Peronospora resistance to spinach

Abstract

The present invention relates to an allele, named alpha-WOLF 23, conferring resistance to at least one Peronospora oleracea microspecies wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) a motif "KWMCLR"; and wherein the protein has an amino acid sequence having a sequence similarity of at least 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99.5%, 99.5%, 100% to SEQ ID NO: 11 in an incremental priority order. The alleles, when present in spinach plants, confer at least complete resistance to spinach downy mildew microspecies Pe: 3, Pfs: 5, Pe: 8, Pe: 9, Pe: 11, Pe: 14 and Pe: 16 and do not confer resistance to microspecies Pe: 2, Pe: 4, Pe: 6, Pe: 7, Pe: 10, Pe: 13, Pe: 15 and Pe: 18.

Description

Technical Field

[0001] The present invention relates to alleles that confer resistance to downy mildew (Peronospora effusa), and plants comprising said alleles. The present invention also relates to progeny, seeds and plant parts (e.g. leaves) of said resistant plants; and the present invention relates to propagation material suitable for producing said plants. The present invention also relates to methods of identifying said alleles and resistant plants, and methods of selecting and producing said resistant plants. Background Art

[0002] Downy mildew (Peronospora effusa) is a major threat to spinach growers because it directly affects the harvested leaves. In spinach, downy mildew is caused by the oomycete Peronospora farinose f.sp. spinacae (formerly known as Peronospora farinose f.sp. spinacae). The infection renders the leaves unfit for sale and consumption because the phenotype itself manifests itself as yellow lesions on old leaves, and gray mold growth can be observed on the underside of the leaves. The infection can spread very quickly, and it can occur in both greenhouse cultivation and soil cultivation. The optimum temperature for spore formation and germination of Peronospora effusa is 9-12°C, and high relative humidity promotes its formation and germination. When spores are deposited on the moist leaf surface, they can easily germinate and infect the leaves. 8-20°C and ≥80% relative humidity are optimal for mold growth, and mycelial growth can be observed within 6-13 days after infection. Oospores of spinach downy mildew can survive in the soil for up to 3 years or as mycelium in seeds or living plants.

[0003] Currently, 19 pathogenic races of spinach downy mildew (Pe, formerly known as Pfs) have been officially identified and characterized, and many new candidates have been observed in the field. The 19 officially recognized races of spinach downy mildew pathogen are designated Pe:1 to Pe:19 (Pe:1 to Pe:17 were previously known as Pfs:1 to Pfs17 (Irish et al., Phypathol. Vol. 98 pg. 894-900, 2008; Plantum NL (Dutch association for breeding, tissue culture, production and trade of seed and young plants) press release, "Benoeming van Pfs:14, een nieuwe fysio van valse meeldauw in spinazie," September 19, 2012; Report Jim Correl (Univ. Arkansas) and Steven Koike (UC Cooperative Extension, Monterey County), "Race Pfs:14-Another new race of the spinach downy mildew pathogen," September 18, 2012; Plantum NL press release, “Denomination of Pfs:15, a new race of downy mildew in spinach,” September 2, 2014; Plantum NL press release, “Denomination of Pfs:16, a new race of downy mildew in spinach,” March 15, 2016; Plantum NL press release, “Denomination of Pfs:17, a new race of downy mildew in spinach,” April 16, 2018; Plantum NL press release). Pe:18 and 19 were described in “Denomination of Pe:18and 19, two new races of downy mildew in spinach,” April 15, 2021).

[0004] All 19 officially recognized Pe subspecies are publicly available from GD Roelofarendsveen, Sotaweg 22, 2371 Naktuinbouw, The Netherlands.

[0005] The downy mildew species identified recently can destroy the resistance of many spinach varieties currently used commercially in the world, and therefore they have imposed a serious threat to the productivity of the spinach industry. Therefore, it is important to stand in the forefront of development in this field, because the downy mildew constantly develops the ability of its resistance that destroys the commercially available spinach varieties. For this reason, the new resistance gene for downy mildew is a very valuable asset, and they have formed an important research focus in breeding and in spinach and lettuce breeding in particular. One of the main goals of spinach breeders is to develop quickly a spinach variety with resistance to as many downy mildew species (comprising the recently identified species) as possible before these downy mildew species are widely spread and before this industry is threatened.

[0006] In commercially available spinach varieties, resistance to downy mildew is usually produced by so-called R genes. R gene-mediated resistance is based on the ability of plants to recognize invading pathogens. In many cases, this recognition occurs after the pathogen has created the first stage of interaction and transferred the so-called pathogenicity (or avirulence) factor into the plant cell. These pathogenicity factors interact with host components to create conditions that are conducive to pathogen invasion of the host and therefore cause disease. When plants can recognize events triggered by pathogenicity factors, resistance reactions can be triggered. In many different plant pathogen interaction systems (such as the interaction of spinach with different downy mildew strains), the plant only triggers these events after the specific recognition of the invading pathogen.

[0007] The co-evolution of plants and pathogens has led to an "arms race" in which R gene-mediated resistance is sometimes suppressed due to the ability of the pathogen to interact with and modify alternative host targets or to interact with and modify the same target in a different way, resulting in the plant losing the ability to successfully establish infection and cause disease. In order to re-establish resistance in plants, new R genes have to be introduced that are able to recognize alternative modes of action of pathogenicity factors.

