Recombinant botulinum neurotoxin expression strain and application thereof

Abstract

The invention relates to a recombinant botulinum neurotoxin expression strain. The recombinant botulinum neurotoxin expression strain is a genetic engineering recombinant strain which is obtained by cloning a botulinum neurotoxin gene into a hansenula polymorpha genome. The recombinant botulinum expression strain provided by the invention can tolerate the highest high temperature of 49 DEG C, the optimal growth temperature is 37-43 DEG C, accurate post-translational processing can be carried out, meanwhile, the recombinant botulinum expression strain has a metabolic pathway taking methanol as a carbon source and an energy source, and high-cell-density fermentation and stable production of foreign proteins can be achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a recombinant botulinum neurotoxin expression strain and application thereof. Background Art

[0002] Recombinant botulinum toxin refers to a botulinum toxin protein expressed in a non-pathogenic host bacteria by genetic recombination technology. Botulinum toxin (BoNT) is a neurotoxic protein produced by Clostridium botulinum and its related species, and is divided into seven types, A to G, according to specific serotypes. The toxin acts through different intracellular protein targets and exhibits different durations of effect and effects. In terms of efficacy, type A is the only toxin that has shown clinically important biological activity, and is therefore the most commonly studied and used serotype of botulinum toxin. Type B botulinum toxin also has certain clinical applications, mainly for the treatment of focal dystonia.

[0003] Recombinant botulinum neurotoxins type A and type B are single-chain proteins synthesized by recombinant botulinum expression strains. This single-chain protein is cut by a protease at a specific position to produce two polypeptide chains, namely light chain and heavy chain. These two polypeptide chains are connected by disulfide bonds to form a double-chain structure with biological activity. Figure 1 As shown in Figure 1, the botulinum toxin protein consists of a 50 kDa light chain and a 100 kDa heavy chain, which are connected by a disulfide bond. N and 50 kDa H C . All the type A and type B botulinum toxin products currently on the market at home and abroad are derived from pathogenic Clostridium botulinum, and the production process contains high biosafety risks. The production of botulinum toxin through a new recombinant protein technology route can significantly reduce the biosafety risks of the production process and greatly improve the purity of the product. This new technology route is an extremely complex system engineering with extremely high barriers and great difficulty. In the past few decades, only a few foreign companies in the world have achieved the production of recombinant protein botulinum toxin.

[0004] At present, there are mainly the following methods for preparing recombinant botulinum neurotoxin: Escherichia coli is used as a host cell, genes encoding the light chain and heavy chain of botulinum neurotoxin are inserted into its plasmid, and a connecting polypeptide sequence is added between the light chain and the heavy chain, so that a single-chain recombinant botulinum neurotoxin with neuroenzyme activity is expressed in Escherichia coli.

[0005] Yeast cells are used as host cells, genes encoding the light chain and heavy chain of botulinum neurotoxin are inserted into their plasmids or genomes, and a connecting polypeptide sequence is added between the light chain and the heavy chain, so that a single-chain recombinant botulinum neurotoxin without neuroenzyme activity is expressed in yeast cells. Subsequently, recombinant botulinum neurotoxin protein with neuroenzyme activity is obtained through purification, enzyme digestion and other steps.

[0006] Using the insect cell-insect virus expression system, genes encoding the light chain and heavy chain of botulinum neurotoxin are inserted into the insect virus, and a connecting polypeptide sequence is added between the light chain and the heavy chain, so that a single-chain recombinant botulinum neurotoxin with neuroenzyme activity is expressed in insect cells.

[0007] Mammalian cells are used as host cells, genes encoding the light chain and heavy chain of botulinum neurotoxin are inserted into their genome, and a connecting polypeptide sequence is added between the light chain and the heavy chain, so that recombinant botulinum neurotoxin in single-chain form or double-chain form (connected by disulfide bonds) with neuroenzyme activity is expressed in mammalian cells.

