Anti-b7h3 nanobody and use thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an anti-B7H3 nano antibody and application thereof. The invention provides an anti-B7H3 nano antibody and application thereof, aiming at the problems that the existing B7H3 antibody is mainly a mouse monoclonal antibody and is large in molecular weight, poor in tissue penetrability, not easy to engineer and the like. According to the invention, a human B7H3 target spot is taken as an antigen, 15 anti-B7H3 specific nano antibodies are screened through a phage display technology, and the nano antibodies can be specifically combined with the B7H3 antigen, are high in specificity and affinity, and also have the advantages of small molecular weight, high stability, easiness in transformation, high solubility and the like. Meanwhile, the anti-B7H3 nano antibody and the anti-CD3 antibody OKT3scFv are connected in series to prepare the B7H3 / CD3 bispecific antibody, in-vivo and in-vitro experiments show that the B7H3 / CD3 bispecific antibody has a good anti-tumor effect, and the B7H3 / CD3 bispecific antibody can be applied to preparation of anti-tumor drugs and has a wide anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular, relates to an anti-B7H3 nanobody and uses thereof. Background Art

[0002] B7H3 (CD276) is an important immune checkpoint molecule of the B7-CD28 family. It is a single type I transmembrane protein. The amino acid sequences of human and mouse B7H3 proteins have 88% similarity. Human B7H3 is located on chromosome 15, and its extracellular domain (29-456aa) contains two tandemly repeated immunoglobulin-like variable regions (IgV regions) and immunoglobulin-like constant regions (IgC regions); mouse B7H3 is located on chromosome 9, and its extracellular domain (29-248aa) contains only one IgV region and IgC region. Studies have found that B7H3 exists in two subtypes (2Ig-B7H3 and 4Ig-B7H3), of which the 2Ig-B7H3 form is expressed in human and mouse cells and contains the IgV1-IgC21 region; the 4Ig-B7H3 form only exists in human cells and contains the IgV1-IgC21-IgV2-IgC22 region. The receptor of B7H3 is still unknown, so the physiological function involved in its regulation is not yet clear, but soluble B7H3 (sB7H3) can bind to T, NKT and NK cells, and its binding level increases with T cell activation. Studies have shown that B7H3 has the function of stimulating T cell proliferation, enhancing the induction of cytotoxic T lymphocytes and IFN-γ secretion; but there are also studies showing that B7H3, as a T cell co-inhibitory molecule, can significantly inhibit the secretion of cytokines during T cell activation, and knocking out or blocking B7H3 can promote the onset of experimental autoimmune encephalomyelitis. Studies have shown that B7H3 protects tumor cells by binding to NK cells and inhibiting NK-mediated cytotoxicity. It may also be involved in the occurrence of acute and chronic transplant rejection and the regulation of mucosal surface lymphocyte activity. In addition, recent studies have shown that overexpression of B7H3 is associated with poor prognosis of tumor patients and proliferation, migration and immunosuppression of tumor cells, but its receptors or ligands have not yet been discovered, and its specific biological functions are still inconclusive.

[0003] Detection of various clinical samples revealed that B7H3 was lowly expressed or not expressed in most normal tissues, but highly expressed in a variety of tumor tissues, such as head and neck tumors, craniopharyngioma, prostate cancer, glioma, skin squamous cell carcinoma, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, renal clear cell carcinoma, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma and other solid tumors as well as hematological tumors such as acute myeloid leukemia (Majzner RG et al. CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrates Potent Preclinical Activity Against Pediatric Solid Tumors and Brain Tumors. Clin Cancer Res. 2019Apr15; 25(8):2560-2574; Yang M et al. Tandem CAR-T cellstargeting CD70 and B7-H3 exhibit potent preclinical activity against multiple solid tumors. tumors. Theranostics. 2020Jun 18;10(17):7622-7634;Tyagi A, et al. Evidence supporting a role for the immune checkpoint protein B7-H3 in NK cell-mediated cytotoxicity against AML. Blood. 2022May 5;139(18):2782-2796;Nehama D et al. Kontos F, et al. B7-H3: An Attractive Target for Antibody-based Immunotherapy. Clin Cancer Res. 2021Mar 1;27(5):1227-1235). As a pan-tumor antigen and potential immunosuppressive regulatory molecule, B7H3 has become one of the hot spots in anti-tumor research. The biological drugs currently under development for B7H3-targeted immunotherapy mainly include engineered antibodies, antibody-drug conjugates (ADCs), antibody-drug conjugates (RDCs), and CAR-T, which have shown good anti-tumor activity in clinical or preclinical studies. Therefore, B7H3 has become a drug target with potential research value whose function has not yet been clarified.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The technical problem to be solved by the present invention is that the existing antibodies against B7H3 are mainly mouse monoclonal antibodies, which have the problems of large molecular weight, poor tissue penetration, and difficulty in engineering transformation.

[0006] The technical solution of the present invention to solve the above technical problems is: to provide an anti-B7H3 nanobody. The anti-B7H3 nanobody comprises a heavy chain variable region of CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1 to CDR3 are any of the following:

[0007] As shown in SEQ ID NOs: 1 to 3; or as shown in SEQ ID NOs: 5 to 7; or as shown in SEQ ID NOs: 9 to 11; or as shown in SEQ ID NOs: 13 to 15; or as shown in SEQ ID NOs: 17 to 19; or as shown in SEQ ID NOs: 21 to 23; or as shown in SEQ ID NOs: 25 to 27; or as shown in SEQ ID NOs: 29 to 31; or as shown in SEQ ID NOs: 33 to 35; or as shown in SEQ ID NOs: 37 to 39; or as shown in SEQ ID NOs: 41 to 43; or as shown in SEQ ID NOs: 45 to 47; or as shown in SEQ ID NOs: 49 to 51; or as shown in SEQ ID NOs: 53 to 55; or as shown in SEQ ID NOs: 57 to 59.

[0008] Among them, the above-mentioned anti-B7H3 nanobody also includes a framework region, and the structure of the VHH chain of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0009] Further, in the above-mentioned anti-B7H3 nanobody, the amino acid sequence of the VHH chain of the nanobody is any one of SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:20, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:32, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:56 or SEQ ID NO:60.

