Agrobacterium tumefaciens genome editing system and construction method and application thereof

Abstract

The invention belongs to the technical field of microbial genetic engineering, and particularly relates to a genome editing system of agrobacterium tumefaciens as well as a construction method and application of the genome editing system. The gene editing system is composed of expression plasmids of a homologous recombination system Red gamma-ETrhi145 system and a CRISPR-Cas9 system, and comprises a pBBR1 replication starting point, a kanamycin resistance gene, a tetracycline inducible promoter, an agrobacterium-derived homologous recombinase coding gene Red gamma-ETrhi145, a Cas9 coding gene and sgRNA, the genome editing system is applied to gene knockout in agrobacterium tumefaciens by mediating homologous recombination of a short homologous arm in the agrobacterium tumefaciens. The agrobacterium tumefaciens genome editing system remarkably promotes genome modification of agrobacterium tumefaciens, and shows huge application prospects in the aspect of constructing agrobacterium tumefaciens strains with high transformation efficiency and host range and in the field of plant genetic engineering.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial genetic engineering, and specifically relates to a genome editing system in Gram-negative bacteria and a construction method and application thereof, and in particular to a genome editing system in Agrobacterium tumefaciens and a construction method and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The Redαβγ system derived from Lambda phage and the RecET system derived from Rac prophage can mediate homologous recombination of short homologous arms, collectively known as Red / ET homologous recombination engineering. Red / ET homologous recombination engineering achieves precise modification of target genes at any position in the E. coli genome, including insertion, knockout or replacement. The successful application of this technology has greatly promoted the development of genetic engineering technology, making genome editing more cost-effective, efficient and precise.

[0004] Red / ET homologous recombination engineering, Redα and RecE have 5'-3' nuclease activity, which first degrade the dsDNA molecule from the 5' end, so that the 3' end of the DNA molecule becomes a single-stranded overhang; Redβ and RecT are single-stranded DNA annealing proteins, which bind to the exposed ssDNA to form a complex to prevent the ssDNA molecule from being degraded, and the complex will search for homologous sequences under the mediation of Redβ or RecT to complete DNA recombination; Redγ can inhibit the nuclease activity of RecBCD in Escherichia coli, protect exogenous linear DNA molecules from degradation, and thus promote homologous recombination.

[0005] Agrobacterium tumefaciens is a bacterium with wide application value in the field of plant genetic engineering. It transfers T-DNA and toxic proteins to host cells through its own type IV secretion system T4SS, and uses these elements to promote abnormal growth of diseased parts of plants, forming crown galls and providing nutrition for its own growth. However, when using Agrobacterium tumefaciens for plant gene function research and crop transgenic breeding, there are still many challenges, especially in improving transformation efficiency and expanding host range. Therefore, the development of an efficient and simple homologous recombination system is crucial for genetic engineering research of Agrobacterium tumefaciens.

[0006] The applicant previously applied for and authorized a patent application "Agrobacterium homologous recombination system and its application" (CN113817765B). The patent application screened out four recombinant protein operons, ETh1h2h3h4_agroB6, ETh1h2h3P3_rhi597, ET_rhi145, and ETh_rhi483, from four strains, Agrobacterium tumefaciens str.B6, Rhizobiumleguminosarum bv.trifolii WSM597, Rhizobium sp.LC145, and Rhizobium sp.Root483D2, and functionally verified them in Agrobacterium tumefaciens C58, EHA105, and Rhizobium NBRC 13257, proving that the constructed homologous recombination system can play a recombination function in these three strains. However, the inventors found through further research that the editing efficiency of these systems on the genome is still low and needs to be further optimized and improved. Summary of the invention

[0007] In view of the deficiencies of the above-mentioned prior art, the object of the present invention is to provide a genome editing system of Agrobacterium tumefaciens and its construction method and application. Specifically, in addition to optimizing the recombination efficiency of the homologous recombination system of Agrobacterium tumefaciens in terms of homologous arm length, the amount of DNA added, the amount of dNTP added, and the amount of Protease K added, the Redγ-ET_rhi145 system with the highest recombination efficiency in Agrobacterium tumefaciens C58 and the CRISPR-Cas9 system are constructed on the same plasmid for co-expression, thereby achieving the replacement of the target gene on the genome. The experimental results show that the recombination efficiency is significantly improved, indicating that the CRISPR-Cas9 system can be used in conjunction with the homologous recombination system in Agrobacterium tumefaciens C58, thereby promoting homologous recombination. Based on the above research results, the present invention is completed.

