Flavin monooxygenase FMO mutant and application thereof in indigo production

Abstract

The invention discloses a flavin monooxygenase FMO mutant and application thereof in indigo production, and belongs to the technical field of microbial engineering. Through rational design, directional mutation or random mutation, a mutant with catalytic efficiency several times higher than that of wild-type flavin monooxygenase is obtained, then the mutant is integrated into escherichia coli to obtain a recombinant strain capable of expressing the mutant, and the obtained recombinant strain not only can realize cyclic regeneration of cofactors, but also can be used for preparing the flavin monooxygenase. An expensive cofactor NADPH does not need to be additionally added, so that the effects of saving materials and reducing the production cost are achieved; the fermentation period can be shortened, and the yield of indigo blue is increased and reaches the g-level level. Therefore, the flavin monooxygenase mutant and the constructed recombinant bacteria have good application prospects in the field of indigo production, and large-scale industrial production of indigo is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial engineering, and in particular to a flavin monooxygenase FMO mutant and application thereof in the production of indigo. Background Art

[0002] Indigo is a blue pigment that has been used for thousands of years. It has the characteristics of bright color, strong durability and high safety. In addition, indigo also has medical value such as coagulation, antipyretic, anti-inflammatory and anti-tumor activity. Natural indigo pigment is mainly extracted from plants such as indigo, indigo, and wild green tree, but due to its low efficiency, it is difficult to meet market demand and has gradually been replaced by chemical synthesis. The chemical synthesis method has the advantages of simple production process and high yield, but its substrates aniline and nitrobenzene are harmful to the human body and produce toxic wastewater during the production process. In comparison, the method of producing indigo by microbial fermentation is low-cost, the raw materials are easy to obtain, and it conforms to the concept of green development.

[0003] It is reported that microorganisms such as Pseudomonas sp., Acinetobacter sp., and Bacillus megatreium can produce indigo. However, natural indigo-producing strains still have low yields and long fermentation cycles, resulting in high production costs. Therefore, obtaining a strain that can quickly synthesize indigo will help reduce production costs and improve production efficiency in large-scale industrial production.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a flavin monooxygenase FMO mutant and its application in the production of indigo. By constructing a recombinant strain expressing the flavin monooxygenase FMO mutant, indigo can be produced efficiently and quickly using indole as a substrate.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides a flavin monooxygenase FMO mutant, the amino acid sequence of which is obtained by mutation of the amino acid sequence shown in SEQ ID NO: 1, and the mutation sites of the mutant include:

[0008] (1) Histidine at position 164 was mutated to asparagine;

[0009] (2) Lysine 223 mutated to arginine;

[0010] (3) Glutamine at position 318 was mutated to leucine.

[0011] In a second aspect, the present invention provides a nucleic acid molecule encoding the above-mentioned flavin monooxygenase FMO mutant.

[0012] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned nucleic acid molecule.

[0013] In a fourth aspect, the present invention provides a recombinant bacterium comprising the above-mentioned recombinant vector.

[0014] In a fifth aspect, the present invention provides the use of the above-mentioned flavin monooxygenase FMO mutant, nucleic acid molecule, recombinant vector or recombinant bacteria in the production of indigo and its downstream products.

[0015] In a sixth aspect, the present invention provides a method for producing indigo, comprising: constructing a recombinant bacterium expressing the above-mentioned flavin monooxygenase FMO mutant and transhydrogenase PntAB, using indole as a substrate, and utilizing the recombinant bacterium to ferment and produce indigo.

[0016] The present invention has the following beneficial effects:

[0017] The present invention obtains a mutant whose catalytic efficiency is several times higher than that of the wild-type flavin monooxygenase through rational design, directed mutation or random mutation, and then integrates it into Escherichia coli to obtain a recombinant strain capable of expressing the mutant. The obtained recombinant strain can not only realize the recycling of cofactors without the need to add expensive cofactor NADPH, thereby saving materials and reducing production costs; it can also shorten the fermentation cycle and increase the indigo yield, so that its yield reaches the g-level. Therefore, the flavin monooxygenase mutant of the present invention and the constructed recombinant bacteria have good application prospects in the field of indigo production, and are helpful to promote the large-scale industrial production of indigo. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0019] Figure 1 This is the indigo production result in Example 5. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0021] At present, the enzymes that catalyze the synthesis of indigo mainly include non-heme iron oxygenase, heme oxygenase and flavin-dependent monooxygenase (FMO), which can convert indole into indoxyl, and then spontaneously oxidize indoxyl into indigo. Based on FMO, the present invention obtains a mutant whose catalytic efficiency is several times higher than that of the wild-type FMO through rational design, directed mutation or random mutation, and then constructs a recombinant bacterium expressing the above mutant and the NADP transhydrogenase gene pntAB, which can efficiently catalyze the reaction of indole into indigo.

[0022] The flavin monooxygenase FMO is derived from Methylophaga aminisulfdivorans, and its amino acid sequence is shown in SEQ ID NO: 1. The amino acid sequence of the flavin monooxygenase FMO mutant obtained based on the flavin monooxygenase FMO is shown in SEQ ID NO: 2.

[0023] Specifically, the mutation sites of the flavin monooxygenase FMO mutant in the present invention are: histidine at position 164 is mutated to asparagine; lysine at position 223 is mutated to arginine; glutamine at position 318 is mutated to leucine, that is, H164N, K223R and Q318L.

[0024] Specifically, the preparation method of the flavin monooxygenase FMO mutant in the present invention is as follows: codon optimization is performed on the flavin monooxygenase FMO gene derived from Methylophaga aminisulfdivorans, and its amino acid sequence is shown in SEQ ID NO: 1, the optimized flavin monooxygenase FMO gene is PCR amplified, and the amplified flavin monooxygenase FMO gene is diluted as a template for error-prone PCR amplification to obtain the flavin monooxygenase FMO mutant.

[0025] The NADP transhydrogenase gene pntAB is composed of two subunits, pntA and pntB, which are located adjacently on the genome. In the present invention, pntAB is derived from Escherichia coli BL21 (DE3), and its amino acid sequence is shown in SEQ ID NO: 3-4.

[0026] The recombinant vector provided by the present invention is a DNA molecule containing a nucleotide molecule encoding the flavin monooxygenase FMO mutant or a complementary sequence thereof.

[0027] Among them, the vector can be selected from conventional expression vectors in the art, such as pET-21b(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b(+), pET-28a(+), pET-29a(+), pET-30a(+), pUC-18 or pUC-19.

[0028] The above recombinant vector can be obtained by existing preparation methods, for example: PCR amplification to obtain the gene fragment of the flavin monooxygenase FMO mutant, using the expression vector as a template, designing primers to obtain a linearized vector by reverse PCR amplification, and then connecting the linearized vector with the gene fragment of the mutant by a recombinase to obtain a recombinant vector with the flavin monooxygenase FMO mutant gene fragment inserted. The above method can also be used to obtain a recombinant vector with the NADP transhydrogenase gene pntAB gene fragment inserted.

[0029] The recombinant bacteria provided by the present invention contain the above-mentioned recombinant vector.

[0030] In some embodiments, the host cell of the above-mentioned recombinant bacteria can be a prokaryotic cell or a eukaryotic cell; the prokaryotic cell can be Escherichia coli, preferably, the Escherichia coli can be Escherichia coli BL21 (DE3), Escherichia coli DH5α and Escherichia coli XL-Blue.

[0031] The above-mentioned recombinant bacteria can be obtained by existing preparation methods, for example, the obtained recombinant vector is introduced into the starting strain by chemical transformation to produce a recombinant bacteria expressing the target gene.

[0032] The present invention obtains the above-mentioned flavin monooxygenase FMO mutant through mutation screening, and the mutant and related biomaterials can be used to efficiently produce indigo and its downstream products. Therefore, the present invention also provides a method for producing indigo based on the above-mentioned mutant, which can be applied to different production scenarios, such as shake flask fermentation and fermentation tank fermentation.

[0033] The shake flask fermentation method comprises the following steps:

[0034] (1) streak the recombinant bacterial solution onto a culture medium plate for cultivation;

[0035] (2) picking up the fresh bacterial colonies in step (1) and culturing them in a shake flask;

[0036] (3) transferring the bacterial solution after culturing in step (2) to a fermentation medium for shake flask culture;

[0037] (4) adding an inducer at the initial stage of inoculation to induce expression;

[0038] (5) 2 h after induction of expression, indole was added as a substrate.