[0010] Further, the amino acid sequence of CDR1 of the above-mentioned anti-B7H3 nanobody is such as SEQ ID NO: 1, the amino acid sequence of CDR2 is such as SEQ ID NO: 2, the amino acid sequence of CDR3 is such as SEQ ID NO: 3, and the amino acid sequence of VHH is such as SEQ ID NO: 4; or the amino acid sequence of CDR1 is such as SEQ ID NO: 5, the amino acid sequence of CDR2 is such as SEQ ID NO: 6, the amino acid sequence of CDR3 is such as SEQ ID NO: 7, and the amino acid sequence of VHH is such as SEQ ID NO: 8; or the amino acid sequence of CDR1 is such as SEQ ID NO: 9, the amino acid sequence of CDR2 is such as SEQ ID NO: 10, the amino acid sequence of CDR3 is such as SEQ ID NO: 11, and the amino acid sequence of VHH is such as SEQ ID NO: 12; or the amino acid sequence of CDR1 is such as SEQ ID NO: 13, the amino acid sequence of CDR2 is such as SEQ ID NO: 14, the amino acid sequence of CDR3 is such as SEQ ID NO: 15, and the amino acid sequence of VHH is such as SEQ ID NO: 16; or the amino acid sequence of CDR1 is such as SEQ ID NO: NO:17, the amino acid sequence of CDR2 is such as SEQ ID NO:18, the amino acid sequence of CDR3 is such as SEQ ID NO:19, and the amino acid sequence of VHH is such as SEQ ID NO:20; or the amino acid sequence of CDR1 is such as SEQ ID NO:21, the amino acid sequence of CDR2 is such as SEQ ID NO:22, the amino acid sequence of CDR3 is such as SEQ ID NO:23, and the amino acid sequence of VHH is such as SEQ ID NO:24; or the amino acid sequence of CDR1 is such as SEQ ID NO:25, and the amino acid sequence of CDR2 is such as SEQ ID NO:26; or the amino acid sequence of CDR3 is such as SEQ ID NO:27, and the amino acid sequence of VHH is such as SEQ ID NO:28; or the amino acid sequence of CDR1 is such as SEQ ID NO:29, the amino acid sequence of CDR2 is such as SEQ ID NO:30, the amino acid sequence of CDR3 is such as SEQ ID NO:31, and the amino acid sequence of VHH is such as SEQ ID NO:32; or the amino acid sequence of CDR1 is such as SEQ ID NO:33, and the amino acid sequence of CDR2 is such as SEQ ID NO: NO:34, the amino acid sequence of CDR3 is such as SEQ ID NO:35, and the amino acid sequence of VHH is such as SEQ ID NO:36; or the amino acid sequence of CDR1 is such as SEQ ID NO:37, the amino acid sequence of CDR2 is such as SEQ ID NO:38, the amino acid sequence of CDR3 is such as SEQ ID NO:39, and the amino acid sequence of VHH is such as SEQ ID NO:40;or an amino acid sequence of CDR1 such as SEQ ID NO:41, an amino acid sequence of CDR2 such as SEQ ID NO:42, an amino acid sequence of CDR3 such as SEQ ID NO:43, and an amino acid sequence of VHH such as SEQ ID NO:44; or an amino acid sequence of CDR1 such as SEQ ID NO:45, an amino acid sequence of CDR2 such as SEQ ID NO:46, an amino acid sequence of CDR3 such as SEQ ID NO:47, and an amino acid sequence of VHH such as SEQ ID NO:48; or an amino acid sequence of CDR1 such as SEQ ID NO:49, an amino acid sequence of CDR2 such as SEQ ID NO:50, an amino acid sequence of CDR3 such as SEQ ID NO:51, and an amino acid sequence of VHH such as SEQ ID NO:52; or an amino acid sequence of CDR1 such as SEQ ID NO:53, an amino acid sequence of CDR2 such as SEQ ID NO:54, an amino acid sequence of CDR3 such as SEQ ID NO:55, and an amino acid sequence of VHH such as SEQ ID NO:56; or an amino acid sequence of CDR1 such as SEQ ID NO: NO:57, the amino acid sequence of CDR2 is such as SEQ ID NO:58, the amino acid sequence of CDR3 is such as SEQ ID NO:59, and the amino acid sequence of VHH is such as SEQ ID NO:60.;

[0011] Among them, the above antibody sequences are shown in Table 1 below:

[0012] Table 1 Antibody amino acid sequences

[0013]

[0014]

[0015]

[0016] Furthermore, the anti-B7H3 nanobody is at least one of a monovalent nanobody, a multivalent nanobody, a multispecific nanobody or a fusion nanobody.

[0017] Wherein, the multispecific nanobody is an anti-B7H3 / CD3 bispecific antibody.

[0018] Furthermore, the present invention also provides an isolated polynucleotide encoding the above-mentioned nanobody.

[0019] Furthermore, the nucleotide sequence of the above-mentioned isolated polynucleotide is shown in SEQ ID NO:61-75.

[0020] The present invention also provides a recombinant vector containing the isolated polynucleotide.

[0021] The present invention also provides a host cell containing the above-mentioned recombinant vector.

[0022] Wherein, the host cell is at least one of a prokaryotic host cell, a eukaryotic host cell or a bacteriophage. The prokaryotic host cell includes Escherichia coli, Streptomyces, Bacillus subtilis or Mycobacterium; the eukaryotic host cell includes animal cells, plant cells or fungi; the animal cell is selected from mammalian cells, insect cells or Caenorhabditis elegans; the mammalian cell is selected from any one of 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, mouse L cells, LNCaP cells, 633 cells, Vero cells, BHK cells, CV1 cells, Hela cells, MDCK cells, Hep-2 cells and Per6 cells; the fungi is selected from any one of Saccharomyces cerevisiae, Pichia pastoris, Hansen's yeast, Candida, Kluyveromyces lactis, Aspergillus nidulans, Schizosaccharomyces pombe and Yarrowia lipolytica.

[0023] The present invention also provides an immunoconjugate or a pharmaceutical composition comprising the above-mentioned anti-B7H3 nanobody.

[0024] Wherein, the immunoconjugate further comprises a therapeutic agent, and the therapeutic agent comprises at least one of an immune checkpoint-related preparation, a toxin, a factor, a drug, a radionuclide, a kinase inhibitor or a cytotoxic agent.

[0025] Wherein, the pharmaceutical composition further comprises at least one of a pharmaceutical excipient, a carrier or a diluent.

[0026] Furthermore, the present invention also provides a use of the above-mentioned anti-B7H3 nanobody, isolated polynucleotide or host cell in the preparation of a drug for preventing, diagnosing or treating tumors.

[0027] Furthermore, the tumor includes at least one of head and neck tumors, craniopharyngioma, prostate cancer, glioma, skin squamous cell carcinoma, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, renal clear cell carcinoma, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma or acute myeloid leukemia.

