Efficient homologous recombination engineering bacterium and method for improving gene editing efficiency

Abstract

The invention relates to an efficient homologous recombination engineering bacterium and a method for improving gene editing efficiency. The genome editing work is limited by the homologous recombination efficiency of the host bacteria, so that the engineering bacteria with higher homologous recombination efficiency are of great significance for improving the efficiency of the genome editing work. In order to achieve the purpose, exonuclease VII of host bacteria is modified, an xseA subunit in double subunits is knocked out, meanwhile, an xseB subunit is overexpressed, the dsDNA recombination mediated single region editing efficiency can be improved by 220%, the bacteria homologous recombination efficiency is remarkably improved, and universality and convenience are achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing engineering bacteria, and specifically relates to an engineering bacterium with high-efficiency homologous recombination, a kit for the engineering bacterium, and a method for improving genome editing efficiency by modifying host bacteria exonuclease VII. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Currently, the most widely used bacterial genome editing technologies include Red / ET recombineering and CRISPR / Cas systems. Red / ET recombineering is a homologous recombination technology mediated by the recombinant protein from Escherichia coli λ phage to Redα / Redβ or the recombinant protein from Escherichia coli Rac prophage to RecE / RecT. It can solve the problems that traditional DNA cloning technology cannot solve. It can use the phage recombinase Redαβγ or RecET-mediated short-chain homology arm homologous recombination to delete, insert, replace, point mutate and clone the target DNA. It is independent of restriction sites, position restrictions, high accuracy and no off-target. It has been widely used in many important fields such as microbial biosynthetic pathway cloning and heterologous expression, rapid and accurate editing and phenotypic optimization of bacterial genomes, gene targeting and construction of humanized transgenic animals, and viral vaccine development. The Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated nuclease (CRISPR / Cas) system has recently been used as an efficient and versatile tool for genome editing in various organisms. The CRISPR / Cas system is an acquired immune defense mechanism formed by bacteria and archaea during long-term evolution to fight against invading viruses and foreign DNA. It contains a guide RNA (sgRNA) that matches the target DNA fragment and a Cas protein with nuclease function. The guide RNA guides the Cas protein to bind to the target site, cut the target DNA, generate double-strand breaks, and then repair them through endogenous homologous recombination in bacteria. It is currently the most widely used genome editing tool. However, its genome targeting and manipulation capabilities in bacteria are often limited by homologous recombination efficiency and cytotoxicity.

[0004] In summary, the upper limit of bacterial genome editing (knockout, insertion and replacement) is mainly determined by the homologous recombination efficiency of the host strain. Red / ET recombineering is the most effective method to promote bacterial homologous recombination. In the process of recombination mediated by Red / ET recombineering, the exogenous substrate finally enters the genome from the replication fork in the form of ssDNA to complete the editing. However, ssDNA is easily degraded by exonucleases in bacteria, so inhibiting exonucleases and enhancing the stability of ssDNA in bacteria can theoretically improve the recombination efficiency. Common ssDNA exonucleases include ExoI, ExoVII, ExoX and RecJ, among which ExoVII is relatively special and consists of two subunits (a complex consisting of one XseA subunit and four XseB subunits). ExoVII has nuclease exonuclease activity in both 5'-3' and 3'-5' directions, and can also degrade single-stranded regions at the ends of double-stranded DNA and displaced single-stranded regions. Nuclease exonuclease VII is ubiquitous in bacteria. It has been reported that knocking out xseA can promote homologous recombination, but complete inactivation of ExoVII can cause cell damage. Summary of the invention

[0005] The present invention is designed to provide a method for improving the efficiency of homologous recombination of engineered bacterial genomes, and by regulating the xseA subunit and the xseB subunit in bacterial exonuclease VII, the efficiency of recombination-mediated single-region editing can be significantly improved. The transformation method provided by the present invention has good universality and can be applied to most host bacteria involved in gene editing projects, and the transformation method is simple and the effect is stable.

[0006] Based on the above technical effects, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides an engineered bacterium with high homologous recombination efficiency, wherein the expression of the xseA subunit in the exonuclease VII of the engineered bacterium is inhibited and / or the expression of the xseB subunit is increased compared to the wild type.

[0008] In order to improve the efficiency of homologous recombination in the host bacteria, the present invention transforms the nuclease in the host bacteria; further, the present invention regulates the expression of xseA and xseB in nuclease VII, and the results show that inhibiting xseA and increasing xseB expression can improve the recombination efficiency of the host strain.