[0008] Recombinant botulinum toxin has a wide range of application prospects, mainly used in the fields of medical cosmetology, neurological diseases, dermatology, etc. For example, recombinant botulinum toxin type A for injection can be used to improve moderate to severe frown lines, facial wrinkles, facial paralysis, etc.

[0009] Therefore, there is an urgent need for a method for preparing a recombinant botulinum toxin expression strain that is simple, fast, efficient and universal, so as to greatly shorten the time for the research and development and industrialization of recombinant botulinum toxin, reduce safety risks, improve product purity, reduce costs and increase product returns. Summary of the invention

[0010] The first purpose of the present invention is to provide a recombinant botulinum neurotoxin expression strain to solve the problems of high biosafety risk, complex process, extremely high threshold and great difficulty in the current production process of botulinum toxin.

[0011] The second objective of the present invention is to provide a method for constructing the above-mentioned recombinant botulinum neurotoxin expression strain.

[0012] The present invention is achieved through the following technical solutions: 1. A recombinant botulinum neurotoxin expression strain, wherein the botulinum neurotoxin gene is cloned into Hansenula polymorpha ( Hansenula polymorpha ) genome and then obtained the genetically engineered recombinant strain.

[0013] Furthermore, the botulinum neurotoxin gene is selected from any one of botulinum neurotoxin genes of types A1, A2, A3, A4, A5, A6, A7, A8, B1, B2, B3, and B4.

[0014] Furthermore, the botulinum neurotoxin gene is selected from any one of botulinum neurotoxin genes of types A1, A6, and B2.

[0015] Furthermore, the nucleotide sequence of the botulinum neurotoxin type A1 gene is shown in SEQ ID No: 1, and the amino acid sequence of the translated protein is shown in SEQ ID No: 2.

[0016] Furthermore, the strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-A1, whose deposit number is CGMCC No.31883.

[0017] Furthermore, the nucleotide sequence of the A6 type botulinum neurotoxin gene is shown in SEQ ID No: 3, and the amino acid sequence of the translated protein is shown in SEQ ID No: 4.

[0018] Furthermore, the strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-A6, whose deposit number is CGMCC No.31884.

[0019] Furthermore, the nucleotide sequence of the botulinum neurotoxin type B2 gene is shown in SEQ ID No: 5, and the amino acid sequence of the translated protein is shown in SEQ ID No: 6.

[0020] Furthermore, the strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-B2, whose deposit number is CGMCC No.31885.

[0021] 2. A method for constructing a recombinant botulinum neurotoxin expression strain, the method comprising the following steps: (1) Obtaining recombinant botulinum neurotoxin-related genes by whole gene synthesis; (2) Connecting the botulinum neurotoxin-related gene to an expression vector, transforming it into an Escherichia coli cloning strain, and obtaining a recombinant botulinum neurotoxin plasmid strain through screening; (3) The obtained recombinant plasmid is extracted and transformed into Hansenula polymorpha cells.

[0022] The positive effects of adopting the above technical solution: the recombinant botulinum expression strain provided by the present invention can tolerate a maximum temperature of 49°C, the optimal growth temperature is 37-43°C, can carry out accurate post-translational processing, and has a metabolic pathway that uses methanol as a carbon source and energy source, can achieve high cell density fermentation, and stably produce exogenous protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 recombinant botulinum neurotoxin constructs; Figure 2 Recombinant botulinum toxin type A1 gene cleavage product; Figure 3 Recombinant A1 botulinum toxin plasmid monoclonal verification; Figure 4 Recombinant A6 botulinum toxin gene cleavage product; Figure 5 Recombinant A6 botulinum toxin plasmid monoclonal verification; Figure 6 Recombinant B2 botulinum toxin gene cleavage product; Figure 7 Recombinant B2 botulinum toxin plasmid monoclonal verification; Figure 8 Monoclonal verification of recombinant botulinum toxin A1 expressing bacteria; Fig. 9 Verification of monoclonal expression of recombinant botulinum toxin A6; Fig.10 Monoclonal verification of recombinant botulinum toxin B2 expressing strains; Fig.11 WB verified that the recombinant botulinum toxin expression strain rBN-A1 expressed recombinant botulinum toxin A1; Fig.12 WB verified that the recombinant botulinum toxin expression strain rBN-A6 expressed recombinant botulinum toxin A6; Fig.13 WB verified that the recombinant botulinum toxin expression strain rBN-B2 expressed recombinant botulinum toxin B2.