[0039] In some embodiments, the culture conditions in step (1) are: overnight culture at 37° C. and 180-220 rpm, and the culture medium used is LB culture medium.

[0040] In some embodiments, the culture conditions in step (2) are: culture at 37° C. and 180-220 rpm until the logarithmic growth phase, and the culture medium used is LB culture medium with a liquid volume of 10%-20%.

[0041] In some embodiments, the culture conditions in step (3) are: the OD of cells pre-cultured in a shake flask is 600 When the temperature reaches about 5, transfer the mixture to a conical flask containing fermentation medium (10% liquid volume) according to 10% inoculation amount, and ferment at 25-30°C and 220rpm. Stop fermentation after 24h.

[0042] The components of the fermentation medium include: yeast powder 24g / L, Na2HPO4 6.78g / L, KH2PO43g / L, NaCl0.5g / L, NH4Cl 1g / L, MgSO4 0.241-0.3615g / L, CaCl2 0.011-0.022g / L, CaCO3 10-40g / L, and glucose 10-40g / L.

[0043] In some embodiments, the induction agent in step (4) is 0.05 mM IPTG, the induction conditions are 25-30°C, OD 600 =0.6-0.8.

[0044] In some embodiments, the amount of indole added in step (5) is 0.5-1 g / L each time, and the indole is added every 2 hours after induction.

[0045] The method of fermentation in a fermenter comprises the following steps:

[0046] (1) streak the recombinant bacterial solution onto a culture medium plate for cultivation;

[0047] (2) picking up the fresh recombinant colonies from step (1) and culturing them in a shake flask;

[0048] (3) transferring the bacterial liquid cultured in step (2) to a fermentation tank for fermentation;

[0049] (4) In OD 600 =5, add the inducer to induce expression;

[0050] (5) 6-10 h after induction, start supplementing indole as a substrate.

[0051] In some embodiments, the culture conditions in step (1) are: overnight culture at 37° C., and the culture medium used is LB solid culture medium.

[0052] In some embodiments, the culture conditions in step (2) are: culture at 37° C. and 180-220 rpm until the logarithmic growth phase, and the culture medium used is LB culture medium with a liquid volume of 10%-20%.

[0053] In some embodiments, the culture conditions in step (3) are: fermentation temperature 25-30°C, pH = 6.5-7.5, dissolved oxygen content 25%-35%, stirring associated dissolved oxygen, and stopping fermentation after 72 hours.

[0054] The components of the fermentation medium include: yeast powder 24g / L, Na2HPO4 6.78g / L, KH2PO43g / L, NaCl0.5g / L, NH4Cl 1g / L, MgSO4 0.241-0.3615g / L, CaCl2 0.011-0.022g / L, nicotinic acid 20-40mM, defoaming agent 0.5-2mL / L, glucose 10-40g / L, and the initial liquid volume is 200mL.

[0055] In some embodiments, the conditions for inducing expression in step (4) are: the inducing agent is 0.05 mM IPTG, the induction temperature is 25-30°C, and the OD 600 =0.6-0.8.

[0056] In some embodiments, the method of adding indole in step (5) can refer to the aforementioned shake flask fermentation, and those skilled in the art can also adjust it according to actual production conditions.

[0057] The above production method can obtain a higher yield of indigo, and the process is simple, the production cost is low, and the raw materials are easily available, which is helpful to promote the large-scale industrial production of indigo.

[0058] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0059] The Escherichia coli BL21 (DE3) strain used in the present invention was purchased from Beijing Qingke Biotechnology Co., Ltd., the expression vectors pACYC and pET-28a used were purchased from Wuhan Miaoling Biotechnology Co., Ltd., and the indigo standard used was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0060] Example 1

[0061] This example is the construction of the expression vector pACYC-pntAB

[0062] The specific steps are as follows:

[0063] 1) PCR amplification of the NADP transhydrogenase gene pntAB from Escherichia coli BL21 (DE3), the protein sequence of pntAB is shown in SEQ ID NO:3 and SEQ ID NO:4, and the required primer nucleotide sequences are shown in SEQ ID NO:5 and SEQ ID NO:6; the PCR amplification conditions are 98°C denaturation, 60°C annealing, 72°C extension, and 30 cycles; the pntAB gene of the target fragment is obtained.