[0009] In one embodiment, the expression of the xseA subunit in the exonuclease VII of the engineered bacteria is inhibited; this embodiment can increase the recombination efficiency by 130%;

[0010] In one embodiment, the expression of the xseB subunit in the exonuclease VII of the engineered bacteria is increased; this embodiment can increase the recombination efficiency by 80%;

[0011] In one embodiment with better effect, the exonuclease VII of the engineered bacteria is modified to have the expression of the xseA subunit suppressed and the expression of the xseB subunit increased. This embodiment can increase the recombination efficiency by 220%.

[0012] The engineered bacteria can be any strain commonly used in gene editing work, as long as its genome has exonuclease VII, it can be transformed as described above, and specific examples include Escherichia coli, Burkholderia, Saccharomyces cerevisiae, etc. The specific sequences of the xseA and xseB subunits can be adjusted according to the different host bacteria, which belongs to the technical content that can be routinely inferred by those skilled in the art.

[0013] Further, the expression of the xseA subunit can be inhibited by deleting 70% or more of the sequence in the xseA subunit, and the xseB subunit is overexpressed by increasing the number of copies of the xseB subunit, such as one, two or more; the above sequence deletion and / or increase is modified by editing the gene sequence of the host cell through a vector. The vector used in the present invention is not specifically limited as long as it can replicate in the host cell, and any vector known in the art can be used. Examples of conventional vectors may include recombinant plasmids, cosmids, viruses and bacteriophages.

[0014] In one embodiment verified by the present invention, the preparation of the above-mentioned engineered bacteria is achieved by transfection with a recombinant plasmid, that is, the second aspect of the present invention provides a modification kit for engineered bacteria for homologous recombination, wherein the kit is used to modify the nuclease VII in the host bacteria, and the kit includes at least a recombinase plasmid, and its expression cassette is as follows: comprising a rhamnose-inducible promoter controlling the Escherichia coli recombinase (Redαβγ)-xseB-xseA-targeting gRNA and xseA knockout cassette.

[0015] The above-mentioned modification kit is used to simultaneously modify the two subunits xseB and xseA in the nuclease VII in the host bacteria, specifically to inhibit the expression of the xseA subunit and overexpress the xseB subunit.

[0016] Preferably, the kit further comprises a dsDNA substrate, an inducer, and dNTPs.

[0017] Furthermore, the length of the above-mentioned dsDNA substrate does not exceed 100 bp, and the sequence should be able to anchor multiple target sites.

[0018] Furthermore, the inducer is selected from one of IPTG and rhamnose.

[0019] Furthermore, the content of GC bases in the dNTPs should be close to the GC content in the host bacterial genome.

[0020] In a third aspect, the present invention provides a method for improving genome editing efficiency by modifying host bacterial exonuclease VII, wherein the method is based on the kit described in the second aspect to modify the host bacterial exonuclease VII, and the steps are as follows:

[0021] The recombinase plasmid is added to the host bacteria for cultivation, an inducer is added to the culture medium to induce the expression of the recombinase, and then a competent host bacteria is prepared, and a dsDNA substrate is introduced by electroporation; the competent cells after electroporation are revived at low temperature, and dNTPs are added during the resuscitation process; the competent cells after resuscitation are screened for resistance to obtain the above-mentioned engineered bacteria.

[0022] In a specific embodiment, the host bacteria is Escherichia coli (E. coli) BL21; the preparation method of the host bacteria with the recombinase plasmid is a common operation in the art; the recovery temperature of the competent cells is 28-32° C., and the recovery time is 5-7 hours.

[0023] In a fourth aspect, the application of the engineered bacteria described in the first aspect in genome editing work is provided.

[0024] The above-mentioned engineered bacteria can be edited using methods such as gene knockout, insertion and replacement, and in a preferred embodiment, Red / ET recombination engineering is used.

[0025] The beneficial effects of one or more of the above technical solutions are:

[0026] The present invention discloses for the first time the establishment and application of a method for improving the efficiency of bacterial genome editing by simultaneously constructing a bacterial exonuclease VII XseA subunit knockout box and an XseB subunit overexpressed by a rhamnose promoter on a recombinase plasmid, which can effectively improve the single-region editing efficiency of Escherichia coli E.coli BL21 dsDNA recombination-mediated by 220%. The method established by the present invention can significantly improve the efficiency of bacterial homologous recombination and has universality and convenience. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0028] Figure 1 Effects of single mutations on ExoVII subunits and plasmid construction;

[0029] Figure a shows the effects of different ExoVII subunits on single mutations;

[0030] ΔxseA, the xseA gene was inactivated by the gentamicin resistance gene;

[0031] P-xseB, xseB gene co-expressed with recombinase;

[0032] ΔxseA-oligo, adding an oligonucleotide targeting the xseA gene to inactivate the gene;

[0033] The single mutation rate of ΔxseA+P-xseB increased 2.2-fold;