[0024] The polymorpha Hansenulatus involved in the present invention ( Hansenula polymorpha ) rBN-A1 was deposited under patent procedures on September 5, 2024 in a deposit center recognized by the China Patent Office or the International Patent Organization. The full name of the deposit unit is the General Microbiology Center of the China Microbiological Culture Collection Administration, abbreviated as CGMCC. The address of the deposit unit is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is: CGMCC No.31883.

[0025] The polymorpha Hansenulatus involved in the present invention ( Hansenula polymorpha ) rBN-A6 was deposited under patent procedures in a deposit center recognized by the China Patent Office or the International Patent Organization on September 5, 2024. The full name of the depository is the General Microbiology Center of the China Microbiological Culture Collection Administration, abbreviated as CGMCC. The address of the depository is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is: CGMCC No.31884.

[0026] The polymorpha Hansenulatus involved in the present invention ( Hansenula polymorpha ) rBN-B2 was deposited under patent procedures in a deposit center recognized by the China Patent Office or the International Patent Organization on September 5, 2024. The full name of the depository is the General Microbiology Center of the China Microbiological Culture Collection Administration, abbreviated as CGMCC. The address of the depository is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is: CGMCC No.31885. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below in conjunction with specific embodiments, but it should not be construed as limiting the present invention. Example

[0028] This example illustrates the construction of a recombinant A1 botulinum toxin plasmid.

[0029] According to the amino acid sequence of recombinant botulinum toxin type A1 (BoNT / A1) (GenBank: WP 011948511.1), Beijing Liuhe BGI Genomics Co., Ltd. was commissioned to perform codon optimization and synthesis on the coding gene of recombinant botulinum toxin type A1 (GenBank: KJ997761.1), and the sequence was obtained: SEQ ID No: 1, and the corresponding amino acid sequence was: SEQ ID No: 2.

[0030] The recombinant botulinum toxin A1 gene synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd. was used as a DNA template and single enzyme digestion was performed with BamHI. The enzyme digestion products were detected by electrophoresis, as shown in the attached Figure 2 As shown in lane 1, a target band of about 4000 bp was obtained, which was consistent with expectations. The digestion product in lane 2 was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) and named GDrBNA1. The digestion reaction system was: 10 μg of synthetic vector template, 10 μL of BamHI, 20 μL of digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 30°C for 30 minutes.

[0031] The expression vector pEco(A+) was digested with EcoRI and subjected to agarose gel electrophoresis. The 5700 bp linear expression vector pEco(A+) was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The product was named GEco(A+). The enzyme digestion reaction system was: 10 μg of expression vector, 10 μL of EcoRI, 20 μL of enzyme digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 37°C for 30 minutes.

[0032] GDrBNA1 was assembled with the linearized expression vector GEco(A+) by Gibson using the seamless cloning kit of ClonExpress MultiS One Step CloningKit of Nanjing Novogene Biotechnology Co., Ltd. The reaction system was: 1 μL linearized expression vector, 2 μL gene template, 2 μL reaction buffer, 1 μL Gibson recombinase, and deionized water was used to make up to 10 μL. The reaction conditions were: 37°C for 30 minutes. The above assembly product was transformed into Escherichia coli DH5α competent cells, and the transformed cells were spread onto LB+Amp solid medium and placed in a 37°C incubator until colonies grew.