[0064] 2) Using plasmid pACYC as a template, linear expression vector pACYC was obtained by inverse PCR. The PCR amplification conditions were 98°C denaturation, 58°C annealing, 72°C extension, and 30 cycles;

[0065] 3) The target fragment pntAB and the linearized vector pACYC were connected by Novizan recombinase C112, and the enzyme reaction conditions were 37°C for 30 min. The expression vector pACYC-pntAB was obtained and transferred into E. coli BL21 competent cells by chemical transformation;

[0066] The primers and gene sequences of PCR amplification involved in this embodiment are shown in Table 1:

[0067] Table 1 Primer sequence information

[0068] Primer name Sequence information Sequence number pntAB-F AATAAGGAGATATACCATGGATGGAAGGGAATATCATGCGAATTG SEQ ID NO:5 pntAB-R TACTTTCTGTTCGACTTAAGTTACAGAGCTTTCAGGATTGCATCC SEQ ID NO:6

[0069] Example 2

[0070] This example is the construction of the expression vector pET28a-FMO*

[0071] The specific steps are as follows:

[0072] 1) Codon optimization was performed on the flavin monooxygenase gene FMO from Methylophaga aminisulfdivorans, and the protein sequence of the flavin monooxygenase gene FMO is shown in SEQ ID No: 1;

[0073] 2) The optimized FMO gene was amplified by PCR, and the required primer nucleotide sequences were shown in SEQ ID No: 7 and SEQ ID No: 8 to obtain the FMO gene of the target fragment. PCR amplification conditions: 98°C denaturation, 60°C annealing, 72°C extension, 30 cycles;

[0074] 3) The FMO gene amplified in step 2) was diluted 100 times and used as a template for error-prone PCR amplification. The required primer nucleotide sequences are shown in SEQ ID No: 7 and SEQ ID No: 8.

[0075] The error-prone PCR system is a 100μL system with the following components: 51μL ddH2O, 10μL 100mM Tris-Cl, 2.5μL 2M KCl, 3.5μL 200mM MgCl2, 4μL 25mM dCTP, 4μL 25mM dTTP, 4μL 5mM dATP, 4μL 5mMdGTP, 4μL primer, 2μL 25mM MnCl2, 1μL taq DNA polymerase, and 10μL template.

[0076] PCR amplification conditions: 98℃ denaturation, 65-55℃ annealing, 72℃ extension, 40 cycles. After obtaining the mutant FMO* gene, use the Qingke Bio DNA Gel Recovery Kit to perform gel recovery and purification;

[0077] 4) Using plasmid pET28a as a template, linear expression vector pET28a was obtained by reverse PCR amplification. PCR amplification conditions: 98°C denaturation, 59°C annealing, 72°C extension, 30 cycles;

[0078] 5) The target fragment FMO* and the linearized vector pET28a were connected by Novizan recombinase C112, and the enzyme reaction conditions were 37°C for 30 min. The expression vector pET28a-FMO* was obtained and transferred into E. coli pACYC-pntAB-BL21 competent cells by chemical transformation;

[0079] The primers and gene sequences of PCR amplification involved in this embodiment are shown in Table 2:

[0080] Table 2 Primer sequence information

[0081] Primer name Sequence information Sequence number FMO-F TAAGAAGGAGATATACATGGCGACCCGTATCGCAATCC SEQ ID NO:7 FMO-R GCTTGTCGACGGAGCTCGAATTCTTACGCTTCTTTCGCAACCGG SEQ ID NO:8

[0082] Example 3

[0083] This example is a rapid screening of high indigo-producing strains using pET28a-FMO*-BL21.

