Application of OspPLAV gene in regulation and control of rice flooding stress tolerance

Abstract

The invention discloses an application of an OspPLAV gene in regulation and control of rice flooding stress tolerance. According to the invention, an OspPLAV gene editing knockout vector is constructed, an agrobacterium-mediated method is adopted to transform rice calluses, and a knockout strain of the OspPLAV gene is obtained through screening, and the knockout strain of the OspPLAV gene shows a phenotype that after seeds germinate under a waterflooding condition, seedling roots are developed, seedling growth of the overground part of the seedlings is faster, the growth speed of a first leaf is faster, and the seedling rate is high; the method has great significance in solving the problems of slow seedling growth, inhibited radicle development, low seedling rate and the like in the rice direct seeding process, and has a wide application prospect in plant breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to the application of OspPLAⅤ gene in regulating rice waterlogging stress tolerance. Background Art

[0002] Rice is one of the main food crops in my country. More than half of the world's population relies on rice for food, and its yield directly affects basic livelihood issues. With the rapid development of economy and urbanization, rice direct seeding technology that reduces labor, reduces costs, and facilitates mechanization and simple operation has received more and more attention. The key to promoting direct seeding technology is the problem of seed germination under flooding conditions. Therefore, the development and application of genes related to flooding resistance is crucial for the development of flood-resistant rice varieties. Summary of the invention

[0003] In order to overcome the above-mentioned defects and deficiencies of the prior art, the present invention provides an application of the OspPLAⅤ gene in regulating the growth of rice root system, the growth of the aboveground seedling length, the growth rate of the first leaf and the seedling rate under flooding conditions. Specifically, by knocking out the OspPLAⅤ gene, an OspPLAⅤ gene knockout strain is constructed, and the seedlings of the OspPLAⅤ gene knockout plant seeds after germination show a phenotype of a well-developed root system, faster growth of the aboveground seedling length, faster growth rate of the first leaf and higher seedling rate.

[0004] The first object of the present invention is to provide an application of the OspPLAⅤ gene in regulating rice waterlogging stress tolerance, wherein the OspPLAⅤ gene is a gene encoding a protein having an amino acid sequence as shown in SEQ ID NO.2.

[0005] Preferably, the application is that the nucleotide sequence of the OspPLAⅤ gene is as shown in SEQ ID NO.1.

[0006] Preferably, the application is the application of knocking out the OspPLAⅤ gene in promoting root growth of rice seedlings under flooding conditions.

[0007] Preferably, the application is the application of knocking out the OspPLAⅤ gene in promoting the growth of the aboveground part of rice seedlings under flooding conditions.

[0008] Preferably, the application is the application of knocking out the OspPLAⅤ gene to accelerate the growth of the first leaf of rice seedlings under flooding conditions.

[0009] Preferably, the application is the application of knocking out the OspPLAⅤ gene to improve the rice seedling rate under flooding conditions.

[0010] Preferably, the knockout of OspPLAⅤ gene is by knocking out OspPLAⅤ gene through CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0011] The second object of the present invention is to provide a method for obtaining improved rice with developed seedling root system, fast growth of aboveground seedling length, fast growth rate of first leaf and high seedling rate under flooding conditions, comprising the step of knocking out the OspPLAⅤ gene; the OspPLAⅤ gene is a gene encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.

[0012] Preferably, its nucleotide sequence is shown as SEQ ID NO.1.

[0013] Preferably, the knockout of OspPLAⅤ gene is to knock out OspPLAⅤ gene by CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The OspPLAⅤ gene and its encoded protein of the present invention can be used to regulate the root development, aboveground length growth of seedlings, growth of the first leaf and seedling rate after germination of rice seeds under flooding conditions. The OspPLAⅤ gene knockout strain exhibits a phenotype of well-developed seedling root system, faster growth of aboveground length of seedlings, faster growth of the first leaf and high seedling rate under flooding conditions. Therefore, the present invention can provide genetic resources for solving the problems of slow seedling growth, inhibited radicle development and low seedling rate during direct seeding of rice seeds and for cultivating new rice varieties. The present invention is of great significance for solving the problems of slow seedling growth, inhibited radicle development and low seedling rate during direct seeding of rice seeds, and has broad application prospects in plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the mutation type and sequencing peak diagram of the OspPLAⅤ gene knockout plant.