[0033] The primer sequences are as follows: Primer 1: TGCAGTGACTCCGACATCCC (SEQ ID No: 7); Primer 2: TCTCAAAAGCGGTATGTCCT (SEQ ID No: 8).

[0034] Use primers 1 and 2 to perform PCR verification on single colony transformants. Use a 10 μL pipette tip or toothpick to randomly pick a certain number of single colonies, streak them on another solid culture medium plate, and mark them. Then add the pipette tip or toothpick to the PCR reaction solution and add the bacteria to the PCR reaction solution by blowing. Detect the PCR product by agarose gel electrophoresis.

[0035] like Figure 3 As shown in lanes 1-48, bands of about 4000 bp were amplified, which was consistent with expectations, that is, the single colonies corresponding to these lanes were the expected positive transformants. The correctly verified transformants were inoculated into LB+Amp liquid culture medium, cultured in a shaker at 37°C and 200 rpm, and the plasmids were extracted for sequencing verification. The recombinant plasmid that was correctly verified by sequencing was named p rBNA1. Example

[0036] This example illustrates the construction of a recombinant A6-type botulinum toxin plasmid.

[0037] According to the amino acid sequence of recombinant botulinum toxin type A6 (BoNT / A6) (GenBank: ACW83608.1), Beijing Liuhe BGI Genomics Co., Ltd. was commissioned to perform codon optimization and synthesis on the coding gene of recombinant botulinum toxin type A6 (GenBank: FJ981696.1), and the sequence was obtained: SEQ ID No.3, and the corresponding amino acid sequence was: SEQ ID No: 4.

[0038] The recombinant botulinum toxin A6 gene synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd. was used as a DNA template and digested with BamHI. The PCR product was detected by electrophoresis, as shown in the attached Figure 4 As shown in lanes 1-2, a target band of about 4000 bp was obtained, which was consistent with expectations. The PCR product in lanes 2-3 was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) and named GDrBNA6. The enzyme digestion reaction system was: 10 μg of synthetic vector template, 10 μL of BamHI, 20 μL of enzyme digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 30°C for 30 minutes.

[0039] The expression vector pEco(A+) was digested with EcoRI and subjected to agarose gel electrophoresis. The 5700 bp linearized expression vector pEco(A+) was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the product was named GEco(A+). The enzyme digestion reaction system was: 10 μg of expression vector, 10 μL of EcoRI, 20 μL of enzyme digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 37°C for 30 minutes. GDrBNA6 and the linearized expression vector GEco(A+) were Gibson assembled using the seamless cloning kit of ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. The reaction system was: 1 μL of linearized expression vector, 2 μL of gene template, 2 μL of reaction buffer, 1 μL of Gibson recombinase, and deionized water was used to make up to 10 μL. The reaction conditions were: 37°C for 30 minutes. The above-mentioned assembled products were transformed into Escherichia coli DH5α competent cells, and the transformed cells were spread onto LB+Amp solid culture medium and placed in a 37°C incubator until colonies grew.

[0040] The primer sequences are as follows: Primer 3: ACCCACTGCTGTCTGTGCCTGCTA (SEQ ID No: 9); Primer 4: GCCAAGTTGGTGTTTCTCAAG (SEQ ID No: 10).

[0041] Use primers 3 and 4 to perform PCR verification on single colony transformants. Use a 10 μL pipette tip or toothpick to randomly pick a certain number of single colonies, streak them on another solid culture medium plate, and mark them. Then add the pipette tip or toothpick to the PCR reaction solution and add the bacteria to the PCR reaction solution by blowing. Detect the PCR product by agarose gel electrophoresis.

[0042] like Figure 5 As shown in lanes 1-15, bands of about 1500 bp were amplified, which was consistent with expectations, that is, the single colonies corresponding to these lanes were the expected positive transformants. The correctly verified transformants were inoculated into LB+Amp liquid culture medium, cultured in a shaker at 37°C and 200 rpm, and the plasmids were extracted for sequencing verification. The recombinant plasmid that was correctly verified by sequencing was named p rBNA6. Example

[0043] This example illustrates the construction of a recombinant B2 type botulinum toxin plasmid.