[0034] Figure b shows the construction of the ExoVII subunit modified plasmid, in which the recombinase and xseB are co-expressed under the control of the same promoter; an XseA inactivation box is added to the plasmid, and the expression of the cas9 gene can inactivate XseA in vivo. DETAILED DESCRIPTION

[0035] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0036] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0037] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0038] Example 1 Construction of recombinant engineering bacteria and verification of editing efficiency

[0039] In this example, Escherichia coli (E. coli) BL21 was used as the starting strain to explore the effects of overexpression of E. coli endogenous xseB, interference with E. coli endogenous xseA, and simultaneous expression of both on the efficiency of recombination editing:

[0040] 1. Experimental Materials

[0041] 1) Reagents and instruments involved in the following examples: Single-stranded nucleotides were synthesized from Shanghai Sangon Biotechnology Co., Ltd., restriction endonucleases, DNA polymerases and DNA markers were from New England Biolabs, and antibiotics were purchased from Invitrogen. Escherichia coli (E. coli) BL21 involved in the examples was from our laboratory, a standard quality control strain, and can be purchased through commercial channels.

[0042] 2. Experimental methods

[0043] 2.1 Starting strain: Escherichia coli (E. coli) BL21;

[0044] 2.2 Statistical method for recombination-mediated single-region gene editing efficiency:

[0045] The starting strain was edited with the recombinant plasmids of the control group and the experimental group, and the single colonies on the resistance plate were counted to calculate the number of colonies per 10 8 The number of correct colonies per cell represents the editing efficiency. The values ​​are the mean of biological replicates, and the error bars represent the standard error of all (n≥3) biological replicates. The P value was tested by two-tailed Student's t test: ****P<0.001.

[0046] Control group: The starting strain was transfected with a blank plasmid, and the rest of the operations were the same as those of the experimental group.

[0047] The experimental group was constructed as follows:

[0048] 1) Construction of xseB overexpression plasmid: xseB is derived from Escherichia coli BL21, and the sequence is as follows:

[0049] ATGCCGAAGAAAAATGAGGCGCCCGCCAGCTTTGAAAAGGCGCTGA

[0050] GCGAGCTGGAACAGATTGTAACCCGTCTGGAAAGTGGCGACCTGCCGCTG

[0051] GAAGAGGCGCTGAACGAGTTCGAACGCGGCGTGCAGCTGGCACGTCAGG

[0052] GGCAGGCCAAATTACAACAAGCCGAACAGCGCGTACAAATTCTGCTGTCT

[0053] GACAATGAAGACGCCTCTCTAACCCCTTTTACACCGGACAATGAGTAA

[0054] (SEQ ID NO.1).

[0055] The xseB of the above sequence and the recombinase (Redαβγ) were transferred into the pBBR1 vector to construct a multi-copy recombinase expression plasmid (pBBR1-PRha-Redαβγ-xseB-Km). The efficiency of single-region editing mediated by recombination was increased by 80%.

[0056] 2) Construction of xseA expression interference plasmid: CRISPR-Cas mediated knockout was used to inactivate xseA in the starting strain, and the gRNA sequence of the CRISPR plasmid was as follows: ATTACGCTCTACGAGCCGCG (SEQ ID NO. 2). For xseA, according to the above editing efficiency statistical method, inactivation of xseA can increase the recombination efficiency by 130%.

[0057] 3) Simultaneous overexpression of xseB and inactivation of xseA vector construction: Based on the above results, the recombinase and Cas9 expression vectors were reconstructed: the xseB gene of the BL21 strain was placed after the recombinase (Redαβγ), and the overexpression was controlled by the rhamnose promoter. The xseA-targeting gRNA and the xseA knockout cassette (KO region-xseA gRNA-tracRNA) were placed on the same plasmid for xseA pre-inactivation. The expression cassette structure was as follows Figure 1 b. Overexpression of xseB and inactivation of xseA simultaneously can increase the efficiency of recombination-mediated single-region editing by 220%. The specific steps are as follows:

[0058] (1) The rhamnose-inducible promoter controls the E. coli recombinase (Redαβγ) and is constructed on a suitable backbone plasmid. The xseB gene of the BL21 strain is placed after the recombinase and is controlled by the rhamnose promoter to achieve transient overexpression of the xseB gene. The primers involved are as follows:

[0059]

[0060] (2) The E. coli xseA-targeting gRNA (SEQ ID NO. 2) and the xseA knockout cassette (KO region-xseAgRNA-tracRNA) were placed on the same plasmid, and CRISPR-Cas-mediated knockout was used to pre-inactivate xseA. The primers involved in this step are as follows:

[0061]