[0084] The specific steps are as follows:

[0085] 1) Pick fresh pET28a-FMO / pET28a-FMO*-BL21 colonies into a 96-well plate containing 800 μL LB medium in each well, and culture at 37°C, 1000 rpm for 6 h. Pick only 6 pET28a-FMO-BL21 colonies as a control, and pick pET28a-FMO*-BL21 colonies in all the remaining 90 wells;

[0086] 2) The pET28a-FMO / pET28a-FMO*-BL21 bacterial solution cultured in step 1) was transferred to a 96-well plate containing 720 μL of fermentation medium per well at a 10% inoculation rate for culture at 30° C. and 1000 rpm for a total fermentation time of 24 h;

[0087] 3) After inoculation, culture until the bacterial OD 600 =0.6-0.8, add IPTG with a final concentration of 0.05mM for induction, and the induction temperature is 30°C;

[0088] 4) After 24 hours of fermentation, take 10 μL of fermentation broth sample from each well and dilute it in 190 μL of DMSO, and measure the absorbance at a wavelength of 610 nM using a microplate reader;

[0089] 5) Compare the absorbance values, and take the strain with the higher absorbance value and preserve it with 40% glycerol in a 1:1 ratio;

[0090] The fermentation medium formula is: yeast powder 24g / L, Na2HPO4 6.78g / L, KH2PO4 3g / L, NaCl0.5g / L, NH4Cl 1g / L, MgSO4 0.241g / L, CaCl2 0.011g / L, glucose 4g / L, in which 0.5g / L indole is added as a substrate.

[0091] Example 4

[0092] This example is a shake flask fermentation validation of pET28a-FMO*-BL21

[0093] The specific steps are as follows:

[0094] 1) The pET28a-FMO*-BL21 bacterial solution preserved in Example 2 was streaked onto an LB medium plate and cultured at 37°C and 220 rpm for 16 h;

[0095] 2) Pick the pET28a-FMO*-BL21 colony cultured in step 1) and place it in a 500 mL shake flask filled with 10% LB medium. Place it at 37°C and 220 rpm for shaking until the OD 600 About 5, it takes about 6 hours;

[0096] 3) The pET28a-FMO*-BL21 bacterial solution cultured in step 2) was transferred to a 500 mL shake flask filled with 10% fermentation medium at a 10% inoculation rate, and the shake flask was cultured at 30° C. and 220 rpm until the fermentation was completed. The total fermentation time was 36 h;

[0097] 4) After inoculation, culture until OD 600 =0.6-0.8, add IPTG with a final concentration of 0.05mM, and induce expression at 30°C;

[0098] 5) Every 2 h after induction, 0.5 g / L indole was added as a substrate;

[0099] The fermentation medium formula is: yeast powder 24g / L, Na2HPO4 6.78g / L, KH2PO4 3g / L, NaCl0.5g / L, NH4Cl 1g / L, MgSO4 0.241g / L, CaCl2 0.011g / L, CaCO3 10g / L, glucose 4g / L.

[0100] The strain screened in Example 3 was subjected to shake flask fermentation to determine the indigo yield, and the plasmid of the strain with high indigo yield in shake flask fermentation was extracted for sequencing and identification. The protein sequence is shown in SEQ ID NO: 2, wherein the mutation site is H164N / K223R / Q318L, and the maximum yield of the strain can reach 2.76 g / L.

[0101] Comparative Example 1

[0102] 1) Using BL21 as the chassis strain, construct the pET28a-FMO plasmid and introduce it into the BL21 strain by chemical transformation;

[0103] 2) performing shake flask fermentation according to the steps in Example 4;

[0104] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0105] Comparative Example 2

[0106] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO plasmid was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0107] 2) performing shake flask fermentation according to the steps in Example 4;

[0108] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0109] Comparative Example 3

[0110] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (C78I) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0111] 2) performing shake flask fermentation according to the steps in Example 4;

[0112] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0113] Comparative Example 4

[0114] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (C78I / S23A) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0115] 2) performing shake flask fermentation according to the steps in Example 4;

[0116] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0117] Comparative Example 5

[0118] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (K223R) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0119] 2) performing shake flask fermentation according to the steps in Example 4;

[0120] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0121] Comparative Example 6

[0122] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (N291T) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0123] 2) performing shake flask fermentation according to the steps in Example 4;

[0124] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0125] Comparative Example 7

[0126] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (K223R / D317S) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0127] 2) performing shake flask fermentation according to the steps in Example 4;

[0128] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0129] Comparative Example 8

[0130] 1) Using pACYC-pntAB-BL21 as the chassis strain, the pET28a-FMO (K223R / Q318L) plasmid obtained by site-directed mutagenesis was introduced into the pACYC-pntAB-BL21 strain by chemical transformation;

[0131] 2) performing shake flask fermentation according to the steps in Example 4;

[0132] 3) After the fermentation is completed, the indigo production is detected at 610 nm.