[0044] According to the amino acid sequence of recombinant botulinum toxin type B2 (BoNT / B2) (GenBank: WP 032072540.1), Beijing Liuhe BGI Genomics Co., Ltd. was commissioned to perform codon optimization and synthesis on the coding gene of recombinant botulinum toxin type A1 (GenBank: AB855771.1), and the sequence obtained was: SEQ ID No.5, and the corresponding amino acid sequence was: SEQID No: 6.

[0045] The recombinant B2 botulinum toxin gene synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd. was used as a DNA template and digested with BamHI. The PCR product was detected by electrophoresis, as shown in the attached Figure 6 As shown in lane 2, a target band of about 4000 bp was obtained, which was consistent with expectations. The PCR product in lane 2 was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) and named GDrBNB2. The enzyme digestion reaction system was: 10 μg of synthetic vector template, 10 μL of BamHI, 20 μL of enzyme digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 30°C for 30 minutes.

[0046] The expression vector pEco(A+) was digested with EcoRI and subjected to agarose gel electrophoresis. The linear expression vector pEco(A+) of about 5700 bp was purified and recovered using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The enzyme digestion reaction system was: 10 μg of expression vector, 10 μL of EcoRI, 20 μL of enzyme digestion reaction buffer, and deionized water was used to make up to 200 μL. The reaction was carried out in a metal bath at 37°C for 30 minutes.

[0047] GDrBNB2 was assembled with the linearized expression vector pEco(A+) by Gibson using the seamless cloning kit of ClonExpress MultiS One Step CloningKit from Nanjing Novozyme Biotechnology Co., Ltd. The reaction system was: 2 μL linearized expression vector, 4 μL recombinant B2 botulinum toxin protein encoding gene, 2 μL reaction buffer, 1 μL Gibson recombinase, and deionized water was used to make up to 10 μL. The reaction conditions were: 37°C for 30 minutes. The above assembly product was transformed into Escherichia coli DH5α competent cells, and the transformed cells were spread onto LB+Amp solid medium and placed in a 37°C incubator until colonies grew.

[0048] The primer sequences are as follows: Primer 1: TGCAGTGACTCCGACATCCC (SEQ ID No: 7); Primer 2: TCTCAAAAGCGGTATGTCCT (SEQ ID No: 8).

[0049] Use primers 1 and 2 to perform PCR verification on single colony transformants. Use a 10 μL pipette tip or toothpick to randomly pick a certain number of single colonies, streak them on another solid culture medium plate, and mark them. Then add the pipette tip or toothpick to the PCR reaction solution and add the bacteria to the PCR reaction solution by blowing. Detect the PCR product by agarose gel electrophoresis.

[0050] like Figure 7 As shown in lanes 1-11, bands of about 4000 bp were amplified, which was consistent with expectations, that is, the single colonies corresponding to these lanes were the expected positive transformants. The correctly verified transformants were inoculated into LB+Amp liquid medium, cultured in a shaker at 37°C and 200 rpm, and the plasmids were extracted for sequencing verification. The recombinant plasmid that was correctly verified by sequencing was named p rBNB2. Example

[0051] This example illustrates the transformation and screening of recombinant botulinum toxin expression strains.

[0052] The recombinant plasmids prBNA1 / prBNA6 / prBNB2 were respectively Bam After HI digestion, the products were recovered by alcohol precipitation, and the recovered products were electro-transformed into Hansenula sp. The transformed yeast cells were spread onto SD-Ura solid culture medium plates and placed in a 37°C incubator until colonies grew.

[0053] Single clones of Hansenula colonies on SD-Ura plates were selected and identified by PCR. Single clones of Hansenula colonies in which the recombinant plasmid was integrated into the genome of Hansenula were selected for subsequent induced expression.

