Method for researching and accurately identifying incidence law of flue-cured tobacco fusarium root rot disease in Qujing tobacco area

Abstract

The invention belongs to the field of plant protection, and discloses a Qujing tobacco area flue-cured tobacco fusarium root rot disease incidence law research and accurate identification method, which comprises the following steps: collecting tobacco plant samples with typical tobacco fusarium root rot; performing morphological identification, pathogenicity determination of pathogenic bacteria and molecular biological identification on the strain to be tested; separating and screening antagonistic strains, determining the types of the strains to be detected, and carrying out antagonistic bacteria bacteriostasis spectrum determination; according to different action mechanisms, a plurality of bactericides are selected for medicament screening experiments, and the indoor toxicity of the QJ-331 strain is measured. The method closely focuses on the requirements of green development and high-quality development of a Qujing tobacco planting area, aims at reducing the tobacco leaf production loss caused by the fusarium root rot and reducing tobacco leaf pesticide residues, and continuously increases accurate identification of the flue-cured tobacco fusarium root rot and research, development and application of a biological prevention and control key technology.

Description

Technical Field

[0001] The present invention belongs to but is not limited to the technical field of plant protection, and in particular relates to a study on the pathogenesis of tobacco Fusarium root rot in Qujing tobacco area and a precise identification method. Background Art

[0002] High-quality tobacco production has always been the primary goal of tobacco production, but the prevalence of diseases will pose a serious threat to tobacco production. In recent years, changes in tobacco planting systems, defects in crop rotation systems, expansion of tobacco production areas, and changes in the planting environment affected by climate have all made the incidence and prevalence of root and stem diseases in tobacco production increasingly serious, causing yield losses in tobacco production and also affecting the quality of tobacco leaves.

[0003] Qujing City, Yunnan Province is an important base for tobacco leaf production in my country. Its scale and area have always ranked first among similar production areas in the country. More than 1.2 million mu of flue-cured tobacco is planted in Qujing tobacco-growing areas all year round. In recent years, with the adjustment of planting structure, limited land rotation, and large-scale promotion and application of seedling transplanting technology under film, continuous cropping obstacles have become more serious year by year. In addition, abnormal changes in the global climate, variety resistance problems, and lack of healthy cultivation technology have led to the deterioration of the soil rhizosphere ecological environment in some areas of the tobacco-growing areas. The occurrence and harm of soil-borne diseases, mainly tobacco Fusarium root rot and black shank disease, have gradually worsened, causing serious losses in some local areas. According to the project team's survey on the incidence of flue-cured tobacco rhizomes and stem diseases in 9 tobacco-growing counties (urban areas) in Qujing from 2020 to 2021, a total of 1,000 diseased tobacco plants were collected in the city, and soil 2001 soil samples were collected, covering 100% of all tobacco-growing towns in the city. The samples were isolated, pathogenic, and morphologically and molecularly identified. The results showed that 55.40% of the tobacco samples were infected with only one pathogen, Fusarium, 21.25% of the samples were infected with oomycetes (the pathogen of tobacco black shank) and Fusarium, and 23.35% of the samples were infected with pathogens such as Ralstonia solanacearum, tremella, oomycetes, and Fusarium. The incidence of Fusarium root rot reached 15.25%, and the incidence in serious areas reached 45.76%. Fusarium root rot has risen from a minor disease in previous years to a major rhizome disease with a greater impact on tobacco production, occupying the primary position among common rhizome diseases, and the damage to tobacco production has exceeded tobacco black shank, root knot nematode disease, root black rot, bacterial wilt and other rhizome diseases.

[0004] At present, there is only one chemical agent "Firmes" for the prevention and control of Fusarium root rot. The prevention and control agent is too single, easy to produce drug resistance, and the prevention effect is not ideal. At the same time, "Firmes" is a high-risk pesticide with excessive tobacco leaf pesticide residues according to the "Notice of Yunnan Provincial Company of China National Tobacco Corporation on the Release of a Negative List of Tobacco Pesticides and Fertilizers" (Yunyan Ke

[2022] No. 18). Tobacco farmers are in a dilemma with no effective agents available and no biological agents to choose from. They can only abuse some other high-risk, high-residue chemical agents for passive prevention and control, which will result in poor prevention and control of Fusarium root rot, and the incidence of Fusarium root rot remains high, causing more and more serious losses to tobacco leaves.

[0005] In view of the above analysis, the technical problems that need to be solved urgently in the prior art are:

[0006] Fusarium root rot in Qujing tobacco growing areas has risen from a minor disease to a major disease. Currently, there are problems such as unsatisfactory prevention and control effects and a high risk of excessive pesticide residues. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a method for studying the incidence patterns of tobacco Fusarium root rot disease in Qujing tobacco area and for accurate identification.

[0008] The present invention is achieved by a method for studying the pathogenesis of flue-cured tobacco Fusarium root rot in Qujing tobacco area and accurately identifying the disease, which is characterized in that the method specifically includes:

[0009] S1: Collect samples of tobacco plants with typical tobacco Fusarium root rot;

[0010] S2: Morphological identification of the test strains, pathogenicity determination of the pathogens, and molecular biological identification;

[0011] S3: Isolate and screen antagonistic strains, determine the type of strain to be tested, and perform antibacterial spectrum measurement of antagonistic bacteria;

[0012] S4: Based on different mechanisms of action, multiple fungicides were selected for drug screening experiments to determine the indoor virulence of the QJ-331 strain.

[0013] Further, the S1 collects tobacco plant samples with typical tobacco Fusarium root rot, cuts a small piece of fresh tissue at the junction of the diseased and healthy parts, disinfects them with 75% alcohol and 0.1% mercuric chloride solution in sequence, rinses the tissue block with sterile water for 3 times, and uses sterile filter paper to absorb the residual moisture on the surface of the tissue, evenly places it in PDA culture medium, cultures it in a constant temperature incubator at 28°C for 3-5 days, and then waits for the colonies to grow, picks the edge colonies, and places them in PDA culture medium for purification.

[0014] Furthermore, in the morphological identification in S2, after the test strain is cultured on the PDA plate for 7 days, the colony morphological characteristics of the pathogen are observed and recorded with the naked eye, and the hyphae, spores, spore-forming cells, etc. of the pathogen are observed under an optical microscope, and their sizes are measured for morphological identification.

[0015] Further, the pathogenicity of the pathogen in S2 is determined by conducting potted plant experiments using two methods: wound stem base inoculation and wheat grain inoculation, respectively, to screen out the most pathogenic strain for molecular biological identification, and to complete subsequent experiments. The non-pathogenic strain can be stored at 4°C as a biocontrol strain. The steps include:

[0016] (1) Inoculation at the base of the stem with wounds: Take healthy tobacco seedlings with 5-8 leaves, inoculate the isolated pathogens into the base of the stems of the tobacco seedlings by wound inoculation, keep them moist with absorbent cotton for 24 hours, and place them in an incubator at 28°C to maintain a high temperature and high humidity environment to induce the tobacco seedlings to become diseased;

[0017] (2) Inoculation of wheat grains with bacteria: Select an appropriate amount of full barley grains, rinse them repeatedly until there are no impurities, soak them in clean water for 2 hours, and dispense them into 250 mL triangular flasks. Add 12.5 mL of 12% honey water and 12.5 mL of 2% peptone aqueous solution for every 70 g of the grains, sterilize them at 121°C for 1 hour, add 10 5 mm pathogen cakes after the grains are cooled, shake them thoroughly, and place them in a 28°C incubator for 15 days. During the incubation period, shake the flask every day, mix the wheat grains with pathogens with the culture soil at a ratio of 1:10, place them in plastic flower pots, and finally plant healthy tobacco seedlings with 5-8 leaves;

[0018] (3) Koch's postulates verification: After the inoculated tobacco seedlings show symptoms, the pathogen is isolated to obtain pure culture, and the morphological characteristics of the re-isolated colonies are observed to see whether they are consistent with the initial isolated colonies. Morphological and rDNA ITS sequence identification are performed to complete Koch's postulates verification to determine the pathogenic bacteria.

[0019] Furthermore, in the molecular biological identification in S2, the total DNA of the tested strains was extracted using the CTAB method:

[0020] (1) Preheat the CTAB extract in a 65°C water bath to fully dissolve it;

[0021] (2) Grind the collected hyphae into powder in a sterile mortar and pestle, take an appropriate amount and mix it with 500 μL C TAAB extraction buffer in a 1.5-mL centrifuge tube, and place it in a 65°C water bath for 45 min, shaking it several times during the process;

[0022] (3) Cool the centrifuge tube to room temperature and centrifuge at 10,000 rpm for 10 min. Take the supernatant and mix it with an equal volume of chloroform and emulsify it for 10 min.

[0023] (4) Centrifuge the above liquid at 10,000 rpm for 10 min, take the supernatant and mix it with an equal volume of isopropanol, and place it in a -20°C refrigerator for 30 min;

[0024] (5) Take the above liquid out of the refrigerator, centrifuge at 10,000 rpm for 10 min, remove the supernatant and retain the DNA precipitate, wash it twice with 75% alcohol and once with anhydrous ethanol;

[0025] (6) After air-drying the DNA precipitate, add 40 μL TE solution to dissolve it and store it in a -20°C refrigerator for later use. Use the universal primers ITS1 and ITS4 for fungal ribosomal DNA to perform PCR amplification on the rDNA-ITS gene of the test strain. Finally, use 1% agarose gel electrophoresis to detect the PCR product and store it in a 4°C refrigerator.