[0028] The present invention has the following beneficial effects:

[0029] The present invention uses human B7H3 target as antigen and screens 15 anti-B7H3 specific nano antibodies through phage display technology. The nano antibodies can specifically bind to B7H3 antigen, have strong specificity and affinity, and have the advantages of small molecular weight, high stability, easy transformation, strong solubility, etc. At the same time, the present invention also prepares B7H3 / CD3 bispecific antibodies by connecting anti-B7H3 nano antibodies and anti-CD3 antibody OKT3 in series. In vitro and in vivo experiments show that the bispecific antibodies have good anti-tumor effects. The B7H3 / CD3 bispecific antibodies of the present invention can be used in the preparation of anti-tumor drugs and have a wide range of anti-tumor effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The purity of the recombinant protein B7H3-His was analyzed by SDS-PAGE in the embodiment of the present invention;

[0031] Figure 2 In the embodiment of the present invention, indirect ELISA is used to detect the titer of anti-B7H3 antibodies in camel serum;

[0032] Figure 3 The binding of anti-B7H3 nanobody to B7H3 antigen is analyzed by IFA in the embodiment of the present invention;

[0033] Figure 4 The binding specificity of anti-B7H3 nanobody to B7H3 was analyzed by FACS in the embodiment of the present invention;

[0034] Figure 5 In the embodiment of the present invention, RTCA is used to analyze the in vitro killing activity of B7H3 / CD3 bispecific antibody against B7H3-Hela cells;

[0035] Figure 6 The in vivo anti-tumor effect of the B7H3 / CD3 bispecific antibody was evaluated using the NCG mouse xenograft model in the present invention. A is the binding result of the anti-B7H3 nanobody to the acute myeloid leukemia (AML) cell MV-4-11; B is the survival analysis of the AML xenograft model mice. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0037] The present invention provides an anti-B7H3 nanobody, comprising a heavy chain variable region of CDR1, CDR2 and CDR3, wherein the amino acid sequences of CDR1 to CDR3 are any of the following: as shown in SEQ ID NOs: 1 to 3; or as shown in SEQ ID NOs: 5 to 7; or as shown in SEQ ID NOs: 9 to 11; or as shown in SEQ ID NOs: 13 to 15; or as shown in SEQ ID NOs: 17 to 19; or as shown in SEQ ID NOs: 21 to 23; or as shown in SEQ ID NOs: 25 to 27; or as shown in SEQ ID NOs: 29 to 31; or as shown in SEQ ID NOs: 33 to 35; or as shown in SEQ ID NOs: 37 to 39; or as shown in SEQ ID NOs: 41 to 43; or as shown in SEQ ID NOs: 45 to 47; or as shown in SEQ ID NOs: 49 to 51; or as shown in SEQ ID NOs: 53 to 55; or as shown in SEQ ID NOs: 57 to 59.

[0038] Wherein, the anti-B7H3 nanobody also includes a framework region, and the structure of its heavy chain variable region is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0039] Wherein, the nanobody is at least one of a monovalent nanobody, a multivalent nanobody, a multispecific nanobody or a fusion nanobody.

[0040] The monovalent nanobody is an antigen-specific nanobody obtained by screening from a nanobody library using a specific antigen. It has a large number of hydrophilic residues on its surface and can maintain a strict monomer structure. It can bind to its antigen with high specificity and affinity only in this monomer form.

[0041] The multivalent nanobody is a polymer of monovalent antibodies that recognize the same epitope and has a higher antigen affinity than the corresponding monovalent nanobody.

[0042] The multispecific antibody is a polymer of monovalent antibodies that recognize different epitopes, and can bind to different targets or different epitopes of the same target, and has a higher antigen recognition ability than monovalent antibodies. Nanobodies have a simple structure and can be polymerized together through short connecting sequences, thereby converting into a multivalent and multispecific form.

[0043] Furthermore, the present invention also provides an isolated polynucleotide encoding the above-mentioned nanobody.

[0044] Furthermore, the nucleotide sequence of the above-mentioned isolated polynucleotide is shown in SEQ ID NO:61-75.

[0045] The nucleotide sequence encoding antibody Nb1, SEQ ID NO: 61

[0046] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0047] TGTGCAGCCTCTGGATACACCTACAGTAGCTACTGGATGGGCTGGTTCCGCCAGGCTCCAGGGA

[0048] AGGAGCGCGAGGGGGTCGCAGCTATTTATACTCGTGGTGGTACCACATACTATGCCGACTCCGT

[0049] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0050] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATACGAAAGTGGGGGGTTGGGTACGGAATAACCCCGCCGGAATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0051] The nucleotide sequence encoding antibody Nb10, SEQ ID NO: 62

[0052] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0053] TGTGCAGCCTCTGGAATCACCTACGACAGCTATGCCATGGCCTGGTTCCGCCAGGCTCCAGGAA

[0054] AACAGCGCGAGGGCGTCGCAAGTCTTTACACTCGTGCTGGTACCACATACTATGCCGACTCCGT

[0055] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0056] CCTGAAACCTGAGGACACCGCTATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACGTCTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。

[0057] SEQ ID NO: 63 Nucleotide sequence encoding antibody Nb12

[0058] CAGGTGCAGCTGCAGGAGTCTGGGGGAGACTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0059] TGTGCAGCCTCTGGAATCACCTACAACTGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA

[0060] AGGAGCGCGAGGGCGTCGCAAGTCTTTATACTTGTGCTGGTACCACATACTATGCCGACTCCAT

[0061] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0062] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAATTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。

[0063] SEQ ID NO: 64 Nucleotide sequence encoding antibody Nb15

[0064] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCGCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0065] TGTGTAGCCTCTGGATACGCCTACAGTAGAAACTGGGTGGGCTGGTTCCGCCAAACTCCAGGGA

[0066] AGGAGCGCGAGGCGGTCGCAGCTATTTATACTGGTGGTGGCAGCACATACTATGCCGACTCCGT

[0067] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0068] CCTGATACCTGAGGACACTGCCATATACTACTGTGCGGCAGATCCGGCTGTCGGGGCTTGGGTTTCCGGGGACCCTTCTCGCCGCTTGAAGTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0069] The nucleotide sequence encoding antibody Nb25, SEQ ID NO: 65

[0070] CAGGTGCAGCTGCAGGAGTCTGGGGGAGACTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0071] TGTGCAGCCTCTGGAATCACCTACAGCAGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA

[0072] AGGAGCGCGAGGGGGTCGCAAGTATTCATAGTCCTTCTGGTACCACATACTATGCCGACTCCAT

[0073] AAAGGGCCGATTCACCATCGCCCACGACAACGCCCTGAACACGGTGTATCTGGAAATGAACAG

[0074] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAAGTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。

[0075] The nucleotide sequence encoding antibody Nb52, SEQ ID NO: 66

[0076] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0077] TGTGCAGCCTCTACTTACACCTATAACATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGCG

[0078] AGGGGGTCGCAGCGTTTTATTCCAGAGGTACTAGGGTCTATGCCGACTCCGTGAAGGGCCGATT

[0079] CACCATCTCCCGTGACAACGCCAAGAACACGCTGTATCTAGACATTGACATGCTGAGACCTGAC

[0080] GACGCTGCCATGTACTACTGTGCGGCTGCCACGGAGTTGATTGGTACTGCTCCGTTAGATGCGAGGACGTATAAGTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0081] The nucleotide sequence encoding antibody NbH59, SEQ ID NO: 67

[0082] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0083] TGTGCAGCCCCTGGAAGCATCTATAGTAGGATGTGGATGGGCTGGTTCCGCCAGGCTCCAGGG

[0084] AAGGAGCGCGACGCGGTCGCAGCTATTTATACTGCTGCTGGTAGCACATACTATGCCGACTCCG

[0085] TGAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAATACGGTGTATCTGCAAATGAACA

[0086] GCCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCCCGCCGTGGGATCATGGGTTGGCTCACGCCCCCTAGGGAGCGTGCGCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0087] SEQ ID NO: 68 Nucleotide sequence encoding antibody Nb60

[0088] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCGCC

[0089] TGTGCAGCCTCTGGATACAGTCTAAGTAGCGATTTCGTGGCCTGGTTCCGCCAGGCTTCAGGGA

[0090] AGGATCGCGAAGACGTCGCAGGTATTTATCCTGGTGGTAGTATGGCACACTATGCCGACGCCGT

[0091] GAAGGGCCGATTCACCATCTCCCGAGACAACACCAAGAACATGGTGTATCTGCAAATGAACAG

[0092] CCTGAAACCTGAAGACACCGCCATGTACTACTGTGCATCACGGTTTCTTCCCAAGACCGGTCGAACGTGGGACCCGCTCAATTTTGCTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0093] SEQ ID NO: 69 Nucleotide sequence encoding antibody Nb64

[0094] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0095] TGTGCAGCCTCTGGATACACCTTCAGTCGCCACTGGATGGGCTGGTTCCGCCAGGCTCCAGGGA

[0096] AGGAGCGCGAGGGGGTCGCAGCTATTTATACTAATGGTGGTAGCACATACTATGCCGACTCCGT

[0097] GAAGGGCCGGTTCACCATCTCCCAAGACAACGCCAAGAACACGGTATTTCTGCAAATGAATAG

[0098] CCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATTTAGCTGTTGGTAGTTGGCTG

[0099] AGACAGGGGGGCCCGTTGAGAATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0100] SEQ ID NO: 70 Nucleotide sequence encoding antibody Nb70

[0101] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGCACTCTGAGACTCTCC

[0102] TGTGCAGCCTCTGGATACACCTTAAGTAGCAATTTCGTGGGCTGGTTCCGCCAGGCTTCAGGGA

[0103] AGGTCCGCGAAGAGGTCGCAGGTATCTATCCCGGTGATAGTCTTACGCACTATGCCGACGCCGT

[0104] GAAGGGCCGATTCACCATCTCCCGAGACAACGTCAAGAACACGGTGTATCTGCAAATGAACAG

[0105] CCTGAAACCTGAGGACACCGCCATGTACTACTGTGCGACACGGTTTCACCCCAAGACCAGTCGAACGTGGGACCCGCCCAACTTTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0106] SEQ ID NO: 71 Nucleotide sequence encoding antibody Nb90

[0107] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCCCC

[0108] TGTGTAGCCTCTGGAATCACCCACATCGACTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA

[0109] AGGAGCGCGAGGGGGTCGCAAGTATTCACGCTCGTAGCGGTACGACATACTATGCCAACTCCG

[0110] TACAGGGCCGATTCACCATCTCCCACGACAAGGCCAAGAACACGGTGTATCTGGAAATGAACA

[0111] GCCTGAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATCGAGTCTACTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACTACTGGGGCCGTGGGACCCAGGTCACCGTCTCCTCA。

[0112] The nucleotide sequence encoding antibody NbH1, SEQ ID NO: 72

[0113] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0114] TGTACAGCCTCTGGATTTACCGACAGTAGCTACTGGATGGGCTGGTTCCGCCAGGTTCCAGGAA

[0115] AGGAGCGCGAGGGGGTCGCAACTATTTATACTCAGCTTGGTACCACATACTATGCCGACTCCGT

[0116] GAAGGGCCGATTCACCATCTCCCAAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0117] CCTTAAACCTGAGGACACTGCCATGTACTACTGTGCGGCAGATAGGAAAGTGATGTATTGGGTACAGAATAACCCCGCCGGGATTGGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0118] SEQ ID NO: 73 Nucleotide sequence encoding antibody NbH51

[0119] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0120] TGTGCAGCCTCTGGAATCACCTACAACAGCTACTCCATGGCCTGGTTCCGCCAGGCTCCAGGAA

[0121] AGGAGCGCGAGGGCGTCGCAAGTCTTTACACTCTTGCTGGTACCACATACTATGCCGACTCCGT

[0122] AAAGGGCCGATTCACCATCTCCCACGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAG

[0123] CCTGAAACCTGAGGACACTGCTATGTACTACTGTGCGACAGATCGAGTCTTCTGGGGTACTTCGTCCCTCCAGAGGACCCGCTATAACGTCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0124] SEQ ID NO: 74 Nucleotide sequence encoding antibody NbH68

[0125] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGATCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0126] TGTGCAGCCTCTGGATACATCGACAGTAGCAACTGGATGGGCTGGTTCCGCCAGGCTCCAGGG

[0127] AAGGAGCGCGAGGGGGTCGCAGCCATTTATGCTGATATTGGTACGACATACTATGCCGACTCC

[0128] GTGCAGGGCCGATTCACCATCTCGCAAGACACCGCCAAGAACACGGTATATCTGCAAATGAAC

[0129] GCACTGAAACCTGACGACACTGCCGCGTACTACTGTGCGATAGGGAGGAAGGGTGGGCGCTTGG

[0130] TACAACTCCCGTTTCCGATCGTCAATTACTTACTGGGGCCGGGGAACCCAGGTCACCGTCTCCTCA.