[0008] Despite the fact that there is a relatively low persistence of the R gene, the R gene is still the dominant form of defense against downy mildew in spinach. This is mainly due to the fact that it is the only form of defense that provides absolute resistance. So far, plant breeders have very successfully produced spinach varieties resistant to downy mildew by utilizing resistance genes present in wild germplasms of multiple crop species. Even though the R gene is widely used in spinach breeding, little is known about these R genes so far.

[0009] The officially recognized R gene in spinach is actually two closely linked genes, the α- and β-WOLF genes (WO2018 / 060474; Kock et al.). This is also the first time that the R gene, or better yet, the R alleles, have been characterized at the molecular level, i.e. their nucleotide and amino acid sequences have been determined. While this provides breeders with tools to improve the efficiency of detecting and selecting R alleles, adequately coping with emerging downy mildew races remains crucial for developing commercially successful spinach varieties.

[0010] Therefore, the object of the present invention is to provide new resistance alleles of the α-WOLF gene, and to provide molecular biological tools for identifying the new resistance alleles. The differences observed between the identified alleles of the α and β-WOLF genes are huge and not simple. Therefore, it is impossible to predict in advance the resistance spectrum conferred by the WOLF alleles. Summary of the invention

[0011] In the research leading to the present invention, a new allelic variant of the α-WOLF gene described in WO2018059651 was discovered. The α-WOLF gene encodes a protein belonging to the CC-NBS-LRR (coiled-coil-nucleotide binding site-leucine-rich repeat region) family.

[0012] In the context of the present invention, the term "allele" or "allelic variant" is used to refer to a version of a gene that is linked to a specific phenotype (i.e., resistance profile). Spinach plants were found to carry one or two WOLF genes. Each of the two WOLF genes includes multiple alleles, each of which confers a specific resistance profile.

[0013] The β-WOLF gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1) at positions 213573-221884. In the case of spinach plants that also carry or only carry the α-WOLF gene, the α-WOLF gene is located at approximately the same position as the β-WOLF gene is located on scaffold 12735 in the Viroflay genome assembly.

[0014] The genome assembly for the spinach variety Viroflay, which is susceptible to all known pathogenic races of spinach downy mildew, is publicly available (Spinach (Spinacia oleracea) cultivar SynViroflay, whole genome shotgun sequencing project; Bioproject: PRJNA41497; GenBank: AYZV00000000.2; BioSample: SAMN02182572, see also Dohm et al., 2014, Nature 505: 546-549). In this Viroflay genome assembly, the β-WOLF gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1), at positions 213573-221884. The sequence covered by this interval contains the entire genome sequence of the β-WOLF gene of Viroflay, plus the 2000 base pair sequence upstream of the gene, plus the sequence downstream of the gene, up to the locus of the adjacent gene downstream of the WOLF gene. Spinach variety Viroflay only has a single WOLF gene, i.e. the β-WOLF gene, but most other spinach strains have a single α-type WOLF gene at the same position of the genome. Other spinach strains have two WOLF genes at roughly the same position in the genome. In this case, the two WOLF genes are located adjacent to each other. In most of the spinach strains with two WOLF genes, one of the WOLF genes belongs to the α-type, and the other WOLF gene belongs to the β-type. It has been observed that this allele variation in the WOLF locus is the reason for the difference in resistance to the pathogenic race of spinach downy mildew.

[0015] The difference between the alleles of the α-WOLF gene and the alleles of the β-WOLF gene lies in the presence of specific conserved amino acid motifs in the encoded protein sequence. As described above, all WOLF proteins have the following domains known in the art from N- to C-terminus: a coiled-coil domain (RX-CC-like, cd14798), an NBS domain (also known as "NB-ARC domain", pfam00931; van der Biezen & Jones, 1998, Curr. Biol. 8: R226-R228) and a leucine-rich repeat region (IPR032675), which contains an LRR domain. In addition, all WOLF proteins contain the motif "MAEIGYSVC" (SEQ ID NO: 1) at the N-terminus in their amino acid sequence. In addition, all α-WOLF proteins contain the motif “KWMCLR” (SEQ ID NO: 2) in their amino acid sequence, while all β-WOLF proteins contain the motif “HVGCVVDR” (SEQ ID NO: 3) in their amino acid sequence.

[0016] Thus, the present invention provides novel downy mildew resistance-conferring alleles of the α-WOLF gene, referred to herein as "the alleles of the present invention" or "α-WOLF 23 alleles", which encode proteins that confer resistance to downy mildew pathogens of spinach when expressed in spinach plants.

[0017] The α-WOLF 23 allele encodes a CC-NBS-LRR protein which, when expressed in spinach plants, confers resistance to Downy Mildew races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16 of spinach, and wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises:

[0018] a) comprises a nucleotide sequence having a coding sequence having, in increasing order of preference, at least 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to SEQ ID NO: 10, or

[0019] b) a nucleotide sequence encoding a protein having an amino acid sequence having, in increasing order of preference, at least 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity to SEQ ID NO: 11, or

[0020] c) a nucleotide sequence encoding an LRR domain having, in increasing order of preference, at least 94.5%, 95%, 95.5%, 96%, 96.5%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to SEQ ID NO: 12, or

[0021] d) a nucleotide sequence encoding an LRR domain having an amino acid sequence having, in increasing order of preference, at least 93%, 93.5%, 94.5%, 95%, 95.5%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity to SEQ ID NO:13.