[0008] Specifically, the technical solution of the present invention is as follows:

[0009] The first aspect of the present invention provides a genome editing system of Agrobacterium tumefaciens, wherein the genome editing system at least comprises an Agrobacterium homologous recombination system Redγ-ET_rhi145 and a CRISPR-Cas9 system co-expression vector; the co-expression vector comprises a pBBR1 replication origin, a kanamycin resistance gene, a tetracycline-inducible promoter, and an Agrobacterium-derived homologous recombination operon Redγ-ET_rhi145, a Cas9 encoding gene, and sgRNA;

[0010] Furthermore, the co-expression vector is specifically a plasmid. In a specific embodiment of the present invention, the Agrobacterium tumefaciens genome editing system expression plasmid is named pBBR1-kan-P tet -redγ-ET-sgRNA-cas9_rhi145. Further, when the target gene in the Agrobacterium tumefaciens is the T1PKS gene, the nucleotide sequence of the Agrobacterium genome editing system expression plasmid is shown in SEQ ID NO.1.

[0011] A second aspect of the present invention provides a method for constructing the above-mentioned Agrobacterium tumefaciens genome editing system, the construction method comprising:

[0012] S1, based on the amp-ccdB reverse screening method, using pBBR1-kan-P tet -redγ-ET_rhi145 was used as the basic vector, which was digested with HindⅢ to recover the linear vector;

[0013] S2, amplify the amp-ccdB fragment by PCR, transform the linear vector obtained in step S1 and the amp-ccdB fragment with homology arms into E. coli GBdir-gyrA462 for linear-linear homologous recombination (LLHR), spread on an ampicillin-resistant plate, extract the plasmid for restriction enzyme digestion verification, and obtain pBBR1-kan-P tet -ET-amp-ccdB_rhi145 plasmid;

[0014] S3. Place pBBR1-kan-P tet -ET-amp-ccdB_rhi145 plasmid was digested with BamHI and the linear vector was recovered;

[0015] S4. Obtain P with homology arms by Overlap PCR tet -cas9 fragment; the linear vector obtained in step S3 and the P with homology arms tet -cas9 fragment was transformed into E.coli GB05-dir for LLHR, and then coated on kanamycin resistance plates. After plasmid restriction enzyme digestion verification and sequencing, the correct pBBR1-kan-P tet -redγ-ET-cas9_rhi145 plasmid, which does not contain sgRNA at this time, and its nucleotide sequence is shown in SEQ ID NO.2;

[0016] S5. Insert pBBR1-kan-P tet -redγ-ET-cas9_rhi145 plasmid was digested with PacⅠ, and the linear vector was recovered;

[0017] S6. Use sgRNA-F / sgRNA-R as primers, without template, and directly anneal and extend to obtain the sgRNA fragment. This fragment is too small to be inserted into the plasmid by LLHR, so Overlap PCR with the amp-ccdB sequence is required to obtain the sgRNA-amp-ccdB fragment.

[0018] S7, the linear vector obtained in step S5 and the sgRNA-amp-ccdB fragment with homology arms obtained in step S6 were transformed into E. coli GBdir-gyrA462 for LLHR to obtain pBBR1-kan-P tet -ET-sgRNA-amp-ccdB-cas9_rhi145 plasmid, the plasmid was digested with AscⅠ, and transformed into E.coli GB2005 after T4 ligation. The kanamycin resistance plate was coated and the plasmid was extracted and sequenced after restriction enzyme digestion verification to obtain the correct pBBR1-kan-P tet -redγ-ET-sgRNA-cas9_rhi145 plasmid.

[0019] In the above construction methods, the linear vector can be recovered by ethanol precipitation;

[0020] When performing enzyme digestion, perform overnight digestion treatment.

[0021] The transformation can be performed by conventional electroporation, which will not be described in detail here.

[0022] The third aspect of the present invention provides the use of the above-mentioned Agrobacterium tumefaciens genome editing system in Agrobacterium tumefaciens to mediate homologous recombination of short homologous arms for genetic modification of genomic DNA.