[0062] (3) A dsDNA substrate with short homology arms (100 bp) capable of anchoring different target sites was obtained by PCR. The sequence of the chloramphenicol resistance gene fragment used is as follows (the wavy line part is the homology arm):

[0063]

[0064] (4) culturing the host cells carrying the recombinase plasmid in step (2) in a suitable medium until the logarithmic growth phase, adding an inducer to induce the expression of the recombinase, preparing a host cell competent state carrying the recombinase plasmid, and introducing the dsDNA substrate (antibiotic resistance fragment) into the competent cell by electroporation;

[0065] (5) The competent cells after electroporation were revived at a temperature below the optimal growth temperature. During the resuscitation process, dNTPs with a final concentration of 10 nM (the GC content was similar to or the same as the GC content of the host genome) were added. The resuscitation temperature of E. coli BL21 was 30°C and the resuscitation time was 6 hours.

[0066] (6) After the recovery, the competent cells are centrifuged and the supernatant is discarded. The cells are resuspended in 100 μL of a suitable culture medium, evenly spread on a solid culture medium plate with the corresponding resistance, and incubated at the recovery temperature until a single colony grows;

[0067] (7) Recombination editing efficiency results Figure 1 a. The experimental groups were xseA gene inactivated by gentamicin resistance gene (ΔxseA), xseB gene co-expressed with recombinase (P-xseB), xseA gene inactivated by oligonucleotides targeting the gene (ΔxseA-oligo), and xseA gene inactivated and xseB gene overexpressed (ΔxseA+P-xseB).

[0068] The results are as follows Figure 1 As shown in a, simultaneous overexpression of xseB and inactivation of xseA can increase the efficiency of recombination-mediated single-region gene editing by 220%.

[0069] In addition, there was no significant difference in the growth status of the host bacteria after the above transformation compared with the wild type.

[0070] In this example, a knockout cassette of bacterial exonuclease VII XseA subunit and an XseB subunit overexpressed by a rhamnose promoter were successfully constructed on a recombinase plasmid, achieving a significant improvement in the single-region editing efficiency mediated by Escherichia coli BL21 dsDNA recombination.

[0071] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An engineering bacterium with high efficiency homologous recombination, characterized in that: Compared with the wild type, the expression of the xseA subunit in the exonuclease VII of the engineered bacteria is inhibited, and / or the expression of the xseB subunit is increased.

2. The engineered bacteria with high efficiency homologous recombination as claimed in claim 1, characterized in that: The exonuclease VII of the engineered bacteria is modified to have the expression of the xseA subunit suppressed and the expression of the xseB subunit increased.

3. The engineered bacteria with high efficiency homologous recombination as claimed in claim 1, characterized in that: The engineering bacteria is one of Escherichia coli, Burkholderia spp. and Saccharomyces cerevisiae.

4. A kit for transforming engineered bacteria for homologous recombination, characterized in that: The kit is used to transform the nuclease VII in the host bacteria. The kit includes at least a recombinase plasmid, and its expression box is as follows: it includes a rhamnose-inducible promoter controlling the Escherichia coli recombinase (Redαβγ)-xseB-xseA-targeting gRNA and an xseA knockout box.

5. The kit for transformation of engineered bacteria for homologous recombination according to claim 4, characterized in that: The kit also includes a dsDNA substrate, an inducing agent, and dNTPs.

6. The kit for transformation of engineered bacteria for homologous recombination according to claim 5, characterized in that: The dsDNA substrate length does not exceed 100 bp, and the sequence should be able to anchor multiple target sites; Or, the inducer is selected from one of IPTG and rhamnose; Alternatively, the content of GC bases in the dNTPs is close to the GC content in the host bacterial genome.

7. A method for improving genome editing efficiency by modifying host bacterial exonuclease VII, characterized in that: The method is based on the kit described in any one of claims 4 to 6 to transform the nuclease exonuclease VII of the host bacteria, and the steps are as follows: the above-mentioned recombinase plasmid is added to the host bacteria for cultivation, an inducer is added to the culture medium to induce the expression of the recombinase, and then a competent host bacteria is prepared, and a dsDNA substrate is introduced by electroporation; the competent cells after electroporation are revived at low temperature, and dNTPs are added during the resuscitation process; the competent cells after resuscitation are subjected to resistance screening to obtain the above-mentioned engineered bacteria.

8. The method for improving genome editing efficiency by modifying host bacterial exonuclease VII as claimed in claim 7, characterized in that: The host bacteria is Escherichia coli BL21; the recovery temperature of the competent cells is 28-32° C., and the recovery time is 5-7 hours.

9. Use of the engineered bacteria according to any one of claims 1 to 3 in genome editing.

10. The use according to claim 9, characterized in that: The gene editing work is Red / ET recombination engineering.

Images