[0022] Optionally, the protein encoded by the α-WOLF 23 allele further comprises an additional motif in its amino acid sequence, namely "DQEDEGEDN" (SEQ ID NO: 4).

[0023] The alleles described in the present invention are nucleic acids, specifically nucleic acid molecules, and more specifically isolated nucleic acid molecules.

[0024] The alleles of the present invention encode CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a coding sequence having, in increasing order of priority, at least 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity with SEQ ID NO:10.

[0025] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a coding sequence having at least 97% sequence identity with SEQ ID NO: 10 in increasing order of priority.

[0026] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises the coding sequence shown in SEQ ID NO:10.

[0027] The allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding a protein having an amino acid sequence having at least 93.5% sequence similarity to SEQ ID NO: 11. Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding a protein having an amino acid sequence having at least 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity to SEQ ID NO: 11 in increasing order of preference.

[0028] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding a protein having the amino acid sequence shown in SEQ ID NO:11.

[0029] The allele described in the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, which has at least 94.5% sequence identity with SEQ ID NO:12 in increasing order of priority.

[0030] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, which has, in increasing order of priority, at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity with SEQ ID NO: 12.

[0031] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, and the nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:12.

[0032] The allele described in the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, and the LRR domain has an amino acid sequence having at least 93% sequence similarity to SEQ ID NO:13.

[0033] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, said LRR domain having an amino acid sequence having, in increasing order of priority, at least 93.5%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity to SEQ ID NO: 13.

[0034] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein the allele comprises a nucleotide sequence encoding an LRR domain, and the LRR domain has the amino acid sequence shown in SEQ ID NO:13.

[0035] The α-WOLF 23 allele, when present in homozygous form in spinach plants, confers complete resistance to at least spinach downy mildew species Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16, and does not confer resistance to at least spinach downy mildew species Pe:2, Pe:4, Pe:6, Pe:7, Pe:10, Pe:13, Pe:15 and Pe:18.

[0036] The α-WOLF 23 allele, when present in a heterozygous form in spinach plants, confers complete resistance to at least spinach downy mildew species Pe:3, Pfs:5, Pe:9, Pe:11 and Pe:14, intermediate resistance to Pe:8 and Pe:16, and does not confer resistance to at least spinach downy mildew species Pe:2, Pe:4, Pe:6, Pe:7, Pe:10, Pe:13, Pe:15 and Pe:18.

[0037] The present invention also relates to a protein encoded by the allele of the present invention. The protein is also referred to herein as "the protein of the present invention" and confers resistance to downy mildew in spinach plants, in particular, when α-WOLF 23 encoding the protein of the present invention is present in the genome of the spinach plant in a homozygous form, it confers resistance to at least spinach downy mildew races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16.

[0038] As used herein, sequence identity is the percentage of identical nucleotides or amino acids between two sequences after appropriate alignment of the two sequences. Those skilled in the art know how to align sequences, for example, by using sequence alignment tools, such as It can be used for nucleotide sequences and protein sequences. In order to obtain the most significant results, the best possible comparison that gives the highest sequence identity score should be obtained. The sequence identity percentage is calculated by comparing the length of the shortest sequence in the assessment. Suitable comparisons are carried out in the following nucleotide sequences: the nucleotide sequence represents a gene that at least comprises a start codon and a stop codon, or a gene that encodes an amino acid sequence of a complete protein encoded by such a gene.

[0039] Sequence similarity for amino acid sequences was calculated using EMBOSS stretcher 6.6.0 (www.ebi.ac.uk / Tools / psa / emboss_stretcher) using the EBLOSUM62 matrix with settings for a gap open penalty of 12 and a gap extend penalty of 2. In the case of DNA, sequence similarity was calculated using the DNA full matrix with settings for a gap open penalty of 16 and a gap extend penalty of 4.

[0040] The present invention also relates to plants, preferably plants of the species Spinacia oleracea L., wherein the plant comprises the alleles according to the present invention in its genome. Plants comprising the alleles according to the present invention in their genome are referred to herein as "plants according to the present invention". In the context of the present invention, plants of the species Spinacia oleracea are Spinach plants.

[0041] In a further embodiment, the plant of the present invention is an agronomically elite plant, preferably an agronomically elite spinach plant.

[0042] In the context of the present invention, an agronomically superior plant is a plant having a genotype which, due to human intervention, contains an accumulation of identifiable and desirable agronomic traits which allow producers to harvest commercially significant products. Preferably, the agronomically superior plant of the present invention is an inbred or hybrid plant.

[0043] As used herein, an inbred plant is a plant of a population of plants that is the result of three or more rounds of selfing or backcrossing; or the plant is a doubled haploid. An inbred line may, for example, be a parental line used to produce a commercial hybrid.

[0044] As used herein, a hybrid plant is a plant that is the result of a cross between two different plants having different genotypes. More specifically, a hybrid plant is the result of a cross between plants of two different inbred lines. Such a hybrid plant may be, for example, an F 1 Hybrid variety plants.