[0023] The short homology arm is specifically a homology arm of 80-160 bp, and further a homology arm of 160 bp. The present invention unexpectedly found that increasing the length of the homology arm can significantly increase the number of recombinants and greatly improve the recombination efficiency.

[0024] A fourth aspect of the present invention provides a method for genetically modifying genomic DNA by mediating homologous recombination of short homology arms in Agrobacterium tumefaciens, the method comprising: using the above-mentioned Agrobacterium tumefaciens genome editing system to perform genome editing on Agrobacterium tumefaciens;

[0025] Further, the Agrobacterium tumefaciens includes Agrobacterium tumefaciens C58;

[0026] The genome editing includes gene knockout;

[0027] The condition parameters in the specific method include: starting OD 600=0.05-0.2, transfer at 25-35℃ for 2-6h to make OD 600 The concentration of the culture medium was 0.4-0.7, induced at 25-35℃ for 0.5-2h, and the competent cells were prepared with ddH2O. The amount of exogenous DNA was 0.5-.1.5mg, the length of the homology arm was 80-160bp, the electroporation voltage was 1200-1400V / mm, the recovery time was 2-4h, 5-40nM dNTP was added to the recovery medium, and the final concentration of Protease K was 5-20μg / mL.

[0028] Further preferred condition parameters include: starting OD 600 =0.1, transferred at 30℃ for 4h to make OD 600 The concentration of the culture medium was 0.6-0.7, induced at 30°C for 1h, and competent cells were prepared with room temperature ddH2O at room temperature. The amount of exogenous DNA was 1.5mg, the length of the homology arm was 160bp, the electroporation voltage was 1350V / mm, the recovery time was 3h, and 10nM dNTP was added to the recovery medium. The final concentration of ProteaseK added was 10μg / mL.

[0029] It should be noted that although the present invention takes the Agrobacterium tumefaciens genome editing system as an example to demonstrate its application in the genome modification of Agrobacterium, based on the inventive concept of the present invention, constructing other genome editing systems for application in the genome modification of other microorganisms also falls within the scope of protection of the present invention.

[0030] Beneficial technical effects of one or more of the above technical solutions:

[0031] The above technical solution provides a genome editing system of Agrobacterium tumefaciens constructed by combining a homologous recombination system with CRISPR / Cas9, which has not been reported in existing literature. The above technical solution uses the constructed genome editing system to achieve gene knockout of Agrobacterium tumefaciens C58. The Agrobacterium tumefaciens genome editing system described in the present invention significantly promotes the genome modification of Agrobacterium, and shows great application prospects in constructing Agrobacterium tumefaciens strains with high transformation efficiency and host range, as well as in the field of plant genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0033] Figure 1 :Agrobacterium tumefaciens genome editing system expression plasmid pBBR1-kan-P tet-Schematic diagram of redγ-ET-sgRNA-cas9_rhi145.

[0034] Figure 2 : pBBR1-kan-P tet Optimization of the recombination efficiency of -redγ-ET_rhi145 in Agrobacterium tumefaciens C58.

[0035] (A) Effects of different resuscitation times on the recombination efficiency of Agrobacterium tumefaciens C58.

[0036] (B) Effects of different dNTP addition amounts on the recombination efficiency of Agrobacterium tumefaciens C58.

[0037] (C) Effects of different Protease K addition amounts on the recombination efficiency of Agrobacterium tumefaciens C58.

[0038] (D) Effects of different lengths of homology arms on the recombination efficiency of Agrobacterium tumefaciens C58. Error bars, three parallel samples for each experimental group, n = 3.

[0039] Figure 3 : Recombination system pBBR1-kan-P tet Recombination efficiency of -redγ-ET_rhi145 replacing AMPB and T1PKS with apra resistance genes in Agrobacterium tumefaciens C58.

[0040] (A)pBBR1-kan-P tet Schematic diagram of the -redγ-ET_rhi145 plasmid.

[0041] (B) Schematic diagram of replacing the target genes AMPB and T1PKS with the apra resistance gene in Agrobacterium tumefaciens.

[0042] (C) Effect of different homology arm lengths on the recombination efficiency of gene replacement in Agrobacterium tumefaciens C58. Error bars, three parallel samples for each experimental group, n = 3.

