Andrographis paniculata endogenous cis-regulatory element ApACR1 and application thereof

Abstract

The invention is applicable to the technical field of gene engineering, and provides an andrographis paniculata endogenous cis-regulatory element ApACR1 and application thereof.The nucleotide sequence of the cis-regulatory element ApACR1 has transcriptional activity equivalent to that of a 35S promoter, and the cis-regulatory element ApACR1 can replace the 35S promoter to be used as an andrographis paniculata endogenous regulatory element. Some potential risks of the 35S promoter in molecular breeding are avoided, and the promoter has important potential application value in subsequent andrographis paniculata molecular biology research and molecular breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an endogenous cis-regulatory element ApACR1 of Andrographis paniculata and an application thereof. Background Art

[0002] Andrographis paniculata is an annual herbaceous plant of the genus Andrographis in the family Acanthaceae. As one of the traditional Chinese medicinal materials in my country, it has important medicinal value in clearing away heat and detoxification, anti-inflammatory and other aspects, and is known as a natural antibiotic. In recent years, with the development of modern medicine and biotechnology, the medicinal value of Andrographis paniculata has gradually been valued.

[0003] However, due to limited wild resources and over-harvesting, the supply of Andrographis paniculata is becoming increasingly tight, so artificial planting and molecular breeding have become important ways to solve this problem. In molecular breeding, the 35S promoter is one of the widely used regulatory sequences. It is derived from the cauliflower mosaic virus (CaMV). Because of its broad spectrum and strong expression characteristics, it is used in the transgenic improvement of various plants. With the emphasis on environmental and safety issues, researchers have begun to look for new regulatory sequences, especially regulatory sequences from the plant's own genome, because these plant-derived sequences can not only effectively avoid the potential ecological risks brought by exogenous genes, but also improve the stability of gene expression. Based on this, in recent years, more and more studies have been devoted to screening and identifying regulatory sequences from the plant itself to replace the 35S promoter. Therefore, mining sequences with strong regulatory functions in the Andrographis paniculata genome is a hot topic in current research. Summary of the invention

[0004] The purpose of the embodiments of the present invention is to provide an endogenous cis-regulatory element ApACR1 of Andrographis paniculata, aiming to solve the problems raised in the background technology.

[0005] In order to solve the above problems, the embodiment of the present invention is implemented as follows: the cis-regulatory element ApACR1 endogenous to Andrographis paniculata has a nucleotide sequence as shown in the sequence table SEQ ID NO.1.

[0006] Another object of the present invention is to provide an application of a cis-regulatory element ApACR1 as a regulatory element derived from Andrographis paniculata.

[0007] Furthermore, the cis-regulatory element ApACR1 is used to replace the 35S promoter as the Andrographis paniculata-derived regulatory element.

[0008] Another object of the present invention is to provide an application of a cis-regulatory element ApACR1 in molecular breeding of Andrographis paniculata.

[0009] Compared with the prior art, the present invention has the following advantages:

[0010] The present invention uses a variety of high-throughput sequencing technologies and molecular biological methods to identify a cis-regulatory element ApACR1 with strong promoter activity. The cis-regulatory element has a transcriptional activity equivalent to that of the 35S promoter, can replace the 35S promoter as the regulatory element of Andrographis paniculata, avoids some potential risks of the 35S promoter in molecular breeding, and has important potential application value in subsequent Andrographis paniculata molecular biology research and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is an IGV screenshot showing the regulatory sequence of Andrographis paniculata ApACR1. The data shown include histone (H3K27me3, H3K4me3, H3K27ac) ChIP-seq, ATAC-seq, and RNA-seq data. Histone ChIP-seq and ATAC-seq were repeated in two groups, and the input was the control sample.

[0012] Figure 2 This is the DNA cloning diagram of ApACR1, where M: DNA marker DL2000; 1 and 2: amplified fragments of ApACR1.

[0013] Figure 3 Luciferase activity analysis to detect the transcriptional activity of ApACR1. A is a schematic diagram of the tobacco injection position; B is a diagram of the luciferase activity detection result after transient transformation of tobacco. DETAILED DESCRIPTION

[0014] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0015] In order to solve the instability and potential ecological risks caused by the use of exogenous regulatory elements in Andrographis paniculata molecular breeding research, the embodiment of the present invention provides an Andrographis paniculata endogenous cis-regulatory element ApACR1 and its application, and the cis-regulatory element ApACR1 sequence has a regulatory activity equivalent to the 35S promoter activity.

[0016] Specifically, the present invention integrates multi-omics data such as RNA-seq, ChIP-seq, and ATAC-seq through bioinformatics methods, and discovers a sequence with strong promoter activity in the Andrographis paniculata genome, named ApACR1. Through gene cloning and luciferase activity detection of transiently transformed tobacco, it was found that ApACR1 has strong transcriptional activity, and its activity of promoting luciferase reporter gene (LUC) is comparable to that of the traditional 35S promoter, and has similar promoter activity to the traditional 35S promoter, indicating that this sequence has important potential application value in the subsequent molecular breeding of Andrographis paniculata.

[0017] The experimental methods in the following examples without specifying specific experimental conditions are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials and equipment used in the present invention can be obtained from commercial sources.

[0018] Example 1: This example provides a cis-regulatory element ApACR1 endogenous to Andrographis paniculata with comparable promoter activity to that of the 35S promoter; ApACR1 is an open chromatin region (ACR, Accessible chromatin region) identified from the Andrographis paniculata genome based on sequencing data such as histone ChIP-seq, ATAC-seq, and RNA-seq, and the fragment is located in the promoter region of the Andrographis paniculata annotated gene Apv3LG19G139.108. The sequence of ApACR1 is obtained as follows:

[0019] Download multi-omics data of Andrographis paniculata, such as histone chromatin immunoprecipitation sequencing data (H3K27me3ChIP-seq, H3K4me3 ChIP-seq, H3K27ac ChIP-seq), targeted open chromatin sequencing data (ATAC-seq), transcriptome data (RNA-seq), etc., and process them through bioinformatics methods to mine potential sequences with strong regulatory activity. The bioinformatics data processing method is briefly as follows:

[0020] S1. Data download: Transcriptome data were downloaded according to NCBI (https: / / www.ncbi.nlm.nih.gov / ) accession numbers SRX12305817, SRX12305811, and SRX12305810. Histone ChIP-seq and ATAC-seq data were downloaded according to the National Genomics Database (https: / / ngdc.cncb.ac.cn) accession number PRJCA026190.

[0021] S2. Data processing: RNA-seq data were processed using TrimGalore software (http: / / github.com / FelixKrueger / TrimGalore) to remove adapter sequences and low-quality reads in the raw data. The filtered reads were aligned to the Andrographis paniculata reference genome (figshare, 10.6084 / m9.figshare.24986769) using HISAT2 software (http: / / daehwankimlab.github.io / hisat2 / ). Gene expression levels were calculated using Cuffnorm software (http: / / cole-trapnell-lab.github.io / cufflinks / cuffnorm), expressed as the number of fragments per kilobase of transcription per million reads.

[0022] ATAC-seq data were filtered using TrimGalore software, and the filtered reads were aligned to the Andrographis genome (same as above) using Bowtie2 software (https: / / bowtie-bio.sourceforge.net / bowtie2 / manual.shtml), with the parameter set to: -X 1000. Alignments with MAPQ values ​​greater than 30 were retained, and peaks were identified using MACS2 (https: / / github.com / macs3-project / MACS) software with the parameters set to “--nomodel--shift100--extsize 200-q 0.01”. Tn5 enzyme-labeled genomic DNA was used as a control for peak identification. Reproducible peaks between two biological replicates were defined as open chromatin regions (ACRs). HOMER software (http: / / homer.ucsd.edu / homer) was used to annotate ACRs for the genome. Deeptools software (https: / / deeptools.readthedocs.io / en / develop / ) and pyGenomTrack software (https: / / pygenometracks.readthedocs.io / en / latest / ) were used to visualize AT AC-seq signals, while featurecounts (https: / / rnnh.github.io / bioinfo-notebook / docs / featureCounts.html) was used to calculate and rank ACR abundance.

[0023] The histone ChIP-seq data were removed from the adapter sequences and low-quality reads using the TrimGalore software mentioned above. The filtered reads were aligned to the reference genome using Bowtie2 software with default parameters. Aligned reads with MAPQ values ​​greater than 30 were used for peak identification using MUSIC software (https: / / github.com / gerste inlab / MUSIC). The parameters for H3K27me3 peak identification were set to “-get_multiscale_broad_ERs”, while the parameters for H3K4me3 and H3K27ac peak identification were set to “-get_multiscale_punctate_ERs”. The ChIP-seq data were then processed using Deeptools software to generate data distribution plots and heat maps. The peaks were annotated for the genome using HOMER software (http: / / homer.ucsd.edu / homer), and the abundance was calculated using featurecounts.

[0024] Screening of candidate ACR regulatory sequences. ACRs were screened based on sequencing data such as ChIP-seq, ATAC-seq, and RNA-seq. The main principles were that the associated gene expression level was high, the ACR abundance was high, the associated histone ChIP-seq (including H3K4me3 and H3K27ac ChIP-seq) abundance was high, and the associated histone H3K27me3 ChIP-seq abundance was low. Through sequencing, an open chromatin region was identified from the Andrographis genome. The fragment was located in the promoter region of the gene numbered Apv3LG19G139.108 in Andrographis and was named ApACR1 (e.g. Figure 1 and Table 1), as one of the candidate regulatory sequences.

[0025] Table 1

[0026]

[0027] Example 2: This example provides a method for cloning ApACR1, which specifically includes the following steps:

[0028] According to the multi-omics data of Andrographis paniculata, the ApACR1 sequence was predicted, and specific primers ApACR1-F: GTTAATAACCGACCGAGT (as shown in SEQ ID NO.2) and ApACR1-R: TCAACAA ACAACAATTCG (as shown in SEQ ID NO.3) were designed. The target fragment was amplified using the high-fidelity enzyme KOD using the Andrographis paniculata leaf DNA as a template. The PCR amplification system was (50μL): 10×PCR Buffer 5μL, 2mM dNTPs 5μL, 25mM MgSO43μL, upstream primer 1.5μL, downstream primer 1.5μL, cDNA template 1μL, ddH2O 33μL. The PCR amplification program was: 94℃ pre-denaturation for 2min; 98℃ for 10s, 58℃ for 30s, 68℃ for 30s, 35 cycles; 68℃ post-extension for 10min. The amplification results are shown in Figure 2. Figure 2As shown, sequencing comparison analysis shows that the fragment length is 798bp, and the nucleotide sequence of ApACR1 is shown in SEQ ID NO.1, specifically:.

[0029] Example 3: This example provides a method for detecting the transcriptional activity of ApACR1, which specifically comprises the following steps:

[0030] S1. Construction of ApACR1-mini35S-LUC vector: Based on the ApACR1 sequence, specific primers with restriction sites were designed: ApACR1-KpnI-F: GGGGTACCGTTAATAACCGACCGAGT (as shown in SEQ ID NO.4), ApACR1-PstI-R: AACTGCAGTCAAACAAACAA CAATTCG (as shown in SEQ ID NO.5). The target fragment was amplified using the high-fidelity enzyme KOD using the DNA of Andrographis paniculata leaves as a template. The PCR amplification system and amplification procedure refer to the above-mentioned Example 1. The amplified product was detected by gel electrophoresis and then cut and recovered, and then ligated to the mini35S-LUC vector linearized by double restriction digestion of KpnI and PstI using restriction digestion and ligation. The enzyme digestion system was (50 μL): 1 μg vector or recovered product, 5 μL 10×rCutSmart Buffer, 1 μL KpnI, 1 μL PstI, and ddH2O to 50 μL; the enzyme digestion system was reacted at 37°C for 30 min before the recovery was terminated. The ligation system was (10 μL): 2 μL linearized plasmid, 6.5 μL enzyme digestion recovery product, 1 μL 10×T4 Ligase buffer, 0.5 μL T4 Ligase; the ligation system was reacted at 25°C for 2 h before transforming E. coli DH5α competent cells. After kanamycin selection and colony PCR detection, it was submitted to Shanghai Bioengineering Co., Ltd. for Sanger sequencing. The ApACR1-mini35S-LUC vector was constructed after the correct sequencing.

[0031] S2. Luciferase activity analysis to detect the transcriptional activity of ApACR1: The constructed vector ApACR1-mini35S-LUC, the positive control 35S-mini35S-LUC (constructed using the traditional 35S promoter according to the above method) and the negative control mini35S-LUC were transformed into GV3101 (pSoup) Agrobacterium competent cells, and the colonies identified as positive by antibiotic selection and PCR were inoculated in 50 μg mL -1 Kanamycin and 50 μg mL -1 LB liquid medium containing rifampicin was cultured overnight at 28°C and 200 rpm. Agrobacterium was cultured to OD 600The concentration of MgCl2 was 0.5-1.0, and the bacteria were collected by centrifugation at 2000g for 8 minutes. The bacteria were washed twice with an infiltration solution (10mMMgCl2, 10mM MES, pH=5.6); the bacteria were suspended with an infiltration solution containing 100mM acetosyringone so that the OD600 value of the bacterial solution was about 0.5. Select fully extended tobacco leaves of about 1 month old, and inject the mixed bacterial solution from the back of the tobacco leaves with a 1mL syringe without a needle. 5-10 leaves were injected for each combination. After growing overnight in the dark under normal greenhouse growth conditions, they were exposed to normal light for 24-48 hours. Cut off the tobacco leaves, spray the back of the leaves with a reaction solution containing 1mM luciferin substrate, turn the reverse side up, and move them into the plant living imaging system to detect the luminescence. The results are as follows Figure 3 The results showed that compared with the negative control mini35S-LUC, where almost no fluorescence signal was observed, ApACR1-mini35S-LUC showed a strong fluorescence signal, and its fluorescence intensity was comparable to that of the 35S-mini35S-LUC positive control.

[0032] In summary, the embodiment of the present invention identified a cis-regulatory element ApACR1 with strong promoter activity, which has a transcriptional activity equivalent to that of the 35S promoter and can replace the 35S promoter as the regulatory element of Andrographis paniculata, avoiding some potential risks of the 35S promoter in molecular breeding. It has important potential application value in subsequent Andrographis paniculata molecular biology research and molecular breeding.

[0033] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. The endogenous cis-regulatory element ApACR1 of Andrographis paniculata, characterized in that: The nucleotide sequence of the cis-regulatory element ApACR1 is shown in the sequence listing SEQ ID NO.

1.

2. Use of the cis-regulatory element ApACR1 as claimed in claim 1 as a regulatory element derived from Andrographis paniculata.

3. The use according to claim 2, characterized in that: The cis-regulatory element ApACR1 is used to replace the 35S promoter as the Andrographis paniculata-derived regulatory element.

4. Use of the cis-regulatory element ApACR1 as claimed in claim 1 in molecular breeding of Andrographis paniculata.

Images