[0026] (7) The PCR products were sequenced in both forward and reverse directions by Kunming Qingke Biotechnology Co., Ltd. The sequencing results were compared with the genes published in GenBank on the website http: / / www.ncbi.nlm.nih.gov for homology, and the phylogenetic tree was constructed using MEGA5.0 software to analyze their genetic relationships.

[0027] Further, in S3, rhizosphere soil without disease was collected from the field where Fusarium root rot of flue-cured tobacco occurred in the systematic survey point of Qujing tobacco area for isolating antagonistic bacteria, with Fusarium W8 as the target strain, and the isolation, screening and identification steps include:

[0028] (1) separation medium;

[0029] (2) Isolation and purification of antagonistic microorganisms in tobacco soil: The rhizosphere soil samples of healthy tobacco plants were mixed evenly by dilution and plate spreading methods. 5 g of soil sample and 45 ml of sterile water were placed in a 50 ml centrifuge tube, shaken at 170 r / min for 30 min, and then placed on a clean bench for 10 min. The supernatant of the soil bacterial suspension was taken and a gradient dilution method was used to prepare a 10-2 to 10-6 dilution for standby use. The prepared 10-4 to 10-5 concentration soil solution was spread on the NA culture medium. The spreader was spread evenly and inverted for culture. Three replicates were set for each treatment. Single colonies were picked and inoculated in different culture media. The culture was purified by plate streaking method and stored at 4 °C.

[0030] (3) Screening of antagonistic microorganisms. Fusarium W8 was used as the target bacteria. The plate confrontation method was used to determine the inhibition rate of the obtained strains against the test fungi. A hole puncher (R = 7 mm) was used to obtain a bacterial cake with the same growth. The bacterial cake was inoculated in the center of a new PDA plate and cultured at 27 ± 2 ° C for 24 h. After that, 1 μL of the test bacterial suspension (OD600 = 1) was inoculated at a distance of 2.5 cm from W8. Sterile water was inoculated as a control and cultured at 27 ± 2 ° C for 5 days. The strains that produced the inhibition zone were screened, and the colony diameter of the W8 strain was measured to calculate the inhibition rate. Each experiment was repeated 3 times. The screened strains with antibacterial effect were purified and stored in a refrigerator at -80 ° C with 15% glycerol.

[0031]

[0032] (4) Identification of antagonistic microorganisms: The 16S rRNA of the strain to be tested was amplified using the bacterial universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1495R (5'-GGTTACCTTGTTACGACTT-3'), and cloned, transformed and sequenced. The gene sequence was compared with the published sequence in the NCBI database to determine the type of the strain to be tested;

[0033] (5) Indoor potted test of antagonistic strains: When the tobacco seedlings grow to the stage of 4 leaves and 1 heart, the antagonistic bacteria to be tested and the tobacco Fusarium root rot pathogen are inoculated by root irrigation, and the pathogen inoculation amount is 106 CFU / mL15mL. After inoculation of the pathogen, the plants are cultured in a greenhouse, and the disease situation of the tobacco seedlings is checked and recorded every day, and the disease index and relative control effect are calculated;

[0034] (6) Determination of the antibacterial spectrum of antagonistic bacteria. Through the re-screening results, two antagonistic bacteria with obvious antibacterial effects and antibacterial bands in the confrontation test were selected to conduct a plate confrontation test against common plant pathogenic bacteria Acidovoraxavenae subsp. citrulli, Bacillus cereus, Bacillus zanthoxyli, Bacillus aryabhattai, and Pseudomonas mediterranea to determine their antibacterial spectrum. The strains to be tested were activated on LB plates to make the fermentation broth concentration of 1×108 CFU / mL. According to the public Formula "C1V1=C2V2", take 2.5mL of pathogenic bacteria fermentation liquid of different concentrations in the biosafety cabinet, add 250mL of LB solid culture medium cooled to 55℃, shake well to make the final concentration of 106CFU / mL, pour into a culture dish of d=9cm and cool and solidify, then put 4 sterile filter paper pieces (d=6mm) at equidistant distance 2.5cm from the center of the LB plate mixed with different pathogenic bacteria, inoculate 5μL of antagonistic bacteria fermentation liquid with a concentration of 108CFU / mL on the filter paper pieces, add an equal amount of sterile water as a control, repeat 3 times, culture at 28℃ for 2d, observe and measure the diameter of the inhibition zone (D) generated around the antagonistic bacteria colony and the diameter (d) of the colony, and evaluate the inhibitory effect of antagonistic bacteria on pathogenic bacteria with the ratio of D / d;

[0035] (7) Field application of antagonistic microorganisms in the prevention and control of tobacco Fusarium root rot. Better biocontrol agents were screened in indoor experiments and field trials were carried out. The test biocontrol agents were inoculated into sterilized LB liquid culture medium and cultured at 32°C and 180 r / min for 18 h. The culture was diluted with sterile water to obtain a bacterial solution with a bacterial content of 1×108 CFU / mL.

[0036] Further, in S4, novel phenylpyrrole fungicides (Phenylpyrrole), sterol demethylation inhibitors (DMI), methoxyacrylate fungicides (QOI), succinate dehydrogenase inhibitors (SDHIs), amide urea combined with organic sulfur fungicides, and triazole combined with methoxyacrylate fungicides were selected for drug screening experiments.

[0037] Furthermore, the indoor virulence determination of the QJ-331 strain in S4 adopts the toxic medium method, and the final concentration gradient is determined based on the results of multiple preliminary experimental determinations in the early stage, and the steps are as follows:

[0038] (1) Use a triangular flask, add 100 mL of standard PDA culture medium powder to each bottle, inject 90 mL of ultrapure water, sterilize at 121°C for 30 min, and cool to below 50°C for later use;

[0039] (2) Dilute each original drug with sterile water (cooled below 50°C) 100 times according to the set maximum concentration to prepare a stock solution;

[0040] (3) According to the concentration gradient setting (I, II, III, IV, V, VI), the prepared mother solution is diluted again with sterile water to a solution 10 times greater than the concentration gradient setting of each agent, marked and set aside;

[0041] (4) Use a 1000 μg pipette to draw 10 mL of drug solution that is 10 times greater than the concentration gradient setting and add it to 90 mL (100 mL standard volume) of PDA culture medium. Shake evenly and pour into the plate to make a drug-containing culture medium. Add an equal amount of sterile water as a blank control. Repeat 3 times for each concentration, mark well, and set aside.

[0042] (5) Use a sterile cork puncher with a diameter of 5 mm to punch out bacterial blocks of the same age at the edge of the colony. Use an inoculation needle to pick them up and inoculate them into the center of the prepared drug-containing culture medium, with the side with mycelium facing down. Inoculate one bacterial block per dish, with 3 replicates for each treatment concentration, and culture them in a dark incubator at 28°C for 6 days.

[0043] (6) The cross-cross method was used to determine the inhibitory effect of different fungicides on the growth of pathogenic mycelium, and the cell counting method was used to determine the effect of different agents on the spore production of pathogenic bacteria;

[0044] (7) Use DPS software to process the data and obtain the toxicity regression equation Y=a+bx, R value and EC50 value; and use SPSS software to perform differential analysis on the inhibitory effects of each treatment;

[0045] (8) Inhibition rate formula:

[0046]

[0047] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0048] First, the present invention closely revolves around the requirements of green development and high-quality development in the tobacco-growing areas of Qujing, with the goal of reducing the losses of tobacco leaf production caused by Fusarium root rot and reducing agricultural residues in tobacco leaves, and continuously increases the accurate identification of flue-cured tobacco Fusarium root rot and the research and development and application of key technologies for biological control.

[0049] Second, the present invention aims at the accurate identification and pathogenesis of Fusarium root rot of flue-cured tobacco in Qujing tobacco area, overcoming the deficiencies of the prior art in disease identification, diagnostic accuracy, pathogen identification and prevention and control methods. Traditional disease identification methods often rely on empirical judgment, which easily leads to inaccurate disease diagnosis. At the same time, the prevention and control means are single and the effect is not ideal. The present invention provides a systematic and scientific identification method and comprehensive prevention and control strategy, which solves the problems of the prior art in accurate strain identification and efficient prevention and control.

[0050] The technical progress of the present invention is embodied in the following aspects:

[0051] 1. Accurate disease identification: Through multi-level verification of morphological identification, pathogenicity testing and molecular biological identification, the present invention improves the accuracy of pathogen identification and overcomes the high misjudgment rate in traditional disease identification. This process ensures the accurate determination of pathogen species and helps provide a basis for the subsequent selection of prevention and control measures.

[0052] 2. Effective antagonistic bacteria screening: The present invention separates and screens antagonistic strains with antibacterial effects, and measures the antibacterial spectrum of the antagonistic strains, thereby being able to lock in strains that have an inhibitory effect on Fusarium root rot pathogens. Compared with single chemical control methods, this biological control method is more environmentally friendly, reduces the burden of chemical agents on the environment, and improves the inhibitory effect on diseases.

[0053] 3. Multiple control strategies: In drug screening, the present invention screens out multiple fungicides based on different mechanisms of action and accurately measures their toxicity to specific pathogens. This comprehensive strategy avoids the drug resistance problem that may occur with a single drug and improves the effectiveness and long-term effectiveness of disease control.