[0017] Figure 2 The results are shown for WT, ospplav-4, and ospplav-7 after germination for 4 days under 2 cm deep water flooding conditions.

[0018] Figure 3 The results are shown for WT, ospplav-4, and ospplav-7 after germination for 6 days under 2 cm deep water flooding conditions.

[0019] Figure 4This is the statistical result of the aboveground seedling length and root length of WT, ospplav-4, and ospplav-7 after germination for 6 days under 2 cm deep water flooding conditions.

[0020] Figure 5 These are actual pictures of WT, ospplav-7, and ospplav-4 rice seeds after germination for 10 days under 7 cm deep water flooding conditions; among them, A is the state of representative rice seeds of WT, ospplav-7, and ospplav-4 after germination for 10 days under 7 cm deep water flooding conditions, and B is the overall state of WT, ospplav-7, and ospplav-4 rice seeds after germination for 10 days under 7 cm deep water flooding conditions.

[0021] Figure 6 The actual pictures are of WT, ospplav-4, and ospplav-7 rice seeds after germination for 10 days under flooding conditions; among them, * indicates that the seedling rate of the gene knockout strain is significantly different from that of the WT at the level of p<0.05, and *** indicates that the seedling rate of the gene knockout strain is significantly different from that of the WT at the level of p<0.001. DETAILED DESCRIPTION

[0022] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0023] OspPLAⅤ belongs to the phospholipase A family and is homologous to the human PNPLA3 protein. Although OspPLAⅤ belongs to the phospholipase A family, it has low homology with PLA1, PLA2 and the pPLA subfamily, and high homology with the Arabidopsis ATGL protein. So far, there has been no literature report, and its function is still unclear. The present invention obtains the OspPLAⅤ gene knockout homozygous strain by gene knockout. Compared with the wild type, the seeds of the OspPLAⅤ gene knockout strain germinate under flooding conditions, showing a phenotype of well-developed seedling root system, faster growth of the aboveground seedling length, faster growth of the first leaf, and high seedling rate.

[0024] Example 1: Construction of OspPLAⅤ gene knockout vector and acquisition of rice gene knockout plants

[0025] 1. Construction of OspPLAⅤ gene knockout vector

[0026] The CRISPR / Cas9 genome editing system was used to edit the OspPLAⅤ gene in wild-type rice (Zhonghua 11) to obtain gene knockout plants. The specific method is as follows.

[0027] The exon sequence of the target gene OspPLAⅤ (whose CDS sequence is shown in SEQ ID NO.1, with a total length of 1158 bp, and the protein encoded by the amino acid sequence is shown in SEQ ID NO.2, with 385 amino acids) was analyzed using the CRISPR P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR), and two specific target sequences were selected, namely target 1: GCGTGCACACGTGTCGTCGTCGG (SEQ ID NO.3) and target 2: TGCGCGACGCCGATGTGGTAGGG (SEQ ID NO.4). Two expression cassettes U6a-target 1-sgRNA and U3-target 2-sgRNA connected to sgRNA were obtained by overlapping PCR. The two expression cassettes were connected to the pYLCRISPR / Cas9Pubi-H vector by taking advantage of the non-overlapping cleavage site and recognition site of the BsaI enzyme to generate the pCRISPR-OspPLAⅤ vector containing the OspPLAⅤ specific target, and transformed into Agrobacterium EHA105 competent cells. After the plasmids were extracted from the positive clones, they were sent to the company for sequencing, and the pCRISPR-OspPLAⅤ plasmid with the correct result was selected to infect rice callus tissue with Agrobacterium to screen the tissues that successfully knocked out the OspPLAⅤ gene, and regenerate the gene knockout plants.

[0028] 2. Identification of homozygous OspPLAⅤ gene knockout plants

[0029] The total genomic DNA of a single T0 transgenic plant was extracted and used as a template to perform PCR amplification on the nucleotide sequences containing target 1 and 2 using primers flanking the specific target sites of the OspPLAⅤ gene. Specifically, the nucleotide sequence containing target 1 was PCR amplified using T1-F / T1-R (T1-F: CCACGCACCTAAACGAATTAAC, SEQ ID NO.5; T1-R: CGAGCATGAAGCGACGGAAG, SEQ ID NO.6); the nucleotide sequence containing target 2 was PCR amplified using T2-F / T2-R: (T2-F: GGGGTGGTGTGGGAGCAG, SEQ ID NO.7; T2-R: GTTCGCGTAGAAGAGGTAAGAG, SEQ ID NO.8). The amplified product with a single and clear target band was recovered and sent to the company for sequencing. After sequencing, the sequencing results were decoded and analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ). Two homozygous OspPLAⅤ gene knockout strains, ospplav-7 and ospplav-4, with different independent editing sites were selected for subsequent experiments. The sequencing results of the knockout strains are shown in Figure 1 shown.