[0131] SEQ ID NO: 75 Nucleotide sequence encoding antibody NbH73

[0132] CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCC

[0133] TGTGCAGCCTCTGCAGACACCTACAGTCAGAACTTCATGACGTGGTTCCGCCAGGCTGCAGGGA

[0134] AGGAGCGGGAGGGGGTCGCAAGTGTTTATACTGGTAGTGGTGCCACAGTCTATGCCGACTCCG

[0135] TGAAGGGCCGATTCACCATCTCCCGAGACAACGCCGAGAACACGGTGTATCTACAAATGAACA

[0136] GCCTGAAAACCTGAGGACACTGCCATGTACTATTGTGCGGCAAAACTTGTCAGTGGTCGCTGGTTGACGGGGACCTATACCTACTGGGGCCAGGGGGACCCAGGTCACCGTCTCCTCA.

[0137] The present invention also provides a recombinant vector containing the isolated polynucleotide.

[0138] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector.

[0139] An embodiment of the present invention further provides a host cell, which contains the recombinant vector as described in any of the above embodiments.

[0140] An embodiment of the present invention further provides an immunoconjugate or a pharmaceutical composition, which comprises the anti-B7H3 nanobody described in any of the preceding embodiments or the antibody described in any of the preceding embodiments.

[0141] In some embodiments, the immunoconjugate further comprises a therapeutic agent.

[0142] In some embodiments, the therapeutic agent comprises at least one of an immune checkpoint-related agent, a toxin, a factor, a drug, a radionuclide, a kinase inhibitor, and a cytotoxic agent.

[0143] In some embodiments, the pharmaceutical composition includes at least one of a pharmaceutically acceptable excipient, a carrier, and a diluent.

[0144] In the preferred technical scheme of the present invention, the above-mentioned carrier is a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier includes but is not limited to polyvinyl pyrrolidone and its derivatives, polyvinyl alcohol and its derivatives, methyl cellulose and its derivatives, ethyl cellulose and its derivatives, hydroxypropyl cellulose and its derivatives, starch and its derivatives, polyethylene glycol and its derivatives, lactose, sucrose, mannitol, trehalose, sorbitol, dextrin, microcrystalline cellulose, acrylic resin, calcium hydrogen phosphate, calcium stearate, sodium stearyl fumarate, silicon dioxide, titanium dioxide, talc, indigo or a combination thereof.

[0145] The excipients include at least one polar organic solvent and at least one thickening agent.

[0146] The diluent is, for example, selected from pharmaceutically acceptable water or salt.

[0147] Furthermore, the present invention also provides a use of the above-mentioned anti-B7H3 nanobody, isolated polynucleotide or host cell in the preparation of a drug for preventing, diagnosing or treating tumors.

[0148] Furthermore, the tumor includes at least one of head and neck tumors, craniopharyngioma, prostate cancer, glioma, skin squamous cell carcinoma, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, renal clear cell carcinoma, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma or acute myeloid leukemia.

[0149] The "treatment" mentioned in the present invention includes curing, improving, alleviating the patient's condition or pathological characteristics, or inhibiting the deterioration of the condition.

[0150] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0151] Example 1 Construction of eukaryotic expression vector of B7H3-His protein and its expression and purification

[0152] 1.1 Vector construction

[0153] Using the plasmid containing the full-length B7H3 gene (gene number NM_001024736.2) as a template, primers were designed to amplify the B7H3 extracellular domain (ECD) gene, and it was connected to the pVax-His vector after double digestion with restriction endonucleases PstⅠ and XbaⅠ by homologous recombination. It was transformed into DH5α competent medium, coated with kanamycin-resistant plates, and cultured in a 37℃ incubator overnight. Single clones were picked for sequencing and identification, and the successfully constructed clones were expanded and cultured to extract plasmids.

[0154] 1.2 Expression and purification of recombinant proteins

[0155] The recombinant plasmid pVax-B7H3(ECD)-His containing the B7H3 extracellular domain gene was successfully transfected into HEK293T cells. After 8 hours of transient transfection, the medium was replaced with fresh 293freestyle medium and cultured for 5 days. The culture supernatant was collected and purified by affinity chromatography using NTA-Ni column to obtain high-purity recombinant protein B7H3-His. The results are as follows: Figure 1 shown.

[0156] Example 2 Screening and preparation of anti-B7H3 protein nanobodies

[0157] 2.1 Protein emulsification and animal immunization

[0158] After emulsifying 1 mg of purified B7H3-His recombinant protein with an equal volume of Freund's complete adjuvant, the first immunization was performed subcutaneously in the neck of the Alxa Bactrian camel. Then, 1 mg of B7H3-His recombinant protein was emulsified with incomplete Freund's adjuvant every 2 weeks and immunized for 3 consecutive times. Peripheral blood was collected through the jugular vein. The B7H3-His recombinant protein was coated in a 96-well ELISA plate at 200 ng / well. The camel serum before and after immunization was graded diluted and the antibody titer of anti-B7H3 protein in the serum was detected by indirect ELISA. The results are as follows: Figure 2 As shown, the antibody titer against B7H3-His protein was 1:256,000, indicating a good immune effect, which laid the foundation for subsequent library construction.

[0159] 2.2 Construction and panning of VHH phage antibody library

[0160] 2.2.1 Isolation of peripheral blood lymphocytes

[0161] On the 7th day after the shock immunization, 200 mL of peripheral anticoagulated blood was collected aseptically through the jugular vein, diluted with an equal volume of PBS, and then separated by centrifugation using Ficoll-Paque Plus lymphocyte separation solution (catalog 17144002, Cytiva) and lymphocyte separation tubes to obtain 7.5 × 10 8 The total RNA of the obtained lymphocytes can be directly extracted or frozen at -80℃ for later use.