[0054] 4. Applicable to industrial production: This invention provides a stable and repeatable process for monitoring and preventing flue-cured tobacco diseases, providing a scientific basis and reliable technical support for the large-scale production of the tobacco planting industry. This method provides a convenient means for early diagnosis and timely control of diseases, which is conducive to the high-quality development of the tobacco industry.

[0055] In summary, in industrial applications, the present invention not only improves the recognition accuracy of Fusarium root rot, but also enhances the prevention and control effect of the disease, provides practical and reliable technical support for disease management in the tobacco planting industry, and significantly promotes the sustainable development of tobacco planting. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 It is a flow chart of a method for studying the incidence law of flue-cured tobacco Fusarium root rot in Qujing tobacco area and accurate identification provided by an embodiment of the present invention;

[0057] Figure 2These are the symptoms of tobacco Fusarium root rot provided by the embodiments of the present invention;

[0058] Figure 3 is a system investigation point provided by an embodiment of the present invention;

[0059] Figure 4 It is the ratio of disease sample collection and pathogen separation provided by the embodiment of the present invention;

[0060] Figure 5 The disease conditions of different tobacco varieties provided by the embodiments of the present invention;

[0061] Figure 6 It is the morphological characteristics of Fusarium oxysporum provided in the embodiments of the present invention;

[0062] Figure 7 It is the morphological characteristics of Fusarium solani provided in the embodiments of the present invention;

[0063] Figure 8 It is the morphological characteristics of Fusarium equiseti provided in the embodiments of the present invention;

[0064] Fig. 9 It is the morphological characteristics of Fusarium acuminate provided by the embodiments of the present invention;

[0065] Fig.10 It is the morphological characteristics of elderberry Fusarium provided by the embodiment of the present invention;

[0066] Fig.11 It is the morphological characteristics of Fusarium odoratum provided in the embodiments of the present invention;

[0067] Fig.12 The pathogenicity determination of representative strains provided in the examples of the present invention is as follows: A: control group, B: Fusarium oxysporum, C: Fusarium equiseti, D: Fusarium solani, E: Fusarium sambucinum, F: Fusarium redolens, G: Fusarium acuminatum;

[0068] Fig.13 The pathogenicity determination of representative strains provided in the embodiments of the present invention is as follows: A: control group, B: Fusarium oxysporum, C: Fusarium equiseti, D: Fusarium solani, E: Fusarium sambucinum, F: Fusarium redolens, G: Fusarium acuminatum;

[0069] Fig.14is a phylogenetic tree constructed based on ITS genes provided in an embodiment of the present invention;

[0070] Fig.15 is a phylogenetic tree constructed based on ITS sequences provided in an embodiment of the present invention;

[0071] Fig.16 The effects of different temperatures and pH values ​​on the growth of QJ-331 mycelium provided in the embodiments of the present invention;

[0072] Fig.17 The bacterial strain provided in the embodiment of the present invention and Fusarium W8 are placed on a plate in confrontation;

[0073] Fig.18 The phylogenetic tree is constructed based on 16SrDNA sequence provided by the embodiment of the present invention;

[0074] Fig.19 The toxicity of the fungicides provided in the embodiments of the present invention to QJ-331 is determined as follows: A: fludioxonil, B: prochloraz, C: tebuconazole, D: pyraclostrobin, E: trifloxystrobin, F: difenoconazole, G: fluopyram, H: benzoyl·azanil, I: cymoxanil·mancozeb. DETAILED DESCRIPTION

[0075] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0076] like Figure 1 As shown, the embodiment of the present invention provides a method for studying the incidence law of flue-cured tobacco Fusarium root rot in Qujing tobacco area and accurately identifying the disease, the method specifically comprising:

[0077] S1: Collect samples of tobacco plants with typical tobacco Fusarium root rot;

[0078] S2: Morphological identification of the test strains, pathogenicity determination of the pathogens, and molecular biological identification;

[0079] S3: Isolate and screen antagonistic strains, determine the type of strain to be tested, and perform antibacterial spectrum measurement of antagonistic bacteria;

[0080] S4: Based on different mechanisms of action, multiple fungicides were selected for drug screening experiments to determine the indoor virulence of the QJ-331 strain.

[0081] S1, in order to clarify the species structure of the pathogen of tobacco Fusarium root rot in the tobacco-growing area of ​​Qujing, collect tobacco plant samples with typical tobacco Fusarium root rot. Cut a small piece of fresh tissue at the junction of the diseased and healthy parts, disinfect it with 75% alcohol and 0.1% mercuric chloride solution in turn, rinse the tissue block with sterile water for 3 times, and use sterile filter paper to absorb the residual water on the surface of the tissue, evenly place it in PDA culture medium, culture it in a constant temperature incubator at 28°C for 3-5 days, and then pick the edge colonies after the colonies grow out and place them in PDA culture medium for purification.

[0082] The morphological identification in S2 is to culture the test strain on the PDA plate for 7 days, observe and record the colony morphology of the pathogen with the naked eye, observe the hyphae, spores, spore-forming cells, etc. of the pathogen under an optical microscope, and measure their sizes for morphological identification.

[0083] The pathogenicity of the pathogen in S2 was determined by using two methods, namely, inoculation at the base of wounded stems and inoculation of wheat grains with bacteria, because the pathogens spread through the soil and cause rhizome lesions in tobacco plants. The most pathogenic strains were selected for molecular biological identification and subsequent experiments. Non-pathogenic strains can be stored at 4°C as biocontrol strains.

[0084] (1) Inoculation at the base of the stem with wounds: Take healthy tobacco seedlings with 5 to 8 leaves and inoculate the isolated pathogens into the base of the stems of the tobacco seedlings through wound inoculation. Keep them moist with absorbent cotton for 24 hours and place them in an incubator at 28°C to maintain a high temperature and high humidity environment to induce disease in the tobacco seedlings.

[0085] (2) Inoculation of wheat grains with bacteria: Select an appropriate amount of full barley grains, rinse them repeatedly until there are no impurities, soak them in clean water for 2 hours, and divide them into 250mL triangular bottles. Add 12.5mL of 12% honey water and 12.5mL of 2% peptone aqueous solution for every 70g, and sterilize them at 121℃ for 1 hour. After the wheat grains are cooled, add 10 5mm pathogen cakes and shake them well. Place them in a 28℃ incubator for 15 days, and shake the bottles every day during the incubation period. Mix the wheat grains with pathogens with the culture soil at a ratio of 1:10, place them in plastic flower pots, and finally plant healthy tobacco seedlings with 5-8 leaves.

[0086] (3) Koch's postulates verification: After the inoculated tobacco seedlings show symptoms, the pathogen is isolated according to the method in 1.3 to obtain pure culture, and the morphological characteristics of the re-isolated colonies are observed to see whether they are consistent with the initial isolated colonies. Morphological and rDNA ITS sequence identification are performed to complete Koch's postulates verification to determine the pathogenic bacteria.

[0087] In the molecular biological identification in S2, the total DNA of the tested bacteria was extracted using the CTAB method:

[0088] (1) Preheat the CTAB extract in a 65°C water bath to fully dissolve it;

[0089] (2) Grind the collected hyphae into powder in a sterile mortar and pestle, take an appropriate amount and mix it with 500 μL C TAAB extraction buffer in a 1.5-mL centrifuge tube, and place it in a 65°C water bath for 45 min, shaking it several times during the process;

[0090] (3) Cool the centrifuge tube to room temperature and centrifuge at 10,000 rpm for 10 min. Take the supernatant and mix it with an equal volume of chloroform and emulsify it for 10 min.

[0091] (4) Centrifuge the above liquid at 10,000 rpm for 10 min, take the supernatant and mix it with an equal volume of isopropanol, and place it in a -20°C refrigerator for 30 min;

[0092] (5) Take the above liquid out of the refrigerator, centrifuge at 10,000 rpm for 10 min, remove the supernatant and retain the DNA precipitate, wash it twice with 75% alcohol and once with anhydrous ethanol;

[0093] (6) After air-drying the DNA precipitate, add 40 μL TE solution to dissolve it and store it in a -20°C refrigerator for later use. Use the universal primers ITS1 and ITS4 for fungal ribosomal DNA to perform PCR amplification on the rDNA-ITS gene of the test strain. Finally, use 1% agarose gel electrophoresis to detect the PCR product and store it in a 4°C refrigerator.

[0094] Table 1 PCR amplification reaction system

[0095]

[0096] Table 2 Primer sequences and reaction procedures for PCR amplification

[0097]

[0098] (7) The PCR products were sequenced in both forward and reverse directions by Kunming Qingke Biotechnology Co., Ltd. The sequencing results were compared with the genes published in GenBank on the website http: / / www.ncbi.nlm.nih.gov for homology, and the phylogenetic tree was constructed using MEGA5.0 software to analyze their genetic relationships.