[0043] (D) Effects of different homology arm lengths on recombinant genes in Agrobacterium tumefaciens C58. Error bars, three replicates per experimental group, n = 3.

[0044] Figure 4:Genome editing system expression plasmid pBBR1-kan-P tet -redγ-ET-T1PKS-sgRNA-cas9_rhi145 was used to knock out the T1PKS gene in Agrobacterium tumefaciens C58.

[0045] (A)pBBR1-kan-P tet Schematic diagram of the -redγ-ET-cas9_rhi145 plasmid.

[0046] (B)pBBR1-kan-P tet Schematic diagram of the -redγ-ET-T1PKS-sgRNA-cas9_rhi145 plasmid.

[0047] (C)pBBR1-kan-P tet -Redγ-ET-T1PKS-sgRNA-cas9_rhi145 for knockout of T1PKS gene in Agrobacterium tumefaciens C58. Error bars, three parallel samples for each experimental group, n = 3.

[0048] (D)pBBR1-kan-P tet -redγ-ET-T1PKS-sgRNA-cas9_rhi145 recombinant for knocking out T1PKS gene in Agrobacterium tumefaciens C58. Error bars, three parallel samples for each experimental group, n=3. DETAILED DESCRIPTION

[0049] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0050] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0051] In a typical embodiment of the present invention, a genome editing system of Agrobacterium tumefaciens is provided, which is composed of a homologous recombination system Redγ-ET_rhi145 system and a CRISPR-Cas9 system expression plasmid, including a pBBR1 replication origin, a kanamycin resistance gene, a tetracycline-inducible promoter, and an Agrobacterium-derived homologous recombination enzyme encoding gene Redγ-ET_rhi145, a Cas9 encoding gene, and sgRNA, and is named pBBR1-kan-P tet -redγ-ET-sgRNA-cas9_rhi145. Furthermore, the Agrobacterium tumefaciens genome editing system demonstrates the application of homologous recombination mediated by short homology arms in Agrobacterium tumefaciens for gene knockout in Agrobacterium. It has broad application prospects in constructing Agrobacterium tumefaciens strains with high transformation efficiency and host range, as well as in the field of plant genetic engineering.

[0052] The recombinant system expression strains E. coli GB2005, E. coli GB05-dir, and E. coli GBdir-gyrA462 involved in the following examples were purchased from GeneBridges, Germany; Agrobacterium tumefaciens C58 was from Northwest Agriculture and Forestry University.

[0053] Plasmid pBBR1-kan-redγ-P tet -ET_rhi145 and pBBR1-apra-kan were from Shandong University-Helmholtz Institute of Biotechnology.

[0054] The Agrobacterium tumefaciens C58 genome sequence is a reported sequence. For details, please refer to the relevant genome sequence published in NCBI.

[0055] Gene sequencing in plasmid construction was completed by BGI. Gene synthesis was completed by GENEWIZ. Other plasmids not mentioned were commercially available conventional plasmids, and the method of electroporation into recipient bacteria was conventional.

[0056] All other reagents and consumables involved are domestically produced. Unless otherwise specified, the experimental methods and reagents in the examples are conventional methods and commercially available reagents in the art.

[0057] Example 1: Recombinant system expression plasmid pBBR1-kan-redγ-P tet -Optimization of the working conditions of ET_rhi145 recombinant in Agrobacterium tumefaciens C58

[0058] The Redγ-ET_rhi145 system was selected to continue the optimization of recombination conditions, and the crdS gene was replaced with an apra-resistant fragment with homology arms. Studies have shown that adding appropriate concentrations of dNTP and Protease K can improve the recombination efficiency. This application has been optimized from four aspects: recovery time, dNTP concentration added during recovery, Protease K concentration, and homology arm length. Specific experimental process: Pick 3 Agrobacteriumtumefaciens C58 monoclones carrying the recombination system Redγ-ET_rhi145 expression plasmid and put them into a 2ml EP tube containing 1.3ml liquid LB culture medium. The concentration of kanamycin used is 10μg / ml. The culture is shaken at 30℃ and 950rpm for 24h. An appropriate amount of seed liquid is drawn and inoculated into 1.3ml LB liquid culture medium containing kanamycin (10μg / ml) to make the starting OD 600 =0.1, shake culture at 30°C and 950 rpm for 4 h, add anhydrotetracycline (AHT) to a final concentration of 0.2 μg / mL, shake culture at 30°C and 950 rpm for 1 h. 600 When preparing competent cells, ddH2O was used for treatment at room temperature, and then 1.5 mg of apraR PCR fragments with different lengths of homology arms were electrotransformed into the cells. The electroporation voltage was selected to be 1350V / mm, and then the cells were revived at 30℃ for 2h, 3h or 4h, and dNTPs and Protease K were added to the resuscitation medium. Then Agrobacterium tumefaciens C58 was screened for resistance with 50μg / ml apramycin, and cultured in a 30℃ incubator. Then the number of colonies was counted and the recombination accuracy was calculated by PCR verification.