[0162] 2.2.2 VHH gene amplification

[0163] First, total RNA of lymphocytes was extracted according to the instructions (catalog 74134, RNeasy Plus Mini Kit, QIAGEN), and then reverse transcription was performed using a reverse transcription kit (catalog 18080051, SuperScript III First-Strand Synthesis System, Invitrogen) with RNA as a template to obtain cDNA. VHH gene was amplified using nested PCR with cDNA as a template. The primers used in the first round of PCR were CALL001 (nucleotide sequence as shown in SEQ ID NO: 76) and CALL002 (nucleotide sequence as shown in SEQ ID NO: 77), and a band of about 700 bp was separated and recovered by agarose gel electrophoresis. Then, the recovered 700 bp product was used as a template for a second round of PCR amplification. The primers used in the second round of PCR were VHH-FOR (nucleotide sequence as shown in SEQ ID NO: 78) and VHH-REV (nucleotide sequence as shown in SEQ ID NO: 79), and a band of 400 bp was separated and recovered by agarose gel electrophoresis. The primer sequences are shown in Table 2 below.

[0164] Table 2 Primer sequences required for VHH gene amplification

[0165] Primer name Sequence number Primer sequence (5'-3') CALL001 SEQ ID NO: 76 GTCCTGGCTGCTCTTCTACAAGG CALL002 SEQ ID NO: 77 GGTACGTGCTGTTGAACTGTTCC VHH-FOR SEQ ID NO: 78 CAGGTGCAGCTGCAGGAGTCTGGGGGAGR VHH-REV SEQ ID NO: 79 CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT

[0166] 2.2.3 Construction of VHH phage display vector

[0167] The 400 bp product recovered in 2.2.2 and the phage display vector pMECS were double-digested with Pst I and Not I and recovered, and then ligated with T4 DNA ligase.

[0168] 2.2.4 Electroporation of ligation products into TG1 competent cells and harvesting of phage antibody library

[0169] The ligation product in 2.2.3 was added to the competent E. coli TG1 cells and electroporated into TG1. After electroporation, SOC medium was added immediately and cultured at 37°C, 200 rpm for 1 hour. Then, the culture was spread on LB / AMP-GLU plates. After culture at 37°C for 6 to 8 hours, the bacterial lawn was collected and 1 / 3 volume of 50% glycerol was added to prepare the phage library.

[0170] 2.2.5 Determination of phage library diversity and capacity

[0171] The electroporation product was diluted 10-fold and then spread on LB / Amp-Glu plates. After culturing at 37°C for 12 h, the number of transformants was calculated, and the final library capacity was 1.73×10 10 of phage libraries.

[0172] 2.2.6 Screening of specific nanobodies against B7H3 protein

[0173] The prepared phage library was used as the antibody source and screened by phage display technology for three rounds. First, the purified B7H3-His recombinant protein (2 μg / mL) was coated on a 96-well ELISA plate, and the plate was blocked with 3% skim milk powder at 37°C for 1 h the next day. 1×10 10 The recombinant phage containing nanobodies was incubated at 37°C for 1 hour and then washed 5 times with PBST. The phage bound to B7H3-His was eluted with 0.1M glycine (pH 1.5) and neutralized with 1M Tris-HCl (pH 8.0). The eluate was re-infected with the host bacteria TG1 and expanded for 3 rounds of screening. 192 clones were randomly selected from the plates of the third round of screening for expansion and culture. The nanobodies that could specifically bind to the B7H3 protein were identified by monoclonal ELISA. The results showed that 128 of the 192 selected clones were positive clones (P / N>3.0, P represents the OD450 value of the B7H3 well, and N represents the OD450 value of the control well); the sequencing results of the positive clones were compared and analyzed, and a total of 15 strains of specific nanobodies against B7H3 were obtained.

[0174] Example 3 Preparation of specific nanobodies against B7H3 protein

[0175] The VHH gene was amplified using the plasmid containing the nanobody gene in step 2.2.6 as a template and constructed into the eukaryotic expression vector pcDNA3.1-hFc by homologous recombination. After sequencing, the plasmid was extracted and transfected into HEK293T cells. After 5 days of expression, the supernatant was collected and purified by affinity chromatography using an NTA-Ni column to obtain the recombinant nanobody.

[0176] Example 4 IFA detection of binding of anti-B7H3 nanobody to B7H3 antigen at cellular level

[0177] The anti-B7H3 nanobody recombinant protein (Nbs-hFc) prepared in Example 3, the anti-B7H3 positive control antibody 8H9 (Ahmed M et al., Humanized Affinity-matured Monoclonal Antibody 8H9 Has Potent Antitumor Activity and Binds to FG Loop of Tumor Antigen B7-H3. J Biol Chem. 2015 Dec 11; 290(50):30018-29) and the isotype control antibody were incubated with Hela cells overexpressing B7H3 molecules (B7H3-Hela) at 37°C for 1 h, washed with PBS three times, and then stained with Alexa Fluor TM 594 Goat anti-human IgG (H+L) (ThermoFisher) secondary antibody (1:500) was used for detection, and fluorescence microscopy was used for observation, imaging and recording. The results are shown in Figure 3 As shown, the anti-B7H3 nanobody recombinant protein (Nbs-hFc) of the present invention has good binding activity with B7H3 at the cellular level.

[0178] Example 5 FACS detection of binding specificity of anti-B7H3 nanobodies

[0179] The anti-B7H3 nanobody recombinant protein (Nbs-hFc) prepared in Example 3, the anti-B7H3 positive control antibody 8H9 and the isotype control antibody were incubated with B7H3-Hela cells, wild-type Hela cells, wild-type A375 cells and A375 cells with B7H3 knockout (A375-B7H3-KO) at 37°C for 1 h, washed with PBS three times and then detected by Alexa Fluor TM 647 Goat anti-human IgG (H+L) (ThermoFisher) secondary antibody (1:600) was used for detection and analyzed by flow cytometer. The results are shown in Figure 4 As shown, the anti-B7H3 nanobody recombinant protein (Nbs-hFc) of the present invention has good binding activity with B7H3-Hela cells, wild-type Hela cells and wild-type A375 cells, and does not bind to A375-B7H3-KO cells, indicating that the anti-B7H3 nanobody prepared by the present invention has good specific binding activity with the B7H3 antigen.

[0180] Example 6 Biacore detection of affinity between nanobodies and B7H3 protein

[0181] The anti-B7H3 recombinant nanobody was respectively bound to the B7H3-mFc antigen coated on the CM5 chip (catalog 29104988, Cytiva) using the Biacore 8k instrument to detect the binding affinity. The results are shown in Table 3. The affinity of the anti-B7H3 recombinant nanobody to the B7H3 protein is between 10 -12 M~10 -9 M, are all high-affinity antibodies.