[0133] The indigo yields of Example 4 and Comparative Examples 1-8 were compared, and the results are shown in Table 3:

[0134] Table 3 Indigo production data of each group

[0135] Expression vector Yield g / L Comparative Example 1 pET28a-FMO 0.86 Comparative Example 2 pET28a-FMO, pACYC-pntAB 1.58 Comparative Example 3 pET28a-FMO(C78I), pACYC-pntAB 2.37 Comparative Example 4 pET28a-FMO(C78I / S23A), pACYC-pntAB 2.23 Comparative Example 5 pET28a-FMO(K223R), pACYC-pntAB 2.41 Comparative Example 6 pET28a-FMO(N291T), pACYC-pntAB 1.82 Comparative Example 7 pET28a-FMO(K223R / D317S), pACYC-pntAB 2.52 Comparative Example 8 pET28a-FMO(K223R / Q318L), pACYC-pntAB 2.24 Example 4 pET28a-FMO(H164N / K223R / Q318L), pACYC-pntAB 2.76

[0136] Example 5

[0137] This example is a pET28a-FMO*-BL21 fermentation tank fermentation

[0138] A single colony of the high-yield strain pET28a-FMO*-BL21 screened in Example 4 was selected and added to 100 mL of LB liquid and cultured at 37°C and 220 rpm until OD 600 =2-3, as seed solution;

[0139] The seed solution was inoculated into a 500 mL fermentation tank containing 200 mL of fermentation medium (yeast powder 24 g / L, Na2HPO4 6.78 g / L, KH2PO4 3 g / L, NaCl 0.5 g / L, NH4Cl 1 g / L, MgSO4 0.241 g / L, CaCl2 0.011 g / L, nicotinic acid 20 mM, defoamer 0.5 mL / L, glucose 40 g / L) and cultured at 37 °C until OD 600 =5, adjust the temperature to 30°C, and add 0.2 mM IPTG for induction;

[0140] Fermentation tank parameters: During the fermentation process, ammonia water was used to control pH = 7.0, the fermentation temperature was 30°C, the DO dissolved oxygen content was 25-35%, and feeding was performed according to the residual amount of glucose. After 6-10 hours of induction, indole was added as a substrate and the indole concentration was controlled to be <0.5 g / L;

[0141] After the fermentation, the indigo production was detected by HPLC (high performance liquid chromatography), and the detection conditions were as follows:

[0142] High performance liquid chromatograph: Shimadzu LC 2030Plus;

[0143] Chromatographic column: ShimNex HE C18 4.6×150mm 3μm;

[0144] Mobile phase A: 0.1% formic acid in water;

[0145] Mobile phase B: acetonitrile;

[0146] Elution program: 10% mobile phase B for 2 min, 10%-100% mobile phase B for 25 min, 100% mobile phase B for 5 min, 100%-10% mobile phase B for 3 min, 100% mobile phase B for 7 min;

[0147] Flow rate: 0.5ml / min;

[0148] Injection volume: 10 μL;

[0149] Column temperature: 30°C;

[0150] Detection wavelength: 610nm;

[0151] The standard curve was drawn with different concentrations of indigo standard. The results after detection are as follows: Figure 1 As shown, the yield of indigo fermented in a 500 mL fermenter was 3 times higher than that in a shake flask, and the product concentration was 8.3 g / L.

[0152] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A flavin monooxygenase FMO mutant, characterized in that: The amino acid sequence of the mutant is obtained by mutation of the amino acid sequence shown in SEQ ID NO: 1, and the mutation sites of the mutant include: (1) Histidine at position 164 was mutated to asparagine; (2) Lysine 223 mutated to arginine; (3) Glutamine at position 318 mutated to leucine.