[0099] S3, collecting rhizosphere soil without disease from the field of flue-cured tobacco Fusarium root rot disease in the systematic survey point of Qujing tobacco area for isolating antagonistic bacteria, taking Fusarium W8 as the target strain, and the isolation, screening and identification steps include:

[0100] (1) Isolation culture medium

[0101] Table 3 Test medium

[0102]

[0103] (2) Isolation and purification of antagonistic microorganisms in tobacco soil. The rhizosphere soil samples of healthy tobacco plants were mixed evenly by dilution and plate spreading methods. 5 g of soil sample and 45 ml of sterile water were placed in a 50 ml centrifuge tube, shaken at 170 r / min for 30 min, and then placed on a clean bench for 10 min. The supernatant of the soil bacterial suspension was taken and a gradient dilution method was used to prepare a 10-2 to 10-6 dilution solution for standby use. The prepared 10-4 to 10-5 concentration soil solution was spread on the NA culture medium by the spreading method. The spreader was spread evenly and inverted for culture. Three replicates were set for each treatment. Single colonies were picked and inoculated in different culture media, purified by plate streak method and stored at 4 °C.

[0104] (3) Screening of antagonistic microorganisms, with Fusarium W8 as the target bacteria, the plate confrontation method was used to determine the inhibition rate of the obtained strains against the test fungi. A hole puncher (R = 7 mm) was used to obtain a bacterial cake with the same growth potential, and the bacterial cake was inoculated in the center of a new PDA plate and cultured at 27 ± 2 ° C for 24 h. After that, 1 μL of the test bacterial suspension (OD600 = 1) was inoculated at 2.5 cm away from W8, and sterile water was inoculated as a control. After culturing at 27 ± 2 ° C for 5 days, the strains that produced the antibacterial zone were screened, and the colony diameter of the W8 strain was measured to calculate the inhibition rate. Each experiment was repeated 3 times. The strains with antibacterial effect obtained by screening were purified and stored in a refrigerator at -80 ° C with 15% glycerol.

[0105]

[0106] (4) Identification of antagonistic microorganisms: The 16S rRNA of the strain to be tested was amplified using the bacterial universal primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1495R (5′-GGTTACCTTGTTACGACTT-3′), and cloned, transformed and sequenced. The gene sequence was compared with the published sequences in the NCBI database to determine the type of the strain to be tested.

[0107] (5) Indoor potted test of antagonistic strains: When the tobacco seedlings grow to the stage of 4 leaves and 1 heart, the antagonistic bacteria to be tested and the tobacco Fusarium root rot pathogen are inoculated by root irrigation. The inoculation amount of the pathogen is 106 CFU / mL15mL. After inoculation of the pathogen, the plants are cultured in a greenhouse, and the disease condition of the tobacco seedlings is checked and recorded every day. The disease index and relative control effect are calculated.

[0108] (6) Antagonistic bacteria antibacterial spectrum determination: Through the re-screening results, two antagonistic bacteria with obvious antibacterial effects and antibacterial bands in the confrontation test were selected to conduct a plate confrontation test against common plant pathogenic bacteria such as Acidovoraxavenae subsp. citrulli, Bacillus cereus, Bacillus zanthoxyli, Bacillus aryabhattai, and Pseudomonas mediterranea to determine their antibacterial spectrum.

[0109] The strain to be tested was activated on the LB plate to make the fermentation liquid concentration 1×108CFU / mL. According to the formula "C1V1=C2V2", 2.5mL of pathogenic bacteria fermentation liquid of different concentrations were taken in the biosafety cabinet and added to 250mL of LB solid medium cooled to 55°C, shaken to make the final concentration 106CFU / mL, and poured into a d=9cm culture dish to cool and solidify. Then, 4 sterile filter paper pieces (d=6mm) were placed equidistantly 2.5cm from the center of the LB plate mixed with different pathogenic bacteria, and 5μL of antagonistic bacteria fermentation liquid with a concentration of 108CFU / mL was inoculated on the filter paper pieces. The same amount of sterile water was added as a control, repeated 3 times, cultured at 28°C for 2d, and the diameter of the inhibition zone (D) and the diameter of the colony (d) produced around the antagonistic bacteria colony were observed and measured, and the inhibitory effect of antagonistic bacteria on pathogenic bacteria was evaluated by the ratio of D / d.

[0110] (7) Field application of antagonistic microorganisms in the prevention and control of tobacco Fusarium root rot. Better biocontrol agents were screened in indoor experiments and field trials were carried out. The test biocontrol agents were inoculated into sterilized LB liquid culture medium and cultured at 32°C and 180 r / min for 18 h. The culture was diluted with sterile water to obtain a bacterial solution with a bacterial content of 1×108 CFU / mL.

[0111] In S4, a novel phenylpyrrole fungicide (Phenylpyrrole), a sterol demethylation inhibitor (DMI), a methoxyacrylate fungicide (QOI), a succinate dehydrogenase inhibitor (SDHIs), an amide urea compound organic sulfur fungicide, and a triazole compound methoxyacrylate fungicide were selected for drug screening experiments. The names and manufacturers of the 9 fungicides are detailed in Table 4.

[0112] Table 4 Tested fungicides

[0113]

[0114] The indoor virulence determination of the QJ-331 strain adopts the toxic medium method, and the final concentration gradient is determined based on the results of multiple preliminary experimental determinations in the early stage. The steps are as follows:

[0115] Table 5 Bactericide concentration gradient setting

[0116]

[0117] (1) Use a conical flask, add 100 mL of standard PDA culture medium powder to each flask, inject 90 mL of ultrapure water, sterilize at 121°C for 30 min, and cool to below 50°C for later use.

[0118] (2) Dilute each original drug with sterile water (cooled below 50°C) 100 times according to the set maximum concentration to prepare a stock solution.

[0119] (3) According to the concentration gradient setting (I, II, III, IV, V, VI), the prepared mother solution is diluted again with sterile water to a solution that is 10 times greater than the concentration gradient setting of each agent, marked and set aside.

[0120] (4) Use a 1000 μg pipette to draw 10 mL of drug solution that is 10 times greater than the concentration gradient setting, add it to 90 mL (100 mL standard volume) of PDA culture medium, shake it evenly and pour it into the plate to make a drug-containing culture medium. Add an equal amount of sterile water as a blank control, repeat 3 times for each concentration, mark it and set aside.

[0121] (5) Use a sterile cork puncher with a diameter of 5 mm to punch out bacterial blocks of the same age at the edge of the colony. Use an inoculation needle to pick them up and inoculate them into the center of the prepared drug-containing culture medium, with the side with mycelium facing down. Inoculate one bacterial block per dish, with 3 replicates for each treatment concentration, and culture them in a dark incubator at 28°C for 6 days.

[0122] (6) The cross-cross method was used to determine the inhibitory effect of different fungicides on the growth of pathogenic mycelium; the cell counting method was used to determine the effect of different agents on the spore production of pathogenic bacteria.

[0123] (7) The data were processed using DPS software to obtain the toxicity regression equation Y=a+bx, R value, and EC50 value; and the inhibitory effects of each treatment were analyzed using SPSS software.

[0124] (8) Inhibition rate formula:

[0125]

[0126] The method provided by the present invention is aimed at studying the pathogenesis and precise identification of Fusarium root rot of flue-cured tobacco in Qujing tobacco-growing area. Through a series of steps, the pathogenic mechanism of the pathogen is deeply analyzed and effective prevention and control measures are screened out.

[0127] First, in step S1, samples of infected tobacco plants with typical Fusarium root rot characteristics are collected to ensure that the samples are representative and reliable. After sampling, aseptic operations are strictly performed in accordance with experimental requirements to avoid cross-contamination of samples and ensure the accuracy of subsequent experiments.

[0128] Next, step S2 performs triple identification of the test strain in terms of morphology, pathogenicity and molecular biology. Morphological identification first observes the appearance and microscopic characteristics of the strain, and analyzes the hyphae and conidia in detail under a microscope, recording their color, size and shape and other characteristics. In the pathogenicity determination of pathogens, the pathogens are inoculated into healthy tobacco plants, and the recurrence of the disease is observed to confirm the pathogenicity of the strain. Finally, molecular biology techniques (such as PCR amplification and gene sequencing) are used to specifically detect the DNA of the strain to ensure the accuracy of the identification results.

[0129] In step S3, bacterial strains with antagonistic effects are isolated and screened from environmental samples, and the inhibitory effect of antagonistic bacteria on pathogenic bacteria is evaluated by measuring the antibacterial spectrum of the test strains. The determination of the antibacterial spectrum helps to screen out antagonistic strains with a broad inhibitory effect on tobacco Fusarium root rot, thereby providing effective bio-inhibitor candidate strains for the prevention and control program.

[0130] Finally, step S4 selects different types of fungicides based on a variety of possible mechanisms of action and conducts a drug screening experiment. In the experiment, the indoor toxicity to the pathogen QJ-331 was determined in order to find a suitable fungicide formula and dosage. By accurately measuring the toxicity values ​​of different fungicides, agents with high bactericidal effects on Fusarium root rot were finally screened out, providing a theoretical basis for precise prevention and control.

[0131] Relevant evidence of the technical effects achieved by the embodiments of the present invention.