[0182] Table 3 In vitro binding affinity and kinetic analysis of anti-B7H3 nanobodies to B7H3 protein

[0183] Antibody ID Antibody Name Binding rate ka (1 / Ms) Dissociation rate kd (1 / s) Affinity KD(M) 1# Nb1 2.52E+06 2.89E-03 1.15E-09 3# Nb10 1.45E+06 9.31E-04 6.40E-10 4# Nb12 4.17E+06 1.64E-03 3.94E-10 6# Nb15 3.25E+06 6.39E-03 1.97E-09 8# Nb25 3.65E+06 2.10E-03 5.76E-10 11# Nb52 1.94E+05 2.75E-07 1.41E-12 12# NbH59 6.00E+06 5.90E-03 9.84E-10 13# Nb60 9.99E+05 2.73E-04 2.74E-10 14# Nb64 3.07E+06 9.09E-03 2.97E-09 16# Nb70 1.67E+06 8.89E-04 5.31E-10 17# Nb90 1.13E+06 6.10E-04 5.37E-10 18# NbH1 1.75E+06 7.77E-04 4.44E-10 19# NbH51 3.16E+06 7.02E-04 2.22E-10 20# NbH68 1.76E+06 8.06E-04 4.58E-10 21# NbH73 6.12E+05 3.86E-04 6.30E-10

[0184] Example 7 RTCA detection of in vitro killing activity of B7H3 / CD3 bispecific antibody against B7H3-Hela cell line

[0185] The 15 nanobodies provided by the present invention were respectively concatenated with the single-chain antibody OKT3 scFv (Table 4, SEQ ID NO: 80) against CD3 molecules using a G4S linker to construct a eukaryotic expression vector, transfected into HEK293T cells for expression, and purified using a Ni column.

[0186] Table 4 Anti-CD3 molecule antibody OKT3 scFv sequence information

[0187]

[0188] B7H3-Hela cells were slowly added to a 96-well plate dedicated to the non-labeled killing detection instrument (RTCA) at a density of 5000 cells per well and 100 μL / well (duplicate wells), and cultured in the instrument until the cell index was between 1.0 and 2.0. T cells and B7H3 / CD3 bispecific antibody (0.01 μg / mL) were added at an E:T ratio of 5:1 for co-culture, and the instrument was started to continue detection. The results are as follows: Figure 5 As shown, compared with the blank group and the irrelevant control group of anti-human CD19-CD3 bispecific antibodies (the sequence of the anti-CD19 scFv antibody refers to the approved product Tisagenlecleucel), after 50 hours of co-culture, the cell indexes of the above 15 B7H3 / CD3 bispecific antibody groups were all close to 0, indicating that the above anti-B7H3 / CD3 bispecific antibodies have good killing activity against B7H3-Hela cells.

[0189] Example 8 Detection of anti-tumor activity of B7H3 / CD3 bispecific antibody in AML model

[0190] The anti-B7H3 nanobody recombinant protein (Nbs-hFc) prepared in Example 3 and the anti-B7H3 positive control antibody 8H9 were incubated with acute myeloid leukemia (AML) cells MV-4-11 at 37°C for 1 h, washed with PBS three times, and then stained with Alexa Fluor TM 647 Goat anti-human IgG (H+L) (ThermoFisher) secondary antibody (1:600) was used for detection, and the results showed that the anti-B7H3 nanobody recombinant protein (Nbs-hFc) of the present invention was positive for binding to MV-4-11 cells ( Figure 6 A).

[0191] MV-4-11-luciferase cells were cultured at a rate of 2 × 10 6 The cells were inoculated into 6- to 8-week-old NCG mice through the tail vein, and the tumor growth was detected in a live imaging instrument. After the tumor was formed, they were randomly divided into 17 groups, with 3 mice in each group. A blank control group (PBS), an experimental group (B7H3 / CD3 bispecific antibody) and an irrelevant control group (CD19-CD3 bispecific antibody) were set up. The bispecific antibody was administered intraperitoneally once every 2 days for 7 consecutive times. The dose of the bispecific antibody was 2.5 mg / kg. The blank control group (PBS) was given the same volume of PBS. At the first administration, each mouse in the experimental group (B7H3 / CD3 bispecific antibody) and the irrelevant control group (CD19-CD3 bispecific antibody) was inoculated with 1×10 7 T cells, and each mouse in the blank control group (PBS) was injected with the same volume of PBS through the tail vein. The survival status of each mouse in the experimental group (B7H3 / CD3), irrelevant control group (CD19-CD3) and blank control group (PBS) was observed and counted for 40 days. The Kaplan-Meier method was used to draw the mouse survival curve. The results are as follows Figure 6 As shown in Figure B, all the mice in the blank control group (PBS) and the irrelevant control group (CD19-CD3 bispecific antibody) died 16 days after tumor implantation, while the survival rates of the mice in the 15 B7H3 / CD3 bispecific antibody groups prepared by the present invention were 100% 40 days after tumor implantation, indicating that the 15 B7H3 / CD3 bispecific antibodies prepared by the present invention had good anti-tumor activity in the mouse xenograft model of AML.

[0192] It can be seen from the above experimental results that the 15 anti-B7H3 nanobodies obtained by the present invention all have good antigen binding activity and antigen binding specificity, and are all high-affinity antibodies. The B7H3 / CD3 bispecific antibody formed by combining the anti-B7H3 nanobody of the present invention with the anti-CD3 molecule antibody OKT3 scFv has good killing activity against tumor cells both in vivo and in vitro, and can be used to prepare drugs for preventing or treating tumors.

Claims

1. An anti-B7H3 nanobody, characterized in that: A heavy chain variable region comprising CDR1, CDR2 and CDR3, wherein the amino acid sequences of CDR1 to CDR3 are any of the following: As shown in SEQ ID NOs: 1 to 3; or as shown in SEQ ID NOs: 5 to 7; or as shown in SEQ ID NOs: 9 to 11; or as shown in SEQ ID NOs: 13 to 15; or as shown in SEQ ID NOs: 17 to 19; or as shown in SEQ ID NOs: 21 to 23; or as shown in SEQ ID NOs: 25 to 27; or as shown in SEQ ID NOs: 29 to 31; or as shown in SEQ ID NOs: 33 to 35; or as shown in SEQ ID NOs: 37 to 39; or as shown in SEQ ID NOs: 41 to 43; or as shown in SEQ ID NOs: 45 to 47; or as shown in SEQ ID NOs: 49 to 51; or as shown in SEQ ID NOs: 53 to 55; or as shown in SEQ ID NOs: 57 to 59.