2. A nucleic acid molecule encoding the flavin monooxygenase FMO mutant according to claim 1.

3. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid molecule according to claim 2.

4. A recombinant bacterium, characterized in that: The recombinant bacteria comprises the recombinant vector according to claim 3.

5. Use of the flavin monooxygenase FMO mutant according to claim 1, the nucleic acid molecule according to claim 2, the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in the production of indigo and its downstream products.

6. A method for producing indigo, characterized in that: include: A recombinant bacterium expressing the flavin monooxygenase FMO mutant and the transhydrogenase PntAB according to claim 1 is constructed, and indole is used as a substrate to ferment and produce indigo using the recombinant bacterium.

7. The method according to claim 6, characterized in that The construction method of the recombinant bacteria comprises: inserting the genes of the flavin monooxygenase FMO mutant and the transhydrogenase PntAB into an expression vector to obtain a recombinant vector, and then introducing the recombinant vector into a starting strain to obtain the recombinant bacteria; The amino acid sequence of the flavin monooxygenase FMO mutant is shown in SEQ ID NO: 2, and the amino acid sequence of the transhydrogenase PntAB is shown in SEQ ID NO: 3-4.

8. The method according to claim 6, characterized in that The starting strains include Escherichia coli, and the Escherichia coli include Escherichia coli BL21 (DE3), Escherichia coli DH5α and Escherichia coli XL-Blue.

9. The method according to claim 6, characterized in that The method for culturing the recombinant bacteria comprises: streaking the recombinant bacteria onto a plate for culturing, and then picking the colonies obtained by the culture to a shake bottle for expansion culture; The conditions for plate culture are: overnight culture at 37°C, 180-220rpm, and the culture medium is LB medium; The conditions for the expanded culture are: culture at 37° C. and 180-220 rpm until the logarithmic growth phase, the culture medium is LB culture medium, and the liquid volume is 10%-20%.

10. The method according to claim 9, characterized in that The fermentation includes shake flask fermentation and fermentation tank fermentation; The shake flask fermentation comprises: inoculating the bacterial liquid obtained after the expansion culture into the fermentation medium for shake flask culture, adding an inducer at the initial stage of inoculation to induce expression, and then starting to supplement indole as a substrate 2 hours after the induced expression; The fermentation in the fermenter comprises: inoculating the bacterial liquid obtained after the expanded culture into the fermentation medium for fermentation culture, and culturing in the fermenter; 600 =5, add the inducer to induce expression, and then add indole as a substrate 6-10 hours after the induction of expression; Preferably, the conditions for the shake flask fermentation are: fermentation at 25-30°C, 220rpm, and stopping fermentation after 24h; the conditions for inducing expression are: the inducer is 0.05mM IPTG, the induction temperature is 25-30°C, and the OD 600 =0.6-0.8; Preferably, the components of the fermentation medium in the shake flask fermentation include: yeast powder 24g / L, Na2HPO4 6.78g / L, KH2PO4 3g / L, NaCl 0.5g / L, NH4Cl 1g / L, MgSO4 0.241-0.3615g / L, CaCl2 0.011-0.022g / L, CaCO3 10-40g / L, glucose 10-40g / L; Preferably, the amount of indole added each time in the shake flask fermentation is 0.5-1 g / L, and the indole addition time is once every 2 hours after induction; Preferably, the fermentation conditions of the fermentation tank are: temperature 25-30°C, pH=6.5-7.5, dissolved oxygen 25%-35%, stirring associated dissolved oxygen, and fermentation time is 72h; the induction expression conditions are: inducer 0.05mM IPTG, induction temperature 25-30°C, OD 600 =0.6-0.8; Preferably, the fermentation medium in the fermentation tank comprises: yeast powder 24 g / L, Na2HPO4 6.78 g / L, KH2PO4 3 g / L, NaCl 0.5 g / L, NH4Cl 1 g / L, MgSO4 0.241-0.3615g / L, CaCl2 0.011-0.022g / L, nicotinic acid 20-40mM, defoamer 0.5-2mL / L, Glucose 10-40g / L.

Images