[0054] The primer sequences are as follows: Primer 1: TGCAGTGACTCCGACATCCC (SEQ ID No: 7); Primer 5: TGGTCTTGCTGGTGATGATG (SEQ ID No: 11).

[0055] like Figure 8 As shown in lanes 1-31, a band of about 1500 bp was amplified using primers 1 and 5, which was consistent with expectations, that is, the single colonies corresponding to lanes 1-8, 10-12, 14-20, 22-24 and 28 were the expected positive recombinant botulinum toxin A1 monoclonal colonies.

[0056] The primer sequences are as follows: Primer 1: TGCAGTGACTCCGACATCCC (SEQ ID No: 7); Primer 4: GCCAAGTTGGTGTTTCTCAAG (SEQ ID No: 10).

[0057] like Fig. 9 As shown in lanes 1-30, a band of about 1500 bp was amplified using primers 1 and 4, which was consistent with expectations. The single colonies corresponding to lanes 2-10, 13-15, 17-23, and 29-30 were the expected positive recombinant botulinum toxin A6 monoclonal colonies.

[0058] The primer sequences are as follows: Primer 1: TGCAGTGACTCCGACATCCC (SEQ ID No: 7); Primer 6: ACGGACTTACACATCTGGATC (SEQ ID No: 12).

[0059] like Fig.10As shown in lanes 1-16, a band of about 1500 bp was amplified using primers 1 and 6, which was consistent with expectations. The single colonies corresponding to lanes 1-2, 4-13, and 15-16 were the expected positive recombinant botulinum toxin B2 monoclonal colonies.

[0060] Preparation of Hansen yeast competent cells and electroporation conditions are prior art, and reference may be made to Faber KN, Haima P, Harder W, et al . Highly-efficient electrotransformation of theyeast Hansenula polymorpha [J]. Current genetics, 1994, 25 (4): 305-310.

[0061] Preparation of competent cells: Pick a single colony in 5 mL YPD liquid medium and culture at 37℃ for 36 h until the colony grows to saturation. Take 5 mL and inoculate it into 200 mL YPD liquid medium and culture at 37℃ until OD 600 =2.0-3.0. Centrifuge at 3000 g for 10 min to pellet the cells. Add 50 mL TED solution. Incubate at 37℃ on a shaker for 15 min. Centrifuge at 3000 g for 10 min at 4℃ to pellet the cells. Add 200 mL pre-cooled 270 mM sucrose solution to suspend the cells. Centrifuge at 3000 g for 10 min at 4℃ to pellet the cells. Add 100 mL pre-cooled 270 mM sucrose to gently suspend the cells. Centrifuge at 3000 g for 10 min at 4℃ to pellet the cells. Add 1 mL pre-cooled 270 mM sucrose solution to gently suspend the cells, aliquot into 100 μL / tube, and use immediately or store at -80℃.

[0062] Electroporation operation steps: Add 10 μg of linearized prBNA1 or prBNA6 or prBNB2 vector to 100 μL competent cells, transfer the mixture into the groove of an electroporation cup with an inner diameter of 2 mm, and place on ice for 30 minutes. Set the electroporation parameters: capacitance 50 μF, resistance 100 Ω, voltage 1.5 kV. Immediately after the electroporation, add 1 mL of YPDTM medium and transfer to a 1.5 mL sterile centrifuge tube. Incubate at 37 °C on a shaker for 60 minutes. Centrifuge at 3000 g for 5 min, remove the supernatant, spread on SD-Ura solid medium, and place in a 37 °C incubator until colonies grow. Example

[0063] This example illustrates the inducible expression of recombinant botulinum toxin protein.

[0064] The recombinant botulinum toxin expression strains rBN-A1 / rBN-A6 / rBN-B2 selected in the preliminary screening were inoculated into 15 mL of BMGY medium and cultured at 37°C for 24-48 hours. 5 mL of bacterial suspension was taken for bacterial preservation, and the remaining bacterial suspension was centrifuged at 6000 rpm, the supernatant was discarded, and the bacterial pellet was resuspended in 10 mL of BMMY medium and cultured for 72 hours. During this period, methanol was added once every 24 hours at a ratio of 1 / 100 (methanol: medium).