[0045] Seeds of spinach comprising the α-WOLF 23 allele were deposited at NCIMB under accession number NCIMB_____.

[0046] The present invention therefore relates to plants grown from seeds deposited with NCIMB under accession number NCIMB_____.

[0047] The resistance of spinach plants to one or more races of Downy Mildew of spinach can be determined using a seedling test. In this context, a seedling test is defined as a test in which spinach seeds are planted in trays containing a growth medium and fertilized twice a week after emergence. Plants are inoculated at the first true leaf stage with a sporangium suspension having approximately 2.5×10 5The concentration of one of the pathogenic species or isolates of spinach downy mildew to be tested was 100 / ml. 30 plants were tested for each species. The inoculated plants were placed in a dew box at 18°C ​​and 100% relative humidity for a period of 24 hours, and then moved to a growth box at 18°C ​​for 6 days with a 12-hour photoperiod. After 6 days, the plants were returned to the dew box for 24 hours to induce spore formation, and the plants were subsequently scored for disease response.

[0048] As used herein, a plant is fully resistant to a race of Downy Mildew sphaerocephala when the plant shows no symptoms in the seedling test described herein.

[0049] As used herein, a plant is intermediately resistant to a race of P. pernosum when the plant shows only symptoms of chlorosis, or sporulation occurs only on the tips of the cotyledons in the seedling assay described herein.

[0050] As used herein, a plant is susceptible to an isolate of a race of P. pernosum when the plant shows symptoms of more than chlorosis in the seedling assay described herein, or when sporulation occurs over a larger area than just the tips of the cotyledons.

[0051] Plants carrying the α-WOLF 23 allele in heterozygous form may further comprise a β-WOLF 0 allele on a homologous chromosome (such as, for example, present in the Viroflay variety), wherein the β-WOLF 0 allele does not confer any resistance to downy mildew. However, plants heterozygous for the α-WOLF 23 allele may further comprise an allele of the α-WOLF or β-WOLF gene on a homologous chromosome that provides resistance to downy mildew. Preferably, such alleles will complement the α-WOLF 23 allele so that the spinach plant will be at least moderately resistant to one or more other races to which the α-WOLF 23 allele does not provide resistance. Most preferably, the other alleles of the α-WOLF or β-WOLF gene complement the α-WOLF 23 allele so that the plant is resistant to spinach downy mildew races Pe:1 to Pe:19. In one embodiment, such plants are agronomically superior plants.

[0052] Alternatively, the resistance spectrum of plants carrying the α-WOLF 23 allele is complemented by resistance-conferring alleles of completely different genes. Examples of such genes are, for example, DMR1 as described in US8,354,570, DMR6 as described in US9,121,029 and p10 as described in US10,226,016.

[0053] The present invention therefore relates to spinach plants carrying the α-WOLF 23 allele and further comprising another genetic determinant which together confer resistance to Downy Mildew species Pe: 1 to Pe: 19. The genetic determinant may be another resistance-conferring α / β-WOLF allele or a resistance-conferring allele of a completely different gene or both.

[0054] Another aspect of the invention relates to seeds capable of growing into the plants of the invention, wherein the plants comprise the alleles of the invention. The invention also relates to the use of the seeds for producing the plants of the invention, i.e., by growing the seeds into plants.

[0055] Another aspect of the present invention relates to leaves harvested from the spinach plants of the present invention, said leaves being present in natural or processed form.

[0056] Spinach leaves are sold in packaged forms, including but not limited to prepackaged spinach leaves or processed in salads containing the leaves. Such packaging is described, for example, in U.S. Pat. No. 5,523,136, which provides packaging films and packages therefrom, including such packages containing leafy products, and methods of making and using such packaging films and packages, which are suitable for use with the spinach leaves of the present invention. Thus, the present invention includes uses and methods of making and using leaves of the spinach plants of the present invention, as well as leaves derived from the spinach plants of the present invention.

[0057] The invention further relates to a container comprising one or more plants of the invention, or one or more spinach plants derived from the plants of the invention, in a growing medium for harvesting leaves from said plants, in a domestic environment, in such a way that the consumer can pick very fresh leaves for use in salads when the plants are in a ready-to-harvest condition.

[0058] The present invention also relates to propagation material suitable for producing the plant according to the present invention, wherein the propagation material is suitable for sexual reproduction and is particularly selected from microspores, pollen, ovary, ovule, embryo sac and egg cell; or is suitable for vegetative reproduction and is particularly selected from cuttings, roots, stems, cells and protoplasts; or is suitable for tissue culture of regenerated cells or protoplasts, and is particularly selected from leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, anthers, flowers, seeds and stems; wherein the propagation material comprises the alleles according to the present invention.

[0059] The present invention also relates to cells of the plant of the present invention. Such cells may be in isolated form, or may be a part of a whole plant or parts thereof, and still constitute cells of the present invention, since such cells comprise the alleles of the present invention. Cells of the present invention may also be regenerable cells, which may be regenerated into new plants of the present invention.