[0132] (I) Molecular identification, dominant species and epidemic pattern of Fusarium root rot in flue-cured tobacco in Qujing tobacco area

[0133] 1.1 Symptoms of Fusarium root rot in flue-cured tobacco

[0134] The severity of tobacco Fusarium root rot varies, and the symptoms are also different. Figure 2As shown, tobacco plants with a mild degree of disease showed slight dwarfing of the aboveground part, with chlorotic and soft leaves on the lower or one side, a wet appearance at the base of the stem, and no obvious pathological symptoms at the roots; tobacco plants with moderate disease were one-quarter to one-third shorter than healthy plants, with yellowing and shriveled leaves and curled edges, slender stems, black to yellow-brown at the base of the stem from bottom to top, with a small amount of white or pink hyphae, and relatively slender roots; tobacco plants with severe disease were more than one-third shorter than healthy plants, with completely withered leaves, black and dry stems, a large amount of white or pink hyphae at the base of the stem and leaves, and extremely fragile and black roots.

[0135] 1.2 Occurrence of Fusarium root rot in tobacco growing areas in Qujing

[0136] In order to find out the actual situation and damage degree of Fusarium root rot in tobacco growing areas in Qujing, a systematic survey was conducted at the main tobacco growing areas in Qujing City, including Jiuxian, Yuezhou, Lashan, Reshui, etc. Figure 3 ), select representative tobacco fields, and conduct systematic investigations in four periods: seedling stage, vigorous growth stage, harvest stage, and end of harvest stage according to the growth cycle of flue-cured tobacco. The statistical results of the investigation are shown in Table 4. The average severity of the disease in the four systematic investigation points is: Malong Jiuxian > Qilin Yuezhou > Xuanwei Reshui > Luoping Lashan. Among them, the most serious disease was in the Jiuxian systematic investigation point at the seedling stage, with an average incidence rate of 70.94% and a disease index of 39.2; the lightest disease was 0.76% at Lashan, with a disease index of 0.18.

[0137] Table 6 Occurrence of Fusarium root rot in flue-cured tobacco at different growth and development stages

[0138]

[0139] Through the collection of tobacco Fusarium root rot disease samples and the separation of pathogens, tobacco plant samples with typical tobacco Fusarium root rot were collected. A small piece of fresh tissue was cut from the junction of the diseased and healthy parts, and then disinfected with 75% alcohol and 0.1% mercuric chloride solution, rinsed with sterile water 3 times, and the residual water on the surface of the tissue was absorbed with sterilized filter paper, and evenly placed in PDA culture medium. After culturing in a constant temperature incubator at 28°C for 3-5 days, the edge colonies were picked out and placed in PDA culture medium for purification. Fusarium was detected in all of them, among which Yuezhou (86.96%)>Jiuxian (80.95%)>Reshui (76%)>Lashan (70.59%), and the average detection rate was 78.62%. ( Figure 4 )

[0140] Table 7 Proportion of Fusarium detection in diseased samples

[0141]

[0142] From the perspective of varieties, the severity of the disease at the four points is consistent with the variety resistance. The susceptible varieties are: Yunyan 97 (Yuezhou), Yunyan 87, Yunyan 105 (Reshui), Yunyan 301 (Jiuxian); the resistant variety is: K326 (Luoping). Figure 5 It can be seen that the disease conditions of various tobacco varieties are: Yunyan 87 is the most serious, and K326 is more resistant to tobacco Fusarium root rot.

[0143] Table 8 Disease incidence of different tobacco varieties

[0144]

[0145] 1.3 Results of sample collection and pathogen isolation and purification of tobacco Fusarium root rot in Qujing tobacco-growing area

[0146] In order to clarify the species structure of the pathogen of Fusarium root rot of flue-cured tobacco in Qujing tobacco-growing areas, samples of Fusarium root rot with typical symptoms in Qujing tobacco-growing areas were sampled at multiple points, preserved and transported to the laboratory for pathogen isolation, pathogenicity determination, and accurate morphological and molecular biological identification. A total of 655 Fusarium samples were obtained and preserved, and it was determined that the dominant species were mainly Fusarium oxysporum, accounting for 57.73%, and Fusarium solani, accounting for 26.80%. Based on the results of morphological observation, they were preliminarily divided into Fusarium oxysporum, Fusarium solani, Fusarium equiseti, Fusarium acuminatum, Fusarium sambucinum and Fusarium redolens.

[0147] (1) Morphological observation of Fusarium oxysporum: In the early stage of PDA culture medium, the colony was pure white felt-like, and pink-purple pigment was produced in the later stage. The aerial hyphae were luxuriant; the hyphae were septate, the large conidia were sickle-shaped, with sharp ends, most of them had 4 septa, (27-52) μm × (4-15) μm; the small conidia were oval, most of them had 0-2 septa, (6-18) μm × (2-4) μm; the thick-walled spores were 5-12 μm; the conidiophores were short and branched on the side of the hyphae (6-22) μm × (3-6) μm, and it was preliminarily identified as Fusarium oxysporum. Figure 6 )

[0148] (2) Morphological observation of Fusarium solani: In the early stage of PDA culture medium, the colony was milky white, and in the later stage it was brownish yellow. The aerial hyphae were densely villi-like; the hyphae had septa, and the large conidia were spindle-shaped and slightly curved, without tips at both ends, and most of them were 2 septa (30-43) μm × (5-19) μm; the small conidia were short cylindrical, and most of them were without septa (4-7) μm × (3-5) μm; the number of thick-walled spores was large, 5-10 μm, and the conidiophores were clustered. It was preliminarily identified as Fusarium solani. Figure 7 )

[0149] (3) Morphological observation of Fusarium equisetifolia: In the early stage of PDA culture medium, the colony was pure white cotton-like, and yellow pigment was produced in the later stage. The aerial hyphae were luxuriant; the hyphae were septate, the large conidia were sickle-shaped, slightly pointed or blunt at both ends, 2 to 6 septa, (22 to 58) μm × (6 to 16) μm; the small conidia were oval (7 to 17) μm × (3 to 6) μm; the thick-walled spores were 6 to 18 μm; the pseudocapitates were attached to long small single phialides, and it was preliminarily identified as Fusarium equisetifolia. Figure 8 )

[0150] (4) Morphological observation of Fusarium oxysporum: In the early stage of PDA culture medium, the colony was pure white cotton-like, and rose-red pigment was produced in the later stage. The aerial hyphae were short and hairy; the hyphae were septate, with more large conidia, crescent-shaped with sharp ends, 4 to 6 septa, (22 to 61) μm × (3 to 9) μm; the small conidia were less (5 to 11) μm × (3 to 4) μm; the conidiophores were clustered or solitary, and the thick-walled spores were irregularly round and 7 × 9 μm. It was preliminarily identified as Fusarium oxysporum. Fig. 9 )

[0151] (5) Morphological observation of elder Fusarium: When placed on PDA culture medium, the colonies were light yellow and short-hairy in the early stage, and the color deepened to brownish yellow in the later stage, but the substrate did not change color. The aerial hyphae were creeping and sparse. The large conidia were cylindrical, with blunt ends, mostly 3-4 septa, and the length and width were about (20-42) μm × (4-5) μm; the small conidia were oval, with a length and width of about (8-18) μm × (3-4) μm, and the number of large and small conidia was small; the conidiophores were short, and it was preliminarily identified as elder Fusarium. Fig.10 )

[0152] (6) Morphological observation of Fusarium odoratum: When placed on PDA culture medium, the colonies were white in the early stage and gray in the later stage, with short hairs; the hyphae were septate, the large conidia were club-shaped, most of them had 4 septa, with rounded ends, and the length and width were about (16-36) μm × (3-4) μm; the small conidia were oval, most of them had no septa or 1 septa, and the length and width were about (4-10) μm × (1-2) μm; the spores were produced on a single phialode, and no thick-walled spores were found. It was preliminarily identified as Elder Fusarium sambucifolium. Fig.11 )

[0153] 1.4 Determination of pathogenicity of pathogens

[0154] (1) Stem base wound inoculation method: After the six isolated Fusarium species were inoculated into the stem base of tobacco seedlings for 7 days, all of them showed symptoms, but the degree of disease was different, while the control group had no symptoms. The tobacco seedlings inoculated with Fusarium oxysporum had the most severe symptoms, with obvious blackening and shrinkage at the wound, accompanied by a large number of white hyphae; the tobacco seedlings inoculated with Fusarium equisetifolia and Fusarium solani had similar disease degrees, with the wound of the tobacco seedlings being water-soaked and yellow-brown, with a small amount of hyphae; the tobacco seedlings inoculated with Fusarium nigra showed yellowing and shrinkage at the wound; the tobacco seedlings inoculated with Fusarium acuminata and Fusarium odoriferum had yellowing at the wound, and the symptoms were milder.

[0155] ( Fig.12 )

[0156] (2) Inoculation of wheat grains with bacteria: About 20 days after the tobacco seedlings were transplanted to the infected soil, they all showed symptoms of the disease, with the aboveground parts of the seedlings being short and the stems being thin and weak. The leaves of some treatment groups first turned yellow-brown and then shrank and withered, which was consistent with the symptoms in the field. Among them, Fusarium oxysporum was the most pathogenic to tobacco seedlings. The tobacco seedlings almost stopped growing after transplanting. In the early stage, the leaves turned yellow and appeared water-soaked, thin and fragile, and the stems were thin and weak. In the later stage, white hyphae appeared at the base of the leaves and stems, and some tobacco seedlings died as a whole. The symptoms of tobacco seedlings caused by Fusarium equisetum were milder than those in the Fusarium oxysporum treatment group, and no tobacco seedlings died. The tobacco seedlings in the other treatment groups grew slowly, but no obvious symptoms appeared. Fig.13 )

[0157] 1.5 Molecular identification results

[0158] (1) Molecular identification of Fusarium oxysporum. Based on the pathogenicity identification results of the isolated pathogen, 50 mg of mycelium cultured for 5 days was ground with liquid nitrogen and transferred to an EP tube. DNA was extracted using a kit (Qiagen Enterprise Management (Shanghai) Co., Ltd.) and stored for later use. The 18SrDNA-ITS gene of QJ-331 was amplified using the universal fungal ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'), and the PCR system was 25 μL. An 18SrDNA-ITS sequence of 868 bp was obtained and sequenced in both forward and reverse directions. The sequencing results are as follows:

[0159] TCGGGGGTACACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAA CCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCC CGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAG TAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATAAGGCCGGAGGAACCACCAAATAAAC

[0160] The sequencing results were compared with the registered gene sequences by BLAST, showing that the homology with the ITS sequence of the strain with gene accession number OK326801.1 in the database was 99%. In the comparison results, 10 registered ITS sequences with higher homology were downloaded, and the phylogenetic tree was constructed and analyzed using MEGA5.0 software. The results are as follows Fig.14 As shown, W8 (OQ608063) isolated by the present invention is clustered with the registered Fusarium oxysporum, and the similarity is high, so they can be considered to be the same species. In summary, combined with the morphological identification results, it can be determined that QJ-331 isolated in the experiment is the pathogen of tobacco Fusarium root rot.

[0161] (2) Molecular identification of Fusarium solani

[0162] The sequencing results were uploaded to NBCI (https: / / blast.nbci.nlm.nih.gov / blast) for BLAST comparison. The results showed that the pathogen had a similarity of 99.00% with F.solani (ITS: MT896771.1). A multi-gene phylogenetic tree was constructed based on the rDNA-ITS gene fragment using the MEGA7.0 maximum likelihood method and the sequence of homologous genes. The results showed that the strain belonged to the same branch as F.solani and had the closest genetic distance. Combined with morphological characteristics, it was identified as F.solani. ( Fig.15 )

[0163] 1.6 Biological determination of the pathogen of flue-cured tobacco Fusarium root rot

[0164] (1) Test strains

[0165] The pathogen of tobacco Fusarium root rot was the QJ-331 strain with the strongest pathogenicity screened out in the pathogenicity determination experiment and preserved in the laboratory of the College of Agriculture and Life Sciences of Kunming University / Yunnan Urban Characteristic Agricultural Engineering Technology Research Center.

[0166] (2) Effects of temperature on mycelial growth and spore production of QJ-331

[0167] PDA was used as the basic medium, and the temperature was set at 10, 15, 20, 25, 30, 35, and 40°C. The QJ-331 strain that had been cultured for 7 days was selected, and a 5 mm × 5 mm bacterial cake was taken from the edge of the colony with a cork puncher, and the mycelium was inoculated in the center of the plate with the mycelium facing down. The treatment was repeated 3 times and cultured at a constant temperature of 28°C and without light for 6 days.

[0168] Depend on Fig.16 It can be seen that the diameter of QJ-331 hyphae increases with the increase of temperature in the range of 10-25℃, reaches a maximum value of 6.23±0.12cm at 25℃, and then decreases with the increase of temperature and stops growing at 40℃. The conidia production curve is single-peaked, with the lowest points at 0℃ and 40℃, reaching a maximum value of 10.67±0.88 (106·mL-1) at 30℃, and then drops sharply.

[0169] Depend on Fig.16It can be seen that QJ-331 mycelium can grow in the range of pH = 3.0 ~ 11.0, and the mycelium growth is significantly good at pH = 7.0 ~ 9.0. The colony diameter is 6.69 ± 0.11 cm at pH = 9.0, reaching the maximum value, and the colony diameter is 1.16 ± 0.21 cm at pH = 3.0, reaching the minimum value; the spore production of QJ-331 is larger in the range of pH = 5.0 ~ 9.0, and the spore production curve reaches the maximum value of 5.76 ± 0.52 (106·mL-1) at pH = 7.0.

[0170] (3) Effects of pH on mycelial growth and spore production of QJ-331

[0171] 1 mol / L C6H8O7 and C6H5Na3O7 were used to adjust the PDA medium (after sterilization) to prepare five gradient plates with pH values ​​of 4.0, 6.0, 7.0, 9.0, and 11.0. The QJ-331 strain that had been cultured for 7 days was selected, and a 5mm×5mm bacterial cake was taken from the edge of the colony with a hole puncher. The mycelium was inoculated in the center of the plate with the mycelium facing down. Each group of treatments was repeated 3 times and cultured at a constant temperature of 28°C and without light for 6 days. The colony diameter was measured by the cross method, and the spore count method was used to count the number of spores.

[0172] (4) Effects of carbon sources on mycelial growth and spore production of QJ-331

[0173] Czapek–Dox Medium was used as the basal medium without carbon source (KNO3 3g, K2HPO4 1g, MgSO4·7H2O 0.5g, KCl 0.5g, FeSO4·7H2O 0.01g, agar 20g, ultrapure water 1000mL, natural pH), and no carbon source was added as the CK group. Sucrose, fructose, lactose, glucose, and mannitol (all calculated as 30g / L pure carbon) were used to prepare different carbon source plates. The QJ-331 strain that had been cultured for 7 days was selected, and a 5mm×5mm bacterial cake was taken from the edge of the colony with a hole puncher. The mycelium was inoculated in the center of the plate with the mycelium facing down. The treatment was repeated 3 times and cultured at a constant temperature of 28℃ and without light for 6 days. The colony diameter was measured by the cross method, and the spore count method was used to count the number of spores.

[0174] Table 9 Effects of different carbon sources on mycelial growth rate and spore production of QJ-331

[0175]

[0176] Note: Different lowercase letters in the same column indicate significant differences at the 0.05 level.

[0177] Note:Thesamelowercasereachesthesignificantlevelof0.05inthetable.

[0178] As shown in Table 9, in the carbon source test, the mycelial growth of QJ-331 was best when sucrose was added as the carbon source, and the spore production was best when glucose was added as the carbon source. The mycelial growth of the treatment groups with fructose, lactose and mannitol as carbon sources was not significantly different from that of the treatment group without carbon source, among which the mycelial growth and spore production were the worst when mannitol was used as the carbon source.

[0179] (II) Screening and preliminary evaluation of antagonistic strains

[0180] After the endogenous microorganisms of tobacco soil and tobacco plants were separated and purified, the antagonistic strains against Fusarium were screened by plate confrontation culture method. After primary screening and rescreening, 21 antagonistic strains with antagonistic effects on Fusarium were finally obtained, accounting for 9.6% of the total number of screened strains. By using the inhibition diameter and inhibition rate as evaluation criteria, under the same conditions, the inhibitory effects of the separated and purified antagonistic bacteria on the growth and reproduction of Fusarium were different. Three strains with an inhibition rate of 60% to 70%, five strains with an inhibition rate of 70% to 80%, seven strains with an inhibition rate of 80% to 90%, and one strain with an inhibition rate greater than 90% were screened. The bacteria numbered 8 had the highest inhibition rate against Fusarium, reaching 90.51%. The 16SrDNA sequence was amplified by PCR using primers 27F and 1492R. The BLAST alignment and construction of the phylogenetic tree, combined with morphological and physiological and biochemical identification, showed that the strain belonged to Bacillus velezensis.

[0181] 2.1 Screening of antagonistic bacteria

[0182] After isolating and purifying the bacteria in tobacco-growing soil, the morphology and color differences of the bacteria were visually judged, and a total of 140 rhizosphere bacteria were isolated. After primary and secondary screening, 16 antagonistic strains with antagonistic effects on tobacco Fusarium root rot were finally obtained, accounting for 11% of the total number of strains. By using the inhibition diameter and inhibition rate as evaluation criteria, under the same conditions, the isolated and purified antagonistic bacteria had different inhibitory effects on the growth and reproduction of Fusarium (Table 10). Three strains with an inhibition rate of 60% to 70%, five strains with an inhibition rate of 70% to 80%, seven strains with an inhibition rate of 80% to 90%, and one strain with an inhibition rate greater than 90 were screened out. The bacterium numbered 8 had the highest inhibition rate against Fusarium, reaching 90.51%. ( Fig.17 )

[0183] Table 1016 bacterial strains against Fusarium solani (mean ± standard error)

[0184]

[0185]

[0186] 2.2 Identification of antagonistic bacteria

[0187] After plate confrontation, 16 strains of bacteria had good antagonistic effects on the test strains, and they were identified as Bacillus and Achromobacter. Among them, Bacillus was the dominant species collected from the soil this time, with 14 strains. Among them, W8 had the highest inhibition rate on the test strains, with an inhibition rate of 90.51%; W9, which had the lowest inhibition rate, belonged to Achromobacter, with an inhibition rate of only 62.22%. The inhibition zones of strains W2, W7, W8, W12 and W14 were the most obvious, and the antagonistic effects were better. In order to clarify the taxonomic status of the five strains, their 16SrDNA sequences were PCR amplified using primers 27F and 1492R. Through BLAST comparison and construction of phylogenetic trees, it was found that strains W2, W7, W8, W12 and W14 were clustered together with Bacillus Velezii ( Fig.18 ), combined with morphological and physiological and biochemical identification, it was shown that the five strains belonged to Bacillus velezensis. Therefore, follow-up studies were carried out on the five strains.

[0188] 2.3 Potted plant test of antagonistic strains

[0189] In order to ensure the feasibility of the experiment, five strains with good inhibitory effects were selected for potted plant experiments. The test results showed that after 21 days of inoculation with Fusarium, the five strains tested had different degrees of control effects on the incidence of tobacco seedlings. The incidence of tobacco seedlings inoculated with Fusarium without using pesticides was 70%, and the disease index was 49.52; there was a significant difference between the W7 treatment group and other treatment groups, with an incidence of 14.29%, a disease index of 9.52, and a control effect of 85.17%, with the best comprehensive control effect. The second was W8, with an incidence rate of 23.81%, a disease index of 25.85, and a control effect of 54.03%; there were no significant differences among the W12, W2, and W14 treatment groups, and the tobacco seedling incidence rate was higher among the treatment groups, at 42.86%, 47.62%, and 47.62%, respectively, and the disease indexes were 35.24, 32.80, and 30.69, respectively, and the control effects were 47.25%, 38.36%, and 44.14%, respectively, among which W2 had the worst control effect.

[0190] In summary, W7 had the best control effect, followed by W8, and the control effects of other treatments were average.

[0191] Table 11 Bacillus Velezii W2, W7, W8, W12 and W14 indoor potted plant protection effect

[0192]

[0193]

[0194] (III) Screening of flue-cured tobacco fusarium pesticides

[0195] 3.1 Indoor virulence determination of QJ-331 strain

[0196] The plates of each treatment group were placed in a dark incubator at 28°C for 6 days. The growth of QJ-331 mycelium and the inhibition of each agent on it are shown in Table 12. Each agent treatment had different degrees of inhibition on the mycelium growth of QJ-331, among which fludioxonil, prochloraz, tebuconazole and pyraclostrobin showed strong inhibition on QJ-331 mycelium at low concentrations. When the concentration of fludioxonil was 0.5μg / mL, the inhibition rate of mycelium growth reached 51.98%; when the concentration of prochloraz was 5μg / mL, the inhibition rate of mycelium growth reached 72.42%; when the concentration of tebuconazole was 30μg / mL, the inhibition rate of mycelium growth reached 96.25%; when the concentration of pyraclostrobin was 4μg / mL, the inhibition rate of mycelium growth reached 60.60%; when the concentrations of trifloxystrobin, difenoconazole and fluopyram reached 10μg / mL, 40μg / mL and 25μg / mL, the inhibition rates of mycelium growth all exceeded 50%. When the concentrations of benzoyl·azoxystrobin and cymoxanil·mancozeb were 300μg / mL and 500μg / mL, the inhibition rates of mycelium growth were 55.35% and 49.16%, respectively.

[0197] Fludioxonil, prochloraz, tebuconazole, and pyraclostrobin are the four fungicides with the strongest toxicity to QJ-331, and the median lethal concentration is less than 1.6μg / mL. When the concentration of fludioxonil is ≤0.5μg / mL, the inhibition percentage increases accordingly with the increase of fludioxonil concentration, but when the concentration is ≥1μg / mL, the inhibition percentage shows a negative growth, and the EC50 value is 0.5329μg / m, which is the most significant effect compared with each treatment group. It can be seen from the treatment results of prochloraz at various concentrations that with the increase of concentration, the inhibition percentage increases accordingly. When the concentration reaches 5μg / mL, the inhibition rate reaches 72.42%, the colony growth is extremely slow, and its EC50 value is 0.8872, which has a strong inhibitory effect. When the concentration of tebuconazole reaches 30μg / mL, the colony growth almost stagnates, the inhibition rate reaches 96.25%, and the EC50 value is 1.1192μg / mL. When the concentration of pyraclostrobin reached 4μg / mL, the inhibition rate was 60.60%, and the EC50 value was 1.5864μg / mL; followed by trifloxystrobin, difenoconazole, and fluopyram, with EC50 values ​​of 19.9580μg / mL, 25.0485μg / mL, and 41.2572μg / mL, respectively; benzylpyraclostrobin and cymoxanil·mancozeb had the weakest toxicity to QJ-331, with EC50 values ​​of 287.7231μg / mL and 718.8267μg / mL, respectively.

[0198] Table 12 Toxicity determination of different agents on QJ-331 mycelial growth

[0199]

[0200]

[0201] 3.2 Indoor toxicity test of QJ-331 treated with different agents

[0202] As can be seen from Table 13, the colony growth morphology of QJ-331 in the four agent plates, fludioxonil, prochloraz, tebuconazole and pyraclostrobin, was significantly different from that in the control group. The mycelium in the control plate grew evenly, in a dense felt-like shape, and grew prostrate and closely fitted with the culture medium, while the aerial mycelium of Fusarium oxysporum in the agent plates was sparse, growing upward from the cake, and the colony color deepened with the increase of the agent concentration.

[0203] ( Fig.19 )

[0204] Table 13 Indoor toxicity test results of fungicides against QJ-331

[0205]

[0206]

[0207] In this experiment, the indoor toxicity of nine fungicides, including fludioxonil, prochloraz, tebuconazole, pyraclostrobin, trifloxystrobin, fenpropimorph, fluopyram, benzoyl·pyraclostrobin, and cymoxanil·mancozeb, against the QJ-331 strain was determined. The results showed that all nine fungicides had varying degrees of inhibitory effects on the growth of QJ-331 mycelium. The inhibition rates of the agents were as follows, from strong to weak: tebuconazole (96.25%), prochloraz (72.42%), pyraclostrobin (60.60%), fenpropimorph (55.53%), benzoyl·pyraclostrobin (55.35%), trifloxystrobin (53.03%), fludioxonil (51.98%), fluopyram (50.84%), and cymoxanil·mancozeb (49.16%). The EC50 values ​​from small to large are fludioxonil (0.5329μg / mL), prochloraz (0.8872μg / mL), tebuconazole (1.1192μg / mL), pyraclostrobin (1.5864μg / mL), trifloxystrobin (19.9580μg / mL), difenoconazole (25.0485μg / mL), fluopyram (41.2572μg / mL), benzopyraclostrobin (287.7231μg / mL), and mancozeb (718.8267μg / mL).

[0208] The present invention uses QJ-331 as a target and determines the indoor inhibitory effects of 9 fungicides. The four agents of fludioxonil, prochloraz, tebuconazole, and pyraclostrobin show good antibacterial effects at low concentrations, and the EC50 values ​​are all less than 1.5864 μg / mL. Flubimazole, difenoconazole, and fluopyram are used as specific drugs for preventing and controlling tobacco powdery mildew, red star disease, and root-knot nematode disease, respectively. In this experiment, they all have good antibacterial effects on Fusarium oxysporum. However, benzoyl·pyraclostrobin and cymoxanil·mancozeb have poor inhibitory effects on pathogens. This indoor antibacterial experiment can provide a basis for subsequent potted efficacy experiments.

[0209] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A study on the incidence law of flue-cured tobacco Fusarium root rot in Qujing tobacco area and a precise identification method, characterized in that: The method specifically includes: S1: Collect samples of tobacco plants with typical tobacco Fusarium root rot; S2: Morphological identification of the test strains, pathogenicity determination of the pathogens, and molecular biological identification; S3: Isolate and screen antagonistic strains, determine the type of strain to be tested, and perform antibacterial spectrum measurement of antagonistic bacteria; S4: Based on different mechanisms of action, multiple fungicides were selected for drug screening experiments to determine the indoor virulence of the QJ-331 strain.

2. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: The S1 is to collect tobacco plant samples with typical tobacco Fusarium root rot, cut a small piece of fresh tissue at the junction of the diseased and healthy parts, disinfect them with 75% alcohol and 0.1% mercuric chloride solution in sequence, rinse the tissue block with sterile water for 3 times, and use sterile filter paper to absorb the residual water on the surface of the tissue, evenly place it in PDA culture medium, culture it in a constant temperature incubator at 28° C. for 3-5 days, and then pick the edge colonies after the colonies grow out and place them in PDA culture medium for purification.

3. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: The morphological identification in S2 is to culture the test strain on the PDA plate for 7 days, observe and record the colony morphology of the pathogen with the naked eye, observe the hyphae, spores, spore-forming cells, etc. of the pathogen under an optical microscope, and measure their sizes for morphological identification.

4. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: The pathogenicity of the pathogen in S2 is determined by using two methods, namely, wound stem base inoculation and wheat grain inoculation, to conduct potted plant experiments respectively, screen out the most pathogenic strains for molecular biological identification, and complete subsequent experiments. Non-pathogenic strains can be stored at 4°C as biocontrol strains. The steps include: (1) Inoculation at the base of the stem with wounds: Take healthy tobacco seedlings with 5-8 leaves, inoculate the isolated pathogens into the base of the stems of the tobacco seedlings by wound inoculation, keep them moist with absorbent cotton for 24 hours, and place them in an incubator at 28°C to maintain a high temperature and high humidity environment to induce the tobacco seedlings to become diseased; (2) Inoculation of wheat grains with bacteria: Select an appropriate amount of full barley grains, rinse them repeatedly until there are no impurities, soak them in clean water for 2 hours, and dispense them into 250 mL triangular flasks. Add 12.5 mL of 12% honey water and 12.5 mL of 2% peptone aqueous solution for every 70 g of the grains, sterilize them at 121°C for 1 hour, add 10 5 mm pathogen cakes after the grains are cooled, shake them thoroughly, and place them in a 28°C incubator for 15 days. During the incubation period, shake the flask every day, mix the wheat grains with pathogens with the culture soil at a ratio of 1:10, place them in plastic flower pots, and finally plant healthy tobacco seedlings with 5-8 leaves; (3) Koch's postulates verification: After the inoculated tobacco seedlings show symptoms, the pathogen is isolated to obtain pure culture, and the morphological characteristics of the re-isolated colonies are observed to see whether they are consistent with the initial isolated colonies. Morphological and rDNA ITS sequence identification are performed to complete Koch's postulates verification to determine the pathogenic bacteria.

5. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: In the molecular biological identification in S2, the total DNA of the tested bacteria was extracted using the CTAB method: (1) Preheat the CTAB extract in a 65°C water bath to fully dissolve it; (2) Grind the collected mycelium into powder in a sterile mortar, take an appropriate amount and mix it with 500 μL CTAB extraction buffer in a 1.5-mL centrifuge tube, and place it in a 65°C water bath for 45 min, shaking it several times during the process; (3) Cool the centrifuge tube to room temperature and centrifuge at 10,000 rpm for 10 min. Take the supernatant and mix it with an equal volume of chloroform and emulsify it for 10 min. (4) Centrifuge the above liquid at 10,000 rpm for 10 min, take the supernatant and mix it with an equal volume of isopropanol, and place it in a -20°C refrigerator for 30 min; (5) Take the above liquid out of the refrigerator, centrifuge at 10,000 rpm for 10 min, remove the supernatant and retain the DNA precipitate, wash it twice with 75% alcohol and once with anhydrous ethanol; (6) After air-drying the DNA precipitate, add 40 μL TE solution to dissolve it and store it in a -20°C refrigerator for later use. Use the universal primers ITS1 and ITS4 for fungal ribosomal DNA to amplify the rDNA-ITS gene of the test strain by PCR. Finally, use 1% agarose gel electrophoresis to detect the PCR product and store it in a 4°C refrigerator. (7) The PCR products were sequenced in both forward and reverse directions by Kunming Qingke Biotechnology Co., Ltd. The sequencing results were compared with the genes published in GenBank on the website http: / / www.ncbi.nlm.nih.gov for homology, and the phylogenetic tree was constructed using MEGA5.0 software to analyze their genetic relationships.

6. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: S3, collecting rhizosphere soil without disease from the field of flue-cured tobacco Fusarium root rot disease in the systematic survey point of Qujing tobacco area for isolating antagonistic bacteria, taking Fusarium W8 as the target strain, and the isolation, screening and identification steps include: (1) separation medium; (2) Isolation and purification of antagonistic microorganisms in tobacco soil: The rhizosphere soil samples of healthy tobacco plants were mixed evenly by dilution and plate spreading methods. 5 g of soil sample and 45 ml of sterile water were placed in a 50 ml centrifuge tube, shaken at 170 r / min for 30 min, and then placed on a clean bench for 10 min. The supernatant of the soil bacterial suspension was taken and a gradient dilution method was used to prepare a 10-2 to 10-6 dilution for standby use. The prepared 10-4 to 10-5 concentration soil solution was spread on the NA culture medium. The spreader was spread evenly and inverted for culture. Three replicates were set for each treatment. Single colonies were picked and inoculated in different culture media. The culture was purified by plate streaking method and stored at 4 °C. (3) Screening of antagonistic microorganisms. Fusarium W8 was used as the target bacteria. The plate confrontation method was used to determine the inhibition rate of the obtained strains against the test fungi. A hole puncher (R = 7 mm) was used to obtain a bacterial cake with the same growth. The bacterial cake was inoculated in the center of a new PDA plate and cultured at 27 ± 2 ° C for 24 h. After that, 1 μL of the test bacterial suspension (OD600 = 1) was inoculated at a distance of 2.5 cm from W8. Sterile water was inoculated as a control and cultured at 27 ± 2 ° C for 5 days. The strains that produced the inhibition zone were screened, and the colony diameter of the W8 strain was measured to calculate the inhibition rate. Each experiment was repeated 3 times. The screened strains with antibacterial effect were purified and stored in a refrigerator at -80 ° C with 15% glycerol. (4) Identification of antagonistic microorganisms: The 16S rRNA of the strain to be tested was amplified using the bacterial universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1495R (5'-GGTTACCTTGTTACGACTT-3'), and cloned, transformed and sequenced. The gene sequence was compared with the published sequence in the NCBI database to determine the type of the strain to be tested; (5) Indoor potted test of antagonistic strains: When the tobacco seedlings grow to the stage of 4 leaves and 1 heart, the antagonistic bacteria to be tested and the tobacco Fusarium root rot pathogen are inoculated by root irrigation, and the pathogen inoculation amount is 106 CFU / mL 15mL. After inoculation of the pathogen, the plants are cultured in a greenhouse, and the disease situation of the tobacco seedlings is checked and recorded every day. The disease index and relative control effect are calculated; (6) Determination of the antibacterial spectrum of antagonistic bacteria. Based on the results of repeated screening, two antagonistic bacteria with more obvious antibacterial effects and antibacterial bands in the confrontation test were selected for plate confrontation test against common plant pathogenic bacteria Acidovorax avenae subsp. citrulli, Bacillus cereus, Bacillus zanthoxyli, Bacillus aryabhattai, and Pseudomonas mediterranea to determine their antibacterial spectrum. The strains to be tested were activated on LB plates to make the fermentation liquid concentration 1×108 CFU / mL. According to the formula "C1V1=C2V2", 2.5 mL of pathogenic bacteria fermentation liquid of different concentrations was taken in a biological safety cabinet and added to 250 mL of LB solid culture medium cooled to 55°C. The mixture was shaken to make the final concentration 106 CFU / mL and poured into a culture dish with d=9 cm to cool and solidify. Solidify, then place 4 sterile filter paper pieces (d = 6 mm) at an equal distance of 2.5 cm from the center of the LB plate mixed with different pathogenic bacteria, inoculate 5 μL of antagonistic bacterial fermentation liquid with a concentration of 108 CFU / mL on the filter paper pieces, and add an equal amount of sterile water as a control. Repeat 3 times, culture at 28°C for 2 days, observe and measure the diameter of the inhibition zone (D) generated around the antagonistic bacterial colony and the diameter of the colony (d), and evaluate the inhibitory effect of antagonistic bacteria on pathogenic bacteria with the ratio of D / d; (7) Field application of antagonistic microorganisms in the prevention and control of tobacco Fusarium root rot. Better biocontrol agents were screened in indoor experiments and field trials were carried out. The test biocontrol agents were inoculated into sterilized LB liquid culture medium and cultured at 32°C and 180 r / min for 18 h. The culture was diluted with sterile water to obtain a bacterial solution with a bacterial content of 1×108 CFU / mL.

7. The research on the incidence law and accurate identification method of Fusarium root rot disease in flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: The S4 selected novel phenylpyrrole fungicides (Phenylpyrrole), sterol demethylation inhibitors (DMI), methoxyacrylate fungicides (QOI), succinate dehydrogenase inhibitors (SDHIs), amide urea combined with organic sulfur fungicides, and triazole combined with methoxyacrylate fungicides for drug screening experiments.

8. The research on the incidence law and accurate identification method of Fusarium root rot of flue-cured tobacco in Qujing tobacco area as claimed in claim 1, characterized in that: The indoor virulence determination of the QJ-331 strain in S4 adopts the toxic medium method, and the final concentration gradient is determined based on the results of multiple preliminary experimental determinations in the early stage. The steps are as follows: (1) Use a triangular flask, add 100 mL of standard PDA culture medium powder to each bottle, inject 90 mL of ultrapure water, sterilize at 121°C for 30 min, and cool to below 50°C for later use; (2) Dilute each original drug with sterile water (cooled below 50°C) 100 times according to the set maximum concentration to prepare a stock solution; (3) According to the concentration gradient setting (I, II, III, IV, V, VI), the prepared mother solution is diluted again with sterile water to a solution 10 times greater than the concentration gradient setting of each agent, marked and set aside; (4) Use a 1000 μg pipette to draw 10 mL of drug solution that is 10 times greater than the concentration gradient setting and add it to 90 mL (100 mL standard volume) of PDA culture medium. Shake evenly and pour into the plate to make a drug-containing culture medium. Add an equal amount of sterile water as a blank control. Repeat 3 times for each concentration, mark well, and set aside. (5) Use a sterile cork puncher with a diameter of 5 mm to punch out bacterial blocks of the same age at the edge of the colony. Use an inoculation needle to pick them up and inoculate them into the center of the prepared drug-containing culture medium, with the side with mycelium facing down. Inoculate one bacterial block per dish, with 3 replicates for each treatment concentration, and culture them in a dark incubator at 28°C for 6 days. (6) The cross-cross method was used to determine the inhibitory effect of different fungicides on the growth of pathogenic mycelium, and the cell counting method was used to determine the effect of different agents on the spore production of pathogenic bacteria; (7) Use DPS software to process the data and obtain the toxicity regression equation Y=a+bx, R value and EC50 value; and use SPSS software to perform differential analysis on the inhibitory effects of each treatment; (8) Inhibition rate formula:

Images