Group of SNP markers related to nasopharynx cancer onset risk assessment and application thereof

Abstract

The invention discloses a group of SNP (Single Nucleotide Polymorphism) markers related to assessment of nasopharyngeal carcinoma onset risk. The SNP markers comprise rs2276868, rs3917410 and / or strong linkage sites of the rs2276868 and the rs3917410. The invention further provides application of a reagent for detecting the SNP marker to preparation of a reagent for evaluating the onset risk of nasopharyngeal carcinoma. The method can be used for accurately evaluating the onset risk of nasopharyngeal carcinoma. The invention provides application of a group of reagents for detecting expression of RPL14, SELE, NOTCH3 and FGFR3 genes in preparation of a kit for evaluating the onset risk of nasopharyngeal carcinoma. The invention also provides application of the reagent for detecting the RPL14 gene in preparation of drugs for evaluating nasopharyngeal carcinoma EBV infection and replication, disease-related phenotypes and prognosis.

Description

Technical Field

[0001] The present invention relates to the field of gene mutation detection, and in particular, to a group of SNP markers associated with the assessment of the risk of nasopharyngeal carcinoma and applications thereof. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a relatively rare but locally prevalent malignant tumor. The disease shows familial clustering characteristics, and 5.9% of patients have a family history, suggesting that the disease is affected by genetics or family shared environment. Studies have shown that the heritability of NPC is as high as 61.3%. Locating the genetic susceptibility loci of NPC on the genome is of great significance for the early identification of high-risk groups for NPC, the identification of genetic characteristic subgroups in patients, the selection of treatment methods and the assessment of prognosis, and the development of therapeutic targets. Genome-wide association studies (GWAS) have reported multiple genomic regions associated with NPC, but these regions have limited explanations for the genetic pathogenic risk of NPC, suggesting that more NPC susceptibility loci need to be discovered.

[0003] In addition to genetic and environmental susceptibility factors, studies have found that Epstein-Barr Virus (EBV) infection is involved in the development of nasopharyngeal carcinoma. The EBV DNA load in the plasma of nasopharyngeal carcinoma patients is significantly increased, and a large number of EBV-encoded molecules can also be found in tumor tissues through biopsy.

[0004] There are two main limiting factors for further exploration of nasopharyngeal carcinoma susceptibility sites: insufficient sample size and limited coverage of different frequency sites in the genome. Due to the low overall incidence of nasopharyngeal carcinoma in the population, it is relatively difficult to obtain samples, and the limited sample size of existing GWAS has limited the detection power of such studies. In addition, since the chip data used in the studies that have published GWAS only cover common mutation sites on the genome, it is difficult for such studies to discover rare susceptibility sites for nasopharyngeal carcinoma.

[0005] Since NPC is a complex disease with multiple genes, even if more genetic susceptibility loci are obtained, the risk of NPC based on single-site assessment is low. Therefore, the assessment of the genetic risk of this disease requires the integration of multi-site information to construct a risk prediction model, and the prediction efficacy should be evaluated in different populations. Currently, this type of model is only based on existing GWAS loci, and its predictive efficacy for disease risk is limited, and its predictive efficacy has not yet been systematically evaluated in multi-population samples.

[0006] In addition, the elucidation of the pathogenic mechanism of susceptibility sites has always been a bottleneck in the application and transformation of genetic factors, and nasopharyngeal carcinoma is no exception. In order to understand how susceptibility sites affect the expression or function of genes and disrupt cells or physiological processes involved in pathogenicity, researchers need to collect and analyze multidimensional molecular data of nasopharyngeal carcinoma, and conduct in vivo and in vitro experiments to detect mutations and related genes in nasopharyngeal carcinoma-related scenarios. This type of research is currently lacking in the field of nasopharyngeal carcinoma.

[0007] Although the association between Epstein-Barr virus and nasopharyngeal carcinoma has been reported, how Epstein-Barr virus is involved in the pathogenicity of nasopharyngeal carcinoma susceptibility sites currently mainly revolves around the HLA region, and whether Epstein-Barr virus is involved in the pathogenicity of non-HLA susceptibility regions remains to be explored. Summary of the invention

[0008] The purpose of the present invention is to provide a technical solution that can accurately and effectively assess the risk of nasopharyngeal carcinoma in response to the above technical problems.