[0065] After the culture was completed, the cells were harvested by centrifugation at 6000 rpm, washed once with PB solution, and a portion of the cells was taken for Western Blot detection to confirm whether the three recombinant botulinum toxins A1 / A6 / B2 were expressed.

[0066] Depend on Fig.11 The results showed that lanes 2-3, 5-6, and 10 showed that the recombinant botulinum toxin expression strain rBN-A1 expressed recombinant botulinum toxin A1. Fig.12 The results showed that lanes 2-6 and 9 showed that the recombinant botulinum toxin expression strain rBN-A6 expressed recombinant botulinum toxin A6. Fig.13 The results showed that lanes 2-3, 5-10 showed that the recombinant botulinum toxin expression strain rBN-B2 expressed recombinant botulinum toxin B2.

[0067] The recombinant botulinum toxin expression strain provided by the present invention can tolerate a maximum temperature of 49°C, has an optimal growth temperature of 37-43°C, can carry out accurate post-translational processing, and has a metabolic pathway using methanol as a carbon source and energy source, can achieve high cell density fermentation, and stably produce exogenous proteins.

Claims

1. A recombinant botulinum neurotoxin expressing strain, characterized in that: This strain is a clone of the botulinum neurotoxin gene into Hansenula polymorpha ( Hansenula polymorpha ) genome and then obtained the genetically engineered recombinant strain.

2. The recombinant botulinum neurotoxin expressing strain according to claim 1, characterized in that: The botulinum neurotoxin gene is selected from any one of botulinum neurotoxin genes of types A1, A2, A3, A4, A5, A6, A7, A8, B1, B2, B3, and B4.

3. The recombinant botulinum neurotoxin expressing strain according to claim 2, characterized in that: The botulinum neurotoxin gene is selected from any one of botulinum neurotoxin genes of types A1, A6, and B2.

4. The recombinant botulinum neurotoxin expressing strain according to claim 3, characterized in that: The nucleotide sequence of the botulinum neurotoxin type A1 gene is shown in SEQ ID No: 1, and the amino acid sequence of the translated protein is shown in SEQ ID No:

2.

5. The recombinant botulinum neurotoxin expressing strain according to claim 4, characterized in that: This strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-A1, whose deposit number is CGMCC No.31883.

6. The recombinant botulinum neurotoxin expressing strain according to claim 3, characterized in that: The nucleotide sequence of the A6 type botulinum neurotoxin gene is shown in SEQ ID No:3, and the amino acid sequence of the translated protein is shown in SEQ ID No:

4.

7. The recombinant botulinum neurotoxin expressing strain according to claim 6, characterized in that: This strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-A6, whose deposit number is CGMCC No.31884.

8. The recombinant botulinum neurotoxin expressing strain according to claim 3, characterized in that: The nucleotide sequence of the botulinum neurotoxin type B2 gene is shown in SEQ ID No:5, and the amino acid sequence of the translated protein is shown in SEQ ID No:

6.

9. The recombinant botulinum neurotoxin expressing strain according to claim 8, characterized in that: This strain is Hansenula polymorpha ( Hansenula polymorpha )rBN-B2, whose deposit number is CGMCC No.31885.

10. A method for constructing a recombinant botulinum neurotoxin expression strain, characterized in that: The method comprises the following steps: (1) Obtaining recombinant botulinum neurotoxin-related genes by whole gene synthesis; (2) Connecting the botulinum neurotoxin-related gene to an expression vector, transforming it into an Escherichia coli cloning strain, and obtaining a recombinant botulinum neurotoxin plasmid strain through screening; (3) The obtained recombinant plasmid is extracted and transformed into Hansenula polymorpha cells.

Images