the most significant differences in neutrophils treated with MKN45 TCM, neutrophils treated with MKN45 / NOX4 TCM, and neutrophils treated with MKN45 / shNOX4 TCM. The results showed that a total of 17 genes were significantly different among the three groups ( Figure 6 C), among which 6 genes (CREB3L3, GGT1, SNPH, BIK, RGPD5 and TLDC2) were upregulated as NOX4 gene expression was downregulated, and 11 genes (MTHFD2, PKC2, ASNS, PHGDH, NOX4, AARS1, PLA2G3, MSMO1, SALL4, CHRD and WFDC1) were significantly upregulated after TCM stimulation when NOX4 gene was highly expressed, and KEGG pathway enrichment revealed that most of these genes belonged to metabolic pathways.

[0068] (2) In vitro functional verification of key neutrophil metabolic pathways

[0069] The key molecules of the key metabolic pathways verified above (phosphoglycerate dehydrogenase (PHGDH), asparagine synthetase (ASNS)) were tested for CCK8 activity and cell flow cytometry apoptosis using small molecule inhibitors CBR-5884 (anti-PHGDH) and L-asparaginase (anti-ASNS). The results showed that it had a certain effect of inhibiting NOX4 expression.

[0070] (3) In vivo verification of key metabolic pathways of neutrophils

[0071] NOD / SCID mice can be used as the best neutrophil-deficient mice due to their inherent immune deficiency (i.e., no white blood cells in the body). NOD / SCID mouse models of gastric cancer with different NOX4 expressions were established, and neutrophils polarized by NOX4 and treated with small molecule inhibitors of key metabolic enzymes were injected into the tail vein. Then, normal, deficient, or rich in key metabolites diets were given, and tumor growth and intratumoral neutrophil infiltration were observed.

[0072] NOD / SCID mice (6 mice per group) were subcutaneously inoculated with MKN45 gastric cancer cells overexpressing NOX4. 3 At 5 × 10 neutrophils from healthy donors 6 / 200μL and pretreated with amino acid small molecule inhibitor CBR-5884 (anti-PHGDH) and L-asparaginase (anti-ASNS) and then injected into the tail vein. The actual tumor size of different groups was measured ( Figure 7 A), and the tumor growth curve was drawn based on the data measured every 4 days ( Figure 7 B); Tunel cell apoptosis detection kit was used to detect the apoptosis of gastric cancer cells in each group ( Figure 7 C), and immunofluorescence staining analysis of NOX4 expression and neutrophil infiltration in gastric cancer tumors receiving neoadjuvant immunotherapy ( Figure 7 D) The results showed that anti-PHGDH and anti-ASNS could effectively reduce the size of gastric tumors and significantly improve neutrophil infiltration.

[0073] The embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. Application of NOX4 and neutrophils in the preparation of a gastric cancer immune efficacy prediction kit.

2. The use according to claim 1, characterized in that: The kit comprises reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration in biological samples.

3. The use according to claim 1, characterized in that: The biological sample is selected from gastric cancer tissue.

4. The use according to claim 1, characterized in that: The reagent for detecting the expression level of NOX4 in the biological sample is selected from the reagents for detection by immunohistochemistry, PCR, gene sequencing, and biochip; The reagent for detecting the degree of neutrophil infiltration in the biological sample is selected from the reagent for detection using the immunohistochemical method.

5. A gastric cancer immunotherapy efficacy prediction kit, characterized in that: The kit contains reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration in biological samples.

6. The gastric cancer immunotherapy efficacy prediction kit according to claim 5, characterized in that: The diagnostic kit comprises reagents for detecting the NOX4 expression level and the degree of neutrophil infiltration by immunohistochemistry.

7. Use of reagents that inhibit or interfere with NOX4 activity or metabolic pathways in the preparation of drugs for the treatment of gastric cancer.

8. The use according to claim 7, characterized in that: in, The agent for inhibiting or interfering with NOX4 activity is selected from NOX4 shRNA, and the nucleic acid sequence is shown in any one of SEQ ID NO.3 to 5; The agent that inhibits or interferes with the metabolic pathway is selected from any one of CBR-5884 and L-asparaginase.

9. A pharmaceutical composition for treating gastric cancer, characterized in that: The invention comprises active components and pharmaceutically acceptable excipients, wherein the active components are selected from any one of NOX4 shRNA, CBR-5884 and L-asparaginase, and the nucleic acid sequence of NOX4 shRNA is shown in any one of SEQ ID NOs. 3 to 5.

Images