[0059] The experimental results are shown in Figure 2 As shown in the figure, after 3 hours of recovery, 10nM dNTP was added, and the final concentration of Protease K was 10μg / mL. The recombination efficiency was the highest when the homology arm was extended to 160bp, and the recombination efficiency was improved most effectively by extending the homology arm. When the homology arm was 120bp, the recombination efficiency was lower than that of 100bp. It is speculated that secondary structure may be generated at 120bp, which affects homologous recombination.

[0060] Experimental results summary: Starting OD 600 =0.1, transferred at 30℃ for 4h to make OD 600The concentration of the culture medium was 0.6-0.7, induced at 30°C for 1h, and competent cells were prepared with room temperature ddH2O at room temperature. The amount of exogenous DNA was 1.5mg, the length of the homology arm was 160bp, the electroporation voltage was 1350V / mm, the recovery time was 3h, 10nM dNTP was added to the recovery medium, and the final concentration of Protease K was 10mg / mL.

[0061] delete-crdS-80bp-F:

[0062] ttgcgaaacaacaggcgcaaaatggaccggcgctgctcgtcgcttggatgaatatcgaactttccggagttctgcgcgtgg

[0063] gttcatgtgcagctccatcag

[0064] delete-crdS-80bp-R:

[0065] acgattgcgattggggcgatcctgtttgcccttctcgctgatcccagaaagatggtcgacaggttggccttcagcatcatgaa

[0066] ggagacatgaactcagc

[0067] Using delete-crdS-80bp-F and delete-crdS-80bp-F as primers and the gel-recovered fragment of pBBR1-apra-kan after PvuII digestion as a template, the specific steps for PCR amplification of the apraR fragment are as follows:

[0068]

[0069] PCR reaction procedure

[0070]

[0071] Example 2: Recombinant system expression plasmid pBBR1-kan-redγ-P tet - Application of ET_rhi145 for genome editing on the Agrobacterium tumefaciens C58 genome

[0072] In order to verify the modified function of the optimized Redγ-ET_rhi145 recombination system on other gene sites on the genome, the AMPB (related to AMP binding protein encoding) gene and T1PKS (type I polyketide synthase) gene were further selected on the Agrobacterium tumefaciens C58 genome for functional verification. The above target genes were replaced by apraR PCR fragments with homology arms under the action of recombinase to achieve gene knockout in Agrobacterium. The lengths of the homology arms were 80 bp and 160 bp, respectively. The homology arms were loaded at both ends of the apraR gene by primer synthesis combined with PCR. Figure 3 .

[0073] The experimental results are shown in Figure 3 C and 3D, it can be seen from the figure that when the homology arm is extended from 80bp to 160bp, the number of recombinants at the AMPB gene site can be increased by about 12 times, but the number of recombinants at the T1PKS gene site is only increased by about 1 times and the number of single clones grown on the plate is small.

[0074] delete-AMPB-80bp-F:

[0075] ttatttccggcctgttccggcctgcagaagtgacgacagggcagccagttcggacgagaggtcggtttcttcctgcggttgg

[0076] ttcatgtgcagctccatcag

[0077] delete-AMPB-80bp-R:

[0078] agcatcctatggttgctcgtcgtgaatagtgatggccggacgtcaggagtttttcagatgcagatcataCcgatgttcgcgaa

[0079] ggagacatgaactcagc

[0080] delete-AMPB-160bp-F:

[0081] gggctgactgccggccccggcctgttgttttacgttcatcggcgatggctccgatcatcgattgcatgaaaagcgtgagatta

[0082] tttccggcctgttccgg

[0083] delete-AMPB-160bp-R:

[0084] aagaggtaattgttgtcatcgagacgcagcgggcagcgatgcatgccgctggcgatcgagtgtgagcaatcagaacggt

[0085] gagcatcctatggttgctcgt

[0086] delete-T1PKS-80bp-F:

[0087] atgtccgactataccagcgcttcaaaccaggatcggaacgcctttcgggtcgccgtcatcggtatggcaggccgctttccg

[0088] gttcatgtgcagctccatcag

[0089] delete-T1PKS-80bp-R:

[0090] cgtgcttctgctcctccaagcgcgctctggacttcactgtcggaaaggccttcgatttccatcaacagcgctgccatctcgaa

[0091] ggagacatgaactcagc

[0092] delete-T1PKS-160bp-F:

[0093] catgatcgatccccccaaaaaaggctgcccgttccacaagtaacgtgcgtgttcaatttctaatccagcgagaactgcccat

[0094] gtccgactataccagcgc

[0095] delete-T1PKS-160bp-R:

[0096] ccccgctcggcaagacgctgctctatgaggcgacggcgctcgggcgaaaggttcgcgagtttggcgtagaattcgttcat

[0097] cgtgcttctgctcctccaag

[0098] The specific PCR reaction system and reaction procedure are the same as in Example 1.

[0099] Example 3: Genome editing system expression plasmid pBBR1-kan-P tet Application of -redγ-ET-sgRNA-cas9_rhi145 for genome editing on the Agrobacterium tumefaciens C58 genome

[0100] The CRISPR-Cas system has been successfully applied to gene editing in a variety of bacteria, and has achieved good results in combination with the homologous recombination system. This application constructed a Redγ-ET_rhi145 and CRISPR-Cas9 co-expression plasmid, selected the T1PKS gene for replacement, and explored its effect on the recombination efficiency.

[0101] The two constructed plasmids pBBR1-kan-P tet -redγ-ET-cas9_rhi145 and pBBR1-kan-P tet -redγ-ET-T1PKSsgRNA-cas9_rhi145 (SEQ ID NO.1) were electroporated into Agrobacterium tumefaciens C58, and the correct transformants were identified by colony PCR. The transformants were transferred to culture, 15 μL AHT was added for induction for 1 h, and the competent cells were prepared at room temperature. 1.5 μg apraR donor fragment was added for electroporation, and the recombinants were identified by colony PCR and the efficiency was statistically calculated. The experimental results are shown in Figure 4 As can be seen from the figure, when the homology arm is 80bp, the recombination efficiency is slightly improved when the recombination system is combined with CRISPR-Cas9, but the number of clones growing on the plate is small; when the homology arm is 160bp, the accuracy of the recombination system combined with CRISPR-Cas9 can reach 95.65%, and the number of recombinants increases by about 5 times, indicating that the synergistic use of CRISPR-Cas9 and the recombination system in Agrobacteriumtumefaciens C58 can improve the recombination efficiency.

[0102] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A genome editing system for Agrobacterium tumefaciens, characterized in that: The genome editing system at least comprises an Agrobacterium homologous recombination system Redγ-ET_rhi145 and a CRISPR-Cas9 system co-expression vector; the co-expression vector comprises a pBBR1 replication origin, a kanamycin resistance gene, a tetracycline-inducible promoter, and an Agrobacterium-derived homologous recombination operon Redγ-ET_rhi145, a Cas9 encoding gene, and sgRNA.

2. The genome editing system according to claim 1, characterized in that The co-expression vector is specifically a plasmid, which is named pBBR1-kan-P tet -redγ-ET-sgRNA-cas9_rhi145; further, when the target gene in the Agrobacterium tumefaciens is the T1PKS gene, the nucleotide sequence of the Agrobacterium genome editing system expression plasmid is shown in SEQ ID NO.

1.

3. The method for constructing the genome editing system of Agrobacterium tumefaciens according to claim 1 or 2, characterized in that: The construction method comprises: S1, based on the amp-ccdB reverse screening method, using pBBR1-kan-P tet -redγ-ET_rhi145 was used as the basic vector, which was digested with HindⅢ to recover the linear vector; S2, amplify the amp-ccdB fragment by PCR, transform the linear vector obtained in step S1 and the amp-ccdB fragment with homology arms into E. coli GBdir-gyrA462 for linear-linear homologous recombination LLHR, spread on ampicillin resistance plates, extract plasmid for restriction enzyme digestion verification, and obtain pBBR1-kan-P tet -ET-amp-ccdB_rhi145 plasmid; S3. Place pBBR1-kan-P tet -ET-amp-ccdB_rhi145 plasmid was digested with BamHI and the linear vector was recovered; S4. Obtain P with homology arms by Overlap PCR tet -cas9 fragment; the linear vector obtained in step S3 and the P with homology arms tet -cas9 fragment was transformed into E.coli GB05-dir for LLHR, and then coated on kanamycin resistance plates. After plasmid restriction enzyme digestion verification and sequencing, the correct pBBR1-kan-P tet -redγ-ET-cas9_rhi145 plasmid, which does not contain sgRNA at this time, and its nucleotide sequence is shown in SEQ ID NO.2; S5. Insert pBBR1-kan-P tet -redγ-ET-cas9_rhi145 plasmid was digested with PacⅠ, and the linear vector was recovered; S6. Use sgRNA-F / sgRNA-R as primers, without template, and directly anneal and extend to obtain the sgRNA fragment. This fragment is too small to be inserted into the plasmid by LLHR, so Overlap PCR with the amp-ccdB sequence is required to obtain the sgRNA-amp-ccdB fragment. S7, the linear vector obtained in step S5 and the sgRNA-amp-ccdB fragment with homology arms obtained in step S6 were transformed into E. coli GBdir-gyrA462 for LLHR to obtain pBBR1-kan-P tet -ET-sgRNA-amp-ccdB-cas9_rhi145 plasmid, the plasmid was digested with AscⅠ, and transformed into E.coli GB2005 after T4 ligation. The plasmid was spread on a kanamycin resistance plate, and the plasmid was digested and sequenced to obtain the correct pBBR1-kan-P tet -redγ-ET-sgRNA-cas9_rhi145 plasmid.

4. The construction method according to claim 3, characterized in that: The recovery of the linear vector is carried out by ethanol precipitation.

5. The construction method according to claim 3, characterized in that: When performing enzyme digestion, perform overnight digestion treatment.

6. The construction method according to claim 3, characterized in that: The transformation is carried out by electroporation.

7. Use of the Agrobacterium tumefaciens genome editing system according to claim 1 or 2 in genetic modification of genomic DNA by mediating homologous recombination of short homology arms in Agrobacterium tumefaciens.

8. The use according to claim 7, characterized in that The short homology arm is specifically a homology arm of 80-160 bp; further, a homology arm of 160 bp.

9. A method for genetic modification of genomic DNA by homologous recombination of short homology arms in Agrobacterium tumefaciens, characterized in that: The method comprises: using the Agrobacterium tumefaciens genome editing system according to claim 1 or 2 to perform genome editing on Agrobacterium tumefaciens.

10. The method according to claim 9, characterized in that The Agrobacterium tumefaciens includes Agrobacteriumtumefaciens C58; The genome editing includes gene knockout; The condition parameters in the method include: starting OD 600 =0.05-0.2, transfer at 25-35℃ for 2-6h to make OD 600 The concentration of the culture medium was 0.4-0.7, induced at 25-35℃ for 0.5-2h, and the competent cells were prepared with ddH2O. The amount of exogenous DNA was 0.5-.1.5mg, the length of the homology arm was 80-160bp, the electroporation voltage was 1200-1400V / mm, the recovery time was 2-4h, and 5-40nM dNTP was added to the recovery medium. The final concentration of Protease K was 5-20μg / mL. Further, the condition parameters include: starting OD 600 =0.1, 30℃ for 4h to make OD 600 The concentration of the culture medium was 0.6-0.7, induced at 30°C for 1h, and competent cells were prepared with room temperature ddH2O at room temperature. The amount of exogenous DNA was 1.5mg, the length of the homology arm was 160bp, the electroporation voltage was 1350V / mm, the recovery time was 3h, and 10nM dNTP was added to the recovery medium. The final concentration of ProteaseK added was 10μg / mL.

Images