[0030] Example 2: Germination analysis test of rice seeds of OspPLAⅤ gene knockout strain in 2 cm deep water

[0031] The seeds of wild-type rice plants WT, OspPLAⅤ knockout lines ospplav-7, and ospplav-4 were placed in transparent square germination boxes, 200 mL of distilled water was added, the water depth was 2 cm, and they were cultured in a 28°C incubator with a light / dark setting of 12h / 12h. Three biological replicates were set up, with 30 rice seeds in each replicate, and the germination of seeds under flooding germination treatment was observed. Under flooding conditions, the length of the root sprouts of ospplav-4 and ospplav-7 was equivalent to the seed length after 4 days of germination, while the wild-type radicle had just begun to sprout ( Figure 2 ). After germination for 6 days under flooding conditions, the first leaf of ospplav-4 and ospplav-7 had grown, and the average length of the aboveground seedlings was 8.8 cm and 7.7 cm, and the root length continued to elongate, with an average root length of 6.6 cm and 4.9 cm; the first leaf of the wild type did not grow, and the root length was only equivalent to the seed length, with an average root length of 0.8 cm ( Figure 3 ). The statistical data of root length and aboveground length of ospplav-4, ospplav-7 and wild type WT at 6 days of germination under flooding conditions are shown in Figure 4 shown.

[0032] Example 3: Germination analysis test of rice seeds of OspPLAⅤ gene knockout strain in 7 cm deep water

[0033] The seeds of wild-type rice plants WT, OspPLAⅤ knockout strains ospplav-7 and ospplav-4 were placed in transparent culture bottles, 280 mL of distilled water was added, the water depth was 7 cm, and the bottles were cultured in a 28°C incubator with a light / dark period of 12h / 12h, and the distilled water was changed every 2 days. 20 rice seeds were placed in each culture bottle, and the process was repeated 3 times. The growth of seeds after germination under deep water flooding was observed, and the seedling rate was calculated after 10 days of germination. The calculation formula was: seedling rate = number of seeds that can germinate and can normally seedling / total number of seeds. The experimental results showed that after germination for 10 days under 7 cm deep water flooding conditions, the seedling rates of ospplav-7 and ospplav-4 were 92% and 93%, respectively, while that of the wild type was only 48%. After knocking out the OspPLAⅤ gene, the seedling rate of seeds germinating under water flooding can be significantly improved ( Figure 6 ), and the leaf and root development of ospplav-7 and ospplav-4 were better than that of the wild-type strain WT, and WT was mostly deformed seedlings with abnormal root development ( Figure 5 ).

Claims

1. Application of OspPLAⅤ gene in regulating waterlogging stress tolerance in rice, characterized in that: The OspPLAⅤ gene is a gene encoding a protein whose amino acid sequence is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the OspPLAⅤ gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: To knock out the OspPLAⅤ gene and promote the root growth of rice seedlings under flooding conditions.

4. The use according to claim 1, characterized in that: To knock out the OspPLAⅤ gene and promote the growth of the aboveground seedling length of rice seedlings under flooding conditions.

5. The use according to claim 1, characterized in that: To knock out the OspPLAⅤ gene to accelerate the growth of the first leaf of rice seedlings under flooding conditions.

6. The use according to claim 1, characterized in that: To knock out the OspPLAⅤ gene and apply it to improve the rice seedling rate under flooding conditions.

7. The use according to claim 3, characterized in that: The knockout of OspPLAⅤ gene is to knock out the OspPLAⅤ gene through CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.

4.

8. A method for obtaining improved rice with developed seedling root system, fast growth of aboveground seedling length, fast growth of first leaf and high seedling rate under flooding conditions, characterized in that: The method comprises the step of knocking out the OspPLAⅤ gene; the OspPLAⅤ gene is a gene encoding a protein having an amino acid sequence as shown in SEQ ID NO.

2.

9. The method according to claim 8, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

10. The method according to claim 8, characterized in that The knockout of OspPLAⅤ gene is to knock out OspPLAⅤ gene by CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

Images