2. The anti-B7H3 nanobody according to claim 1, characterized in that: It also includes a framework region, and the structure of the VHH chain of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4; preferably, the amino acid sequence of the VHH chain of the nanobody is any one of SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:20, SEQID NO:24, SEQ ID NO:28, SEQ ID NO:32, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQID NO:48, SEQ ID NO:52, SEQ ID NO:56 or SEQ ID NO:

60.

3. The anti-B7H3 nanobody according to claim 1, characterized in that: The amino acid sequence of the anti-B7H3 nanobody CDR1 is such as SEQ ID NO: 1, the amino acid sequence of CDR2 is such as SEQ ID NO: 2, the amino acid sequence of CDR3 is such as SEQ ID NO: 3, and the amino acid sequence of VHH is such as SEQ ID NO: 4; or the amino acid sequence of CDR1 is such as SEQ ID NO: 5, the amino acid sequence of CDR2 is such as SEQ ID NO: 6, the amino acid sequence of CDR3 is such as SEQ ID NO: 7, and the amino acid sequence of VHH is such as SEQ ID NO: 8; or the amino acid sequence of CDR1 is such as SEQ ID NO: 9, the amino acid sequence of CDR2 is such as SEQ ID NO: 10, the amino acid sequence of CDR3 is such as SEQ ID NO: 11, and the amino acid sequence of VHH is such as SEQ ID NO: 12; or the amino acid sequence of CDR1 is such as SEQ ID NO: 13, the amino acid sequence of CDR2 is such as SEQ ID NO: 14, the amino acid sequence of CDR3 is such as SEQ ID NO: 15, and the amino acid sequence of VHH is such as SEQ ID NO: 16; or the amino acid sequence of CDR1 is such as SEQ ID NO: NO:17, the amino acid sequence of CDR2 is such as SEQ ID NO:18, the amino acid sequence of CDR3 is such as SEQ ID NO:19, and the amino acid sequence of VHH is such as SEQ ID NO:20; or the amino acid sequence of CDR1 is such as SEQ ID NO:21, the amino acid sequence of CDR2 is such as SEQ ID NO:22, the amino acid sequence of CDR3 is such as SEQ ID NO:23, and the amino acid sequence of VHH is such as SEQ ID NO:24; or the amino acid sequence of CDR1 is such as SEQ ID NO:25, and the amino acid sequence of CDR2 is such as SEQ ID NO:26; or the amino acid sequence of CDR3 is such as SEQ ID NO:27, and the amino acid sequence of VHH is such as SEQ ID NO:28; or the amino acid sequence of CDR1 is such as SEQ ID NO:29, the amino acid sequence of CDR2 is such as SEQ ID NO:30, the amino acid sequence of CDR3 is such as SEQ ID NO:31, and the amino acid sequence of VHH is such as SEQ ID NO:32; or the amino acid sequence of CDR1 is such as SEQ ID NO:33, and the amino acid sequence of CDR2 is such as SEQ ID NO: NO:34, the amino acid sequence of CDR3 is such as SEQ ID NO:35, and the amino acid sequence of VHH is such as SEQ ID NO:36; or the amino acid sequence of CDR1 is such as SEQ ID NO:37, the amino acid sequence of CDR2 is such as SEQ ID NO:38, the amino acid sequence of CDR3 is such as SEQ ID NO:39, and the amino acid sequence of VHH is such as SEQ ID NO:40;or an amino acid sequence of CDR1 such as SEQ ID NO:41, an amino acid sequence of CDR2 such as SEQ ID NO:42, an amino acid sequence of CDR3 such as SEQ ID NO:43, and an amino acid sequence of VHH such as SEQ ID NO:44; or an amino acid sequence of CDR1 such as SEQ ID NO:45, an amino acid sequence of CDR2 such as SEQ ID NO:46, an amino acid sequence of CDR3 such as SEQ ID NO:47, and an amino acid sequence of VHH such as SEQ ID NO:48; or an amino acid sequence of CDR1 such as SEQ ID NO:49, an amino acid sequence of CDR2 such as SEQ ID NO:50, an amino acid sequence of CDR3 such as SEQ ID NO:51, and an amino acid sequence of VHH such as SEQ ID NO:52; or an amino acid sequence of CDR1 such as SEQ ID NO:53, an amino acid sequence of CDR2 such as SEQ ID NO:54, an amino acid sequence of CDR3 such as SEQ ID NO:55, and an amino acid sequence of VHH such as SEQ ID NO:56; or an amino acid sequence of CDR1 such as SEQ ID NO: NO:57, the amino acid sequence of CDR2 is such as SEQ ID NO:58, the amino acid sequence of CDR3 is such as SEQ ID NO:59, and the amino acid sequence of VHH is such as SEQ ID NO:60.; 4. The anti-B7H3 nanobody according to claim 1, characterized in that: The anti-B7H3 nanobody is at least one of a monovalent nanobody, a multivalent nanobody, a multispecific nanobody or a fusion nanobody; preferably, the anti-B7H3 nanobody is an anti-B7H3 / CD3 bispecific antibody.

5. An isolated polynucleotide encoding the anti-B7H3 nanobody according to any one of claims 1 to 4; preferably, the nucleotide sequence of the isolated polynucleotide is shown in SEQ ID NO: 61-75. A recombinant vector comprising the isolated polynucleotide according to claim 5.

7. A host cell comprising the recombinant vector according to claim 6.

8. An immunoconjugate or pharmaceutical composition comprising the anti-B7H3 Nanobody according to any one of claims 1 to 4; preferably, the immunoconjugate further comprises a therapeutic agent, the therapeutic agent comprising: At least one of an immune checkpoint-related agent, a toxin, a factor, a drug, a radionuclide, a kinase inhibitor, or a cytotoxic agent.

9. Use of the anti-B7H3 nanobody according to any one of claims 1 to 4, the isolated polynucleotide according to claim 5, the recombinant vector according to claim 6, the host cell according to claim 7 or the immunoconjugate or pharmaceutical composition according to claim 8 in the preparation of a drug for preventing, diagnosing or treating tumors.

10. The use of claim 9 in preparing a drug for preventing, diagnosing or treating tumors, characterized in that: The tumor includes at least one of head and neck tumors, craniopharyngioma, prostate cancer, glioma, skin squamous cell carcinoma, melanoma, intestinal adenocarcinoma, gastric adenocarcinoma, pancreatic cancer, renal clear cell carcinoma, breast cancer, liver cancer, bladder cancer, cervical cancer, skin cancer, neuroblastoma, medulloblastoma, ovarian cancer, lung adenocarcinoma or acute myeloid leukemia.

Images