[0060] The present invention also relates to plant tissue of the plant of the present invention, said plant tissue comprising the allele of the present invention. The tissue may be undifferentiated tissue or differentiated tissue. Undifferentiated tissue is, for example, a stem tip, anther, petal or pollen, which may be used for micropropagation to obtain new seedlings that grow into new plants of the present invention. The tissue may also be grown from the cells of the present invention.

[0061] The present invention further relates to a method for producing plants comprising the alleles according to the present invention, said plants being resistant to Downy Mildew of Spinach by using tissue culture or by using vegetative propagation.

[0062] Progeny of the plant, cell, tissue or seed of the present invention are also part of the present invention, the progeny comprising the α-WOLF 23 allele. Such progeny can itself be a plant, cell, tissue or seed. The progeny can particularly be the progeny of the plant of the present invention, representative seeds of the plant of the present invention are deposited with NCIMB accession number _____. As used herein, the progeny includes the first progeny and all subsequent progeny from hybridization with the plant of the present invention, wherein hybridization includes hybridization with itself or hybridization with another plant, and the progeny that is determined to be the progeny comprises the allele of the present invention. Progeny can be obtained by selfing and / or further hybridization of the deposit. Progeny also includes material obtained by vegetative propagation or another form of proliferation.

[0063] The present invention further relates to germplasm of the plant of the present invention. The germplasm consists of all the genetic characteristics of the organism and, according to the present invention, at least includes the resistance trait of the present invention. The germplasm can be used in breeding programs to develop plants that show resistance to spinach downy mildew. The use of germplasm containing the alleles of the present invention in breeding is also part of the present invention. Seeds that are capable of growing into plants containing the alleles of the present invention and are representative seeds of the germplasm are deposited with NCIMB under the accession number NCIMB_____.

[0064] The present invention also relates to the use of the α-WOLF 23 allele for producing spinach plants resistant to spinach downy mildew.

[0065] The invention also relates to the use of the plant of the invention as a crop plant, a source of seeds or a source of propagation material.

[0066] The invention also relates to the use of the plants of the invention for breeding to confer resistance to spinach downy mildew.

[0067] The present invention also relates to a seed production method, the method comprising growing a spinach plant from a seed comprising the allele of the present invention in a homozygous form, allowing the plant to produce seeds and harvesting the seeds. The production of the seed is suitably completed by selfing or hybridizing with another plant, the other plant being optionally also a plant of the present invention. The plant grown from the seed produced by the method described herein is resistant to spinach downy mildew species Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16.

[0068] The present invention also relates to a method for producing hybrid spinach seeds, the method comprising crossing a first parent plant with a second parent plant, and harvesting the resulting hybrid spinach seeds, wherein the first parent plant and / or the second parent plant are plants of the present invention. Preferably, at least one of the parent plants comprises the alleles of the present invention in homozygous form.

[0069] In a specific embodiment, said first parent plant and / or second parent plant is a plant of an inbred line as defined herein.

[0070] The present invention also relates to hybrid seeds produced by the methods described herein and hybrid plants grown from the hybrid seeds, wherein the hybrid seeds and plants comprise the alleles described herein.

[0071] Transgenic techniques used to transfer nucleotide sequences between sexually incompatible plants can also be used to produce the plants of the present invention by transferring the alleles of the present invention from one species to another. Techniques that can be suitably used include conventional plant transformation techniques known to those skilled in the art, such as transformation methods mediated by Agrobacterium. The plants of the deposits or their progeny are suitable sources of modified genes.

[0072] The present invention also relates to a method for identifying spinach plants comprising the allele according to the present invention, wherein said method comprises the following steps:

[0073] a) detecting the allele of the invention in the genome of a plant by determining the sequence of the allele, or

[0074] b) detecting the allele of the present invention by determining the sequence of the LRR domain of the allele of the present invention in the genome of the plant, or

[0075] c) by detecting unique polymorphisms in the alleles described in the present invention.

[0076] Optionally, the method may further comprise testing whether the plant comprising the allele of the present invention exhibits resistance to Downy Mildew Pathogen of Spinach.

[0077] The LRR domain of the allele of the present invention can be determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO:5, and wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:6.

[0078] The present invention also relates to a method for selecting spinach plants resistant to spinach downy mildew, the method comprising identifying the presence of the alleles described in the present invention, optionally testing the plants for resistance to spinach downy mildew, and selecting plants comprising the alleles as plants resistant to at least the following spinach downy mildew races: Pe:3, Pfs:5, Pe:9, Pe:11 and Pe:14, preferably Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16.

[0079] The introduction of the allele of the present invention can also be accomplished by introgression from a plant containing the allele, such as a plant whose representative seeds are deposited as NCIMB_____, or from its progeny, or from any other plant of the present invention. Breeding methods such as hybridization and selection, backcrossing, recombinant selection or other breeding methods that result in the transfer of genetic sequences from resistant plants to susceptible plants can be used. The resistant plants can be of the same species or of different and / or wild species. The difficulties of hybridization between species can be overcome by techniques known in the art (e.g., embryo rescue), or cis-genesis can be applied instead. The progeny of the deposit can be sexual or vegetative propagation progeny of the deposit, which can be self-fertilized and / or hybridized, and can be F1, F2 or the next generation, as long as the progeny of the deposit still contain the modified allele of the present invention present in the seeds of the deposit. Plants produced by such methods are also part of the present invention.

[0080] The present invention also relates to a method for producing spinach plants resistant to Downy Mildew races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16, the method comprising the following steps:

[0081] a) hybridizing a first parent plant comprising the allele of the present invention with a second parent plant to obtain an F1 population;

[0082] b) optionally, performing one or more rounds of selfing and / or crossing with plants in the F1 population to obtain a next generation population;

[0083] c) selecting plants comprising the allele of the present invention from the F1 population or the next generation population as resistant plants.

[0084] The present invention also relates to a method for producing spinach plants resistant to Downy Mildew races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16, the method comprising:

[0085] a) crossing a first parent plant comprising the allele of the present invention in homozygous form with a second parent plant;

[0086] b) backcrossing the plant obtained in step a) with the second parent plant for at least three generations;

[0087] c) selecting plants comprising at least the allele of the first parent plant of step a) of the present invention from a backcross population of the third generation or higher as plants resistant to spinach downy mildew.

[0088] The present invention also provides a method for introducing another desired trait into a plant resistant to spinach downy mildew, the method comprising:

[0089] a) crossing a plant comprising the allele of the present invention with a second plant comprising said another desired trait to produce F1 offspring;

[0090] b) selecting plants in said F1 comprising said resistance trait and said another desired trait;

[0091] c) crossing the selected F1 offspring with one of the parents for at least three generations to produce backcross offspring;

[0092] d) selecting backcross progeny comprising said resistance trait and said another desired trait; and

[0093] e) optionally, continuously repeating steps c) and d) one or more times to produce a fourth generation or higher backcross progeny selected to contain the resistance trait and the another desired trait.

[0094] Optionally, after any hybridization or backcrossing step described in the above method, a selfing step is carried out.After any hybridization or selfing step of the method, the selection of the plant comprising the spinach downy mildew resistance and the proterties of the another desired can be carried out alternatively. The proterties of the another desired can be selected from but not limited to the following group: resistance to bacteria, fungi or viral diseases, insect or pest resistance, improved germination, plant size, plant type, improved shelf life, water stress and heat stress tolerance, and male sterility. The present invention includes the plant produced by the method.

[0095] The present invention will be further described in the following examples, and the examples are for illustrative purposes only. The examples are not intended to limit the present invention in any way. In the examples and the applications, reference is made to the following figure.

[0096] Resistance information

[0097] Table 1

[0098] The spectrum of resistance conferred by the α-WOLF 23 allele when present in a spinach plant in heterozygous or homozygous form. "-" means full resistance to a particular downy mildew race; "(-)" means intermediate resistance to a particular downy mildew race; "+" means that the allele does not confer resistance and will result in plants carrying only the α-WOLF 23 allele being fully susceptible to a particular downy mildew race; "-*" means that when the allele is present in homozygous form, it confers full resistance to a particular downy mildew race, while the allele, when present in heterozygous form, does confer intermediate resistance to the particular downy mildew race; "nt' means that the isolate has not been tested yet.

[0099] Downy mildew of spinach Resistance score Downy mildew of spinach Resistance score Pe:1 nt Pe: 11 - Pe:2 + Pe:12 nt Pe:3 - Pe: 13 + Pe:4 + Pe:14 - Pe:5 - Pe:15 + Pe:6 + Pe:16 -＊ Pe:7 + Pe: 17 nt Pe:8 -＊ Pe:18 + Pe:9 - Pe:19 nt Pe:10 +

[0100] Collection Information

[0101] Seeds of plants comprising in their genome the α-WOLF 23 allele of the invention were deposited on [date] with the National Collection of Industrial, Food and Marine Microorganisms NCIMB Ltd (Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB219YA, United Kingdom) under accession number NCIMB_____. The deposit was made under the terms of the Budapest Treaty. Upon grant of the patent, all restrictions on the deposit will be lifted and the deposit is intended to satisfy the requirements of 37 CFR §1.801-1.809. Upon grant of the patent, the deposit will be irrevocably and without restriction or condition to be released to the public. The deposit will be maintained at the depository for a period of 30 years, or 5 years after the last request, or for the life of the patent, whichever is longer, and will be replaced as necessary during that period.

[0102] Sequence information

[0103] Table 2. Sequence information

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] The present invention will be further illustrated in the following examples, which are provided for illustrative purposes only and are not intended to limit the present invention in any way. Example

[0110] Example 1

[0111] Testing spinach plants for resistance to Downy Mildew

[0112] Resistance to downy mildew infection was determined using differential collection as described by Irish et al. (2008; Phytopathol. 98: 894-900). Spinach plants of the present invention were sown together with spinach plants from different other genotypes (see Table 3) in trays containing Scotts Redi-Earth medium and fertilized twice a week after emergence with Osmocote Peter's (13-13-13) fertilizer (Scotts). Sporangia suspensions of the pathogenic race of spinach downy mildew (2.5×10 5In this way, four officially recognized pathogenic races were tested.

[0113] The inoculated plants were placed in a dew box at 18°C ​​and 100% relative humidity for a 24-hour period and then moved to a growth box at 18°C ​​with a 12-hour photoperiod for 6 days. After 6 days, the plants were returned to the dew box for 24 hours to induce sporulation and then scored for disease response.

[0114] Plants in this specific test were scored as resistant, moderately resistant, or susceptible based on symptoms of chlorosis and signs of pathogen sporulation on cotyledons and true leaves as described by Irish et al. (2007; Plant Dis. 91: 1392-1396). Plants that showed no signs of chlorosis and sporulation in this specific test were considered resistant. Resistant plants were re-inoculated to assess whether plants initially scored as resistant had escaped infection or if they were truly resistant. Plants that showed only symptoms of chlorosis or sporulation only on the tips of the cotyledons were scored as moderately resistant. Plants that showed more of these symptoms than downy mildew infection were scored as susceptible.

[0115] Table 1 shows the resistance of plants carrying the α-WOLF 23 allele to each of these pathogenic races. Table 3 shows the differential set of resistance of spinach downy mildew races and multiple spinach varieties (hybrids) to each of these pathogenic races. Susceptible reactions were scored as "+" (indicating successful infection by the mold, with sporulation occurring throughout the cotyledons), and resistance was indicated as "-" (no sporulation on the cotyledons). Weakly resistant reactions were marked as "(-)", which in practice means a slightly lower level of infection (symptoms of chlorosis only in differential seedling tests, or sporulation occurring only on the tips of the cotyledons).

[0116] Table 3:

[0117]

[0118]

[0119] Example 2

[0120] Amplification of LRR domain coding region I

[0121] Isolated genomic DNA from a spinach plant containing the α-WOLF 23 allele was used in a polymerase chain reaction (PCR) using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID No: 5) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID No: 6). This primer pair amplifies the LRR domain coding region of the α-WOLF gene and has been designed to selectively amplify a portion of the WOLF gene without amplifying portions of other CC-NBS-LRR protein coding genes.

[0122] The PCR conditions for amplifying the LRR domain coding region of the α-WOLF gene using primers with SEQ ID No: 5 and SEQ ID No: 6 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0123] - 3 minutes at 95°C (initial denaturation step),

[0124] - 40 amplification cycles, each cycle consisting of the following steps: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds,

[0125] - 2 min at 72°C (final extension step).

[0126] Isolated genomic DNA from a spinach plant of the Viroflay variety containing the β-WOLF 0 allele was used in a polymerase chain reaction (PCR) using the forward primer TCACGTGGGTTGTGTTGT (SEQ ID No: 7) and the reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID No: 6). This primer pair amplifies the LRR domain coding region of the β-WOLF gene and has been designed to selectively amplify a portion of the WOLF gene without amplifying portions of other CC-NBS-LRR protein coding genes.

[0127] The PCR conditions for amplifying the LRR domain coding region of the β-WOLF gene using primers with SEQ ID No: 6 and SEQ ID No: 7 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0128] - 3 minutes at 95°C (initial denaturation step),

[0129] - 40 amplification cycles, each cycle consisting of the following steps: denaturation at 95°C for 30 seconds, annealing at 58°C for 50 seconds, and extension at 72°C for 50 seconds,

[0130] - 2 min at 72°C (final extension step).

[0131] The PCR products were visualized on agarose gels (not shown) and the DNA was purified from the PCR reactions. The sequence of the PCR products was then determined using methods well known in the art.

[0132] The DNA sequence of the LRR domain of the α-WOLF 23 allele amplified by primers having SEQ ID No: 5 and SEQ ID No: 6 is provided in Table 2 as SEQ ID No: 12.

[0133] The DNA sequence of the LRR domain of the β-WOLF 0 allele amplified by primers having SEQ ID No: 6 and SEQ ID No: 7 is provided in Table 2 as SEQ ID No: 8.

[0134] Finally, the obtained sequences were translated into the corresponding amino acid sequences of the LRR domains, which have SEQ ID No: 13 and SEQ ID No: 9 for the α-WOLF 23 allele and β-WOLF 0, respectively (see also Table 2).

[0135] If the PCR products are to be sequenced using a SMRT sequencer (Pacific Biosciences), the PCR primers and PCR conditions are different.

[0136] The following standard amplification sequence was added to the forward primer described above: GCAGTCGAACATGTAGCTGACTCAGGTCAC.

[0137] The following standard amplification sequence was added to the reverse primer: TGGATCACTTGTGCAAGCATCACATCGTAG.

[0138] Example 3

[0139] Introducing the α-WOLF 23 allele into plants that do not carry the allele

[0140] Spinach plants containing the α-WOLF 23 allele were crossed with plants of the variety Viroflay carrying the β-WOLF 0 allele, thereby obtaining the F1 generation. Subsequently, the F1 plants were selfed to obtain an F2 population.

[0141] Plants of the F2 population were tested for resistance to spinach downy mildew Pe:3, Pe:5, Pe:9, Pe:11 and Pe:14 as described in Example 1. Approximately 75% of the plants were scored as completely resistant in the test. This segregation pattern is consistent with a dominant inheritance pattern.

[0142] Genomic DNA from each plant of the same F2 population was isolated and used for two different polymerase chain reactions (PCRs). The first PCR reaction was performed using primers for amplifying the LRR domain of the α-WOLF allele, and the second PCR reaction was performed using primers for amplifying the LRR domain of the β-WOLF allele, both reactions being described in Example 2.

[0143] The PCR products were visualized on an agarose gel (not shown), which showed that approximately 75% of the plants contained the α-WOLF fragment, and the remaining approximately 25% of the plants contained only the β-WOLF fragment. The plants containing the α-WOLF fragment were completely correlated with the plants scored as resistant to Pe:3, Pe:5, Pe:9, Pe:11, and Pe:14. The plants containing only the β-WOLF fragment were completely correlated with the plants scored as susceptible to Pe:3, Pe:5, Pe:9, Pe:11, and Pe:14.

[0144] The DNA from the PCR reaction was purified and the sequences of the PCR products were subsequently determined. The sequence obtained for the α-WOLF PCR product corresponded to the sequence of SEQ ID No: 12 (sequence of the LRR domain of the α-WOLF 23 allele). The sequence obtained for the β-WOLF PCR product corresponded to the sequence of SEQ ID No: 8 (sequence of the LRR domain of the β-WOLF 0 allele).

Claims

1. An allele of an α-WOLF gene, said allele encoding a protein which, when expressed in spinach plants, confers resistance to at least Peronospora effusa races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16, and does not confer resistance to races Pe:2, Pe:4, Pe:6, Pe:7, Pe:10, Pe:13, Pe:15 and Pe:18, and wherein said protein comprises in its amino acid sequence: the motif "MAEIGYSVC" at its N-terminus, and the motif "KWMCLR"; and wherein said allele comprises: a) a nucleotide sequence comprising a coding sequence having at least 97% sequence identity to SEQ ID NO: 10, or b) a nucleotide sequence encoding a protein having an amino acid sequence having at least 93.5% sequence similarity to SEQ ID NO: 11, or c) a nucleotide sequence encoding an LRR domain, said nucleotide sequence having at least 94.5% sequence identity to SEQ ID NO: 12, or d) a nucleotide sequence encoding an LRR domain having an amino acid sequence having at least 93% sequence similarity to SEQ ID NO:

13.

2. The allele of claim 1, wherein the protein encoded by the allele further comprises the motif "DQEDEGEDN".

3. The allele according to claim 1 or 2, wherein the allele, when present in homozygous form in spinach plants, confers complete resistance to at least Pe:3, Pfs:5, Pe:9, Pe:11 and Pe:

14.

4. A protein encoded by the allele according to any one of claims 1 to 3.

5. A spinach plant comprising the allele according to any one of claims 1 to 3, a representative sample of seeds of the spinach plant capable of growing into a plant comprising the allele being deposited with NCIMB under the accession number NCIMB_____.

6. Spinach plant according to claim 5, wherein the plant is an agronomically elite plant, in particular a hybrid variety or an inbred line.

7. Spinach seeds capable of growing into spinach plants according to any one of claims 5 and 6.

8. A propagation material suitable for producing a spinach plant according to any one of claims 5 and 6, wherein the propagation material is suitable for sexual reproduction and is particularly selected from microspores, pollen, ovary, ovule, embryo sac and egg cell; or is suitable for vegetative propagation and is particularly selected from cuttings, roots, stem cells and protoplasts; or is suitable for tissue culture of regenerated cells or protoplasts, wherein the regenerated cells or protoplasts are particularly selected from leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, anthers, flowers and stems; and wherein the propagation material comprises the allele according to any one of claims 1 to 3.

9. A method for identifying a spinach plant comprising an allele according to any one of claims 1 to 3, wherein the method comprises the following steps: a) detecting the allele in the genome of a plant by determining the sequence of the allele according to claim 1 or 2, or b) detecting the sequence of the LRR domain of the allele according to any one of claims 1 to 3 in the genome of the plant, or c) by detecting a unique polymorphism in the allele according to any one of claims 1 to 3, and optionally d) testing whether the plants comprising the allele of the present invention show resistance to Downy Mildew of Spinach.

10. The method of claim 9, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO:

5.

11. The method of claim 9, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:

6.

12. A method for selecting spinach plants resistant to downy mildew of spinach, the method comprising identifying the presence of an allele according to any one of claims 1 to 3, optionally testing the plants for resistance to downy mildew of spinach, and selecting plants comprising the allele as plants resistant to at least the following subspecies of downy mildew of spinach: Pe:3, Pfs:5, Pe:9, Pe:11 and Pe:14, preferably Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:

16.

13. A method for producing spinach plants resistant to Downy Mildew races Pe:3, Pfs:5, Pe:8, Pe:9, Pe:11, Pe:14 and Pe:16, the method comprising the steps of: a) crossing a first parent plant comprising the allele according to any one of claims 1 to 3 with a second parent plant to obtain an F1 population; b) optionally, performing one or more rounds of selfing and / or crossing with plants in the F1 population to obtain a next generation population; c) selecting a plant comprising the allele according to any one of claims 1 to 3 as a resistant plant from the F1 population or the next generation population.

14. A method for producing hybrid spinach seeds resistant to Downy Mildew of Spinach, the method comprising the steps of: Crossing a first parent plant with a second parent plant, wherein one or both of the parent plants are homozygous for the gene of any one of claims 1 to 3; and harvesting hybrid seed.

15. Hybrid seed produced by the method of claim 14.

16. A plant grown from the hybrid seed of claim 15.

Images