[0009] To achieve the above purpose, the present invention provides a group of SNP markers associated with the risk of nasopharyngeal carcinoma, wherein the SNP markers include: rs2276868, rs3917410 and / or their strongly linked sites. Preferably, the SNP markers also include rs2276868, rs3917410 and their strongly linked sites.

[0010] As used herein, a "strongly linked locus" refers to a locus with a squared correlation coefficient R between alleles. 2 >0.8. Preferably, the strong linkage site can be rs5361, which is a complete linkage site of rs3917410 (i.e., the square of the inter-site allele correlation coefficient R 2 =1). rs2276868 is a C / T single nucleotide variation site of the RPL14 gene on chromosome 3. rs3917410 is an A / G single nucleotide variation site of the SELE gene on chromosome 1. rs5361 is a G / T single nucleotide variation site of the SELE gene on chromosome 1.

[0011] On the other hand, the present invention also provides a group of genetic markers for assessing the risk of nasopharyngeal carcinoma, wherein the markers include: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I. Preferably, the markers also include their strong linkage sites (R 2 >0.8), such as the complete linkage locus of rs3917410 (R 2 =1)rs5361.

[0012] On the other hand, the present invention also provides a model for assessing the risk of nasopharyngeal carcinoma, wherein the model is constructed based on the following SNP markers: rs2276868, rs3917410, and / or their strongly linked sites. Preferably, the strongly linked site is rs5361, a strongly linked site of rs3917410.

[0013] On the other hand, the present invention also provides a model for assessing the risk of nasopharyngeal carcinoma, wherein the model is constructed based on the following SNP markers: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, HLA amino acid HLA-B_66_I, and / or their strong linkage sites.

[0014] On the other hand, the present invention also provides a method for constructing a risk assessment model for nasopharyngeal carcinoma, which comprises: incorporating SNP markers rs2276868 and rs3917410 or their strongly linked loci (R 2>0.8), combined with known GWAS loci (i.e., rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, and HLA amino acid HLA-B_66_I), the correlation coefficient of the single locus was used as the weight, and the number of alleles carried by the individual was used as the metric to perform weighted summation of the scores.

[0015] On the other hand, the present invention also provides the use of a reagent for detecting the SNP marker in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes a PCR buffer, dNTP, magnesium chloride, DNA polymerase and deionized water.

[0016] On the other hand, the present invention also provides the use of a reagent for detecting the genetic marker in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes a PCR buffer, dNTP, magnesium chloride, DNA polymerase and deionized water.

[0017] On the other hand, the present invention also provides a set of reagents for detecting gene expression for use in preparing a kit for assessing the risk of nasopharyngeal carcinoma, wherein the gene is at least one of RPL14, SELE, NOTCH3 and FGFR3.

[0018] On the other hand, the present invention also provides the use of a reagent for detecting the gene expression in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma. Preferably, the reagent is a specific amplification primer. Preferably, the kit also includes a PCR buffer, dNTP, magnesium chloride, DNA polymerase and deionized water.

[0019] On the other hand, the present invention also provides the use of a reagent for detecting the RPL14 gene in the preparation of a drug for evaluating EBV infection and replication, disease-related phenotypes and prognosis of nasopharyngeal carcinoma.

[0020] The present invention confirms that the genotype frequencies of SNP sites rs2276868, rs3917410 and rs5361 (strong linkage sites of rs3917410) in nasopharyngeal carcinoma patients in the southern Chinese population are significantly different from those in the healthy population, and the carriers of rs2276868-T are more frequent in patients with a family history. The present invention also confirms that genes RPL14, SELE, NOTCH3 and FGFR3 are significantly enriched with more disease-related mutations in nasopharyngeal carcinoma patients in the southern Chinese population. The nasopharyngeal carcinoma risk prediction model proposed by the present invention based on the newly discovered sites (rs2276868 and rs3917410) and the reported GWAS sites has achieved an effect higher than the previous nasopharyngeal carcinoma risk model, and its effect is manifested as a higher area under the curve (AUC), and the identified high-risk group has a higher odds ratio (Odds Ratio, OR) than the low-risk group. The present invention confirms the significant regulatory effect of the susceptibility site rs2276868 on the RPL14 gene in nasopharyngeal carcinoma cells and tissues from single-cell transcriptome data and experimental data; further combined with transcriptome data and knockdown / overexpression experiments, the transcription factor NKRF that has a regulatory effect on RPL14 expression and is affected by rs2276868 was screened. The present invention, combined with the Epstein-Barr virus infection and lysis model, first confirmed the inhibitory effect of the RPL14 gene on the infection and lysis of the Epstein-Barr virus, and also found that the infection and lysis of the Epstein-Barr virus would inhibit the expression of RPL14. The present invention first used Epstein-Barr virus-positive nasopharyngeal carcinoma cell lines and mouse models to confirm the inhibitory effect of RPL14 on the growth and metastasis of nasopharyngeal carcinoma tumors through functional experiments. The present invention, combined with RPL14 expression information and nasopharyngeal carcinoma patient prognosis data, proved for the first time that the higher the RPL14 expression, the better the patient's prognosis. These inventions are of great significance for predicting the risk and prognosis of nasopharyngeal carcinoma, and also provide new molecular targets for the treatment of nasopharyngeal carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The data show the 15 variant sites, target alleles, and OR value information involved in the model for assessing the risk of NPC.

[0022] Figure 2 The results of the evaluation of the predictive power of the model for estimating the risk of developing NPC are shown (area under the curve and hazard comparison).

[0023] Figure 3 Functional risk prediction information of NPC risk locus rs5361 is shown.

[0024] Figure 4 The effect of different rs2276868 genotypes on the expression of susceptibility gene RPL14 in NPC tissues (A) and cells (B) is shown.

[0025] Figure 5 The results showed that NKRF exerted different transcriptional regulatory effects on RPL14 by combining with different rs2276868 genotypes using luciferase reporter plasmid (AB) and chromatin immunoprecipitation experiments (CD).

[0026] Figure 6 It was shown that EBV infection and lysis could inhibit the expression of RPL14 (A and C). Meanwhile, RPL14 could negatively regulate EBV infection and lysis (B and D).

[0027] Figure 7 It was shown that RPL14 overexpression could inhibit the proliferation (A), migration (B) and in vivo tumorigenesis (C, D) of EB virus-positive nasopharyngeal carcinoma cells.

[0028] Figure 8 It was shown that RPL14 is lowly expressed in NPC (A) and patients with low expression have a worse prognosis (B). DETAILED DESCRIPTION

[0029] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific examples. It should be understood by those skilled in the art that the examples are only to help understand the present invention and should not be regarded as specific limitations of the present invention; unless otherwise specified, the sequencing and analysis methods used in the following examples are conventional methods.

[0030] The present invention locates the risk sites and genes for NPC onset based on a large sample full exome association analysis of NPC patients and healthy controls.

[0031] The specific steps are as follows:

[0032] 1. Blood or DNA samples were collected from 2023 NPC patients who met the genetic characteristics of the southern Chinese population and 1068 healthy controls through the Sun Yat-sen University Cancer Center.

[0033] 2. Perform whole exome sequencing and variant calling. Use Agilent SureSelect Human All Exon V6+UTR kit or Agilent SureSelect Human All Exon V5+UTR kit or Roche SeqCap EZ Exome+UTR Target Enrichment kit for library construction and exon region capture. Use Illumina HiSeq sequencer to perform sequencing with paired-end 2x150bp standard. Use Sentieon software (Sentieon, USA) for alignment and genotype identification. The operation procedures are carried out according to the manufacturer's instructions.

[0034] 3. Taking the occurrence of nasopharyngeal carcinoma as the target phenotype, the following multi-level molecular correlation analysis was performed:

[0035] (1) Single nucleotide variation (SNV) level: Multivariate regression analysis was used to perform association analysis on all SNVs with a minor allele frequency > 0.001 on the genome, while correcting for confounding factors such as gender and population genetic structure.

[0036] (2) Multi-SNV-gene level: Four regression analysis and statistical methods are used to detect the cumulative effect of multiple SNVs in each gene unit on the studied trait, and the optimal solution is selected. When applying each method, confounding factors such as sex and population genetic structure are corrected. The four methods are:

[0037] (A) SNP-set (Sequence) Kernel Association Test (SKAT) based on linear regression equation;

[0038] (B) Burden test based on variation loading;

[0039] (C) SKAT for the combined effect of common and rare variants based on linear equations;

[0040] (D) Burden test for the combined effect of common and rare variants based on variant loading.

[0041] The statistical results are as follows Figure 1 And as shown in Table 1. Figure 1 The 15 variant sites, target alleles and OR value information involved in the model for assessing the risk of NPC are shown. Table 1 shows the gene information significantly associated with NPC based on multi-SNV association analysis.

[0042] Table 1: Genes significantly associated with nasopharyngeal carcinoma

[0043] Gene name Gene-based P values Statistical methods RPL14 <0.05 SKAT for the combined effect of common and rare variants SELE <0.05 SKAT for the combined effect of common and rare variants FGFR3 <0.05 Burden test NOTCH3 <0.05 SKAT for the combined effect of common and rare variants

[0044] The model designed by the present invention for calculating the polygenetic risk score (PRS) for nasopharyngeal carcinoma is: Figure 1 The 15 germline variant sites shown (rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I) or their strongly linked sites (R 2 >0.8) is calculated by summing the target allele copy number x weight. The weight is derived from association analysis based on a single locus and is the logarithm of the disease risk odds ratio (OR).

[0045] The specific formula is:

[0046]

[0047] Among them, dosage ij is the target allele carried by a given individual i at the variant site j (A1, see Figure 1 ) (value range: 0 / 1 / 2). Information on germline variant sites, target alleles (A1) and OR can be found in Figure 1 .

[0048] like Figure 2 As shown, it shows the predictive efficacy evaluation results (area under the curve and risk comparison) of the model for evaluating the risk of nasopharyngeal carcinoma. Figure 2As shown in A, the horizontal axis of the figure is the percentile of PRS, and the vertical axis is the odds ratio of individuals with each percentile score of PRS to individuals with the lowest 5% percentile of nasopharyngeal cancer. It can be seen from the figure that with the increase of PRS, the risk of nasopharyngeal cancer increases significantly. Figure 2 As shown in B in the figure, the horizontal axis is the false positive rate, and the vertical axis is the true positive rate. It can be seen from the figure that the PRS of the present invention has a higher AUC than the published PRS containing only GWAS sites.

[0049] Since there are multiple SNP sites in the exon region of the significant gene SELE that are significantly associated with the occurrence of nasopharyngeal carcinoma, the function of these sites was predicted. The results showed that the rs5361 mutation has a greater possibility of affecting the normal function of SELE ( Figure 3 ).

[0050] The present invention constructs 15 SNP sites for assessing the risk of nasopharyngeal carcinoma at rs2276868, rs5361 and rs3917410, and their strongly linked sites, and a method for capturing RPL14, SELE, NOTCH3 and FGFR3 genes in the target region of the genome as follows:

[0051] Design and customize synthetic probes for the target region (Nanodigmbio probes: each length: 120 bp. See Table 2 and Table 3).

[0052] Table 2: Probe sequences designed for target sites

[0053]

[0054]

[0055] Table 3: Probe sequences designed for target gene regions

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] NadPrep DNA Library Preparation Kit was used for library construction and capture hybridization. The experimental steps were completed using the automated equipment MGISP-960 / 100 automated workstation MGI sequencing platform (Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd.). Sequencing was completed by MGIDNBSEQ-T7 (Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd.) (pair-end of 150bp). Sentieon software (Sentieon, USA) was used for alignment and genotype identification. The operating procedures were carried out according to the manufacturer's instructions.

[0078] The present invention uses the single-cell transcriptome data of nasopharyngeal carcinoma to analyze the correlation between different genotype carriers of rs2276868 and the expression of the susceptibility gene RPL14. At the same time, a promoter reporter plasmid containing different rs2276868 genotypes was constructed (cloning primers: forward CGGGGTACCGAGAGGATCGTCTTCACTCAG, reverse CTAGCTAGCACCCTCACCATGCGCTTCC, constructed into pGL3 plasmid), and a luciferase experiment was performed. The results are as follows: Figure 4 shown. Figure 4 A shows the changes in the standardized mean expression of RPL14 in NPC tissues with different rs2276868 genotypes (CC, CT, TT); Figure 4 Figure B shows the effect of different genotypes on the expression of the susceptibility gene RPL14 at the cellular level. Figure 4 As shown, it was confirmed that the expression of RPL14 in nasopharyngeal carcinoma patients carrying rs2276868-T type (RPL14-T, same as TT type) was lower than that in nasopharyngeal carcinoma patients carrying rs2276868-C type (RPL14-C, same as CC type).

[0079] The present invention designed siRNA of NKRF gene (NKRF-siRNA sequence: CCAAGAGACATCTACCAAGAT; control sequence si-NC: CCTGGAACAATTGCTTTTA) and overexpression plasmid (forward primer: AAGCTTGCCACCATGGACTACAAAGAC; reverse primer: GAATTCTCAATTTGCTTGAGGCATAAC, constructed into pCDNA3.1 plasmid), and performed luciferase experiment and chromatin immunoprecipitation experiment. The results are as follows Figure 5 shown. Figure 5 A shows that after knocking down NKRF, the luciferase transcriptional activities of the above RPL14-C and RPL14-T were inhibited (left figure), but after correction with the control group (si-NC), compared with RPL14-C, NKRF knockdown had a stronger inhibitory effect on RPL14-C (right figure); Figure 5 The left figure of B shows the relative luciferase activity results of RPL14-C and -T after overexpression of NKRF, and the right figure shows that after correction with the control group (Vector), overexpression of NKRF can further promote the transcriptional activity of RPL14-C; Figure 5 Figure C is the primer design pattern of the RPL14 promoter region, and Figure D is the result of the chromatin immunoprecipitation experiment (PRL14-P1 corresponds to primer1, PRL14-P2 corresponds to primer2, and PRL14-P3 corresponds to primer3), which shows that NKRF does bind to the region near the mutation site and plays a transcriptional regulatory role. Figure 5 It can be seen that the transcription factor NKRF binds to the region near rs2276868 and has a stronger transcriptional regulatory effect on the rs2276868-C type.

[0080] The present invention designs siRNA of RPL14 gene (two siRNAs targeting different regions of mRNA, including siRPL14-1: CTGCTAAAGTTCCAGCAAA; siRPL14-2: CACTGATTTCATCCTCAAG; control sequence si-NC: CCTGGAACAATTGCTTTTA) and overexpression plasmid (forward primer: CCGGAATTCATGGTGTTCAGGCGCTTCGT; reverse primer: CGCGGATCCTTATGCTTTCTTGCCAGATGCC, constructed into pCDH plasmid). The present invention utilizes Epstein-Barr virus to infect Epstein-Barr virus-negative nasopharyngeal carcinoma cells (S26 and HK-1, provided by Qian Chaonan Laboratory of Sun Yat-sen University Cancer Center and Kwok Wai LO Laboratory of The Chinese University of Hong Kong, Hong Kong, China, respectively), and treats Epstein-Barr virus-positive nasopharyngeal carcinoma cells (CNE2-EBV and HONE1-EBV, provided by Zeng Musheng Laboratory of Sun Yat-sen University Cancer Center) with phorbol ester TPA (20 ng / ml) and sodium butyrate NaB (3 mM) at different time points to establish an Epstein-Barr virus lysis induction model. Figure 6 A shows that the expression of RPL14 tends to be downregulated during EBV infection. Figure 6 B shows that knocking down RPL14 (left) can promote the infection efficiency of EB virus and increase the GFP positive rate, while overexpression (RPL14 group, right) inhibits the infection efficiency of EB virus compared with the control group (Vector); Figure 6 C shows that the expression of RPL14 is also downregulated during the induction of EB virus lysis. Figure 6 D shows that RPL14 knockdown (left) or overexpression (right) significantly promotes and inhibits the expression of EB virus lytic phase-related genes. The above experiments reveal that EB virus infection and lysis can inhibit the expression of RPL14 (A and C), and RPL14 can negatively regulate EB virus infection and lysis (B and D).

[0081] The present invention utilizes the RPL14 overexpression plasmid (PRL14) and a lentiviral packaging system to stably overexpress RPL14 in Epstein-Barr virus-positive nasopharyngeal carcinoma cells (CNE2-EBV and HONE1-EBV), and uses clone formation experiments and Transwell migration experiments to determine the inhibitory effect of RPL14 overexpression on the proliferation and migration of nasopharyngeal carcinoma cells. At the same time, a nude mouse tumor formation experiment is used to take six-week-old male BALB / c nude mice and inoculate CNE2-EBV cells (5 x 10 6 The tumor size of the mice was measured weekly with a caliper and calculated as L x W 2x 0.5 (where L is the longest diameter of the tumor and W is the shortest diameter). Figure 7 A shows that RPL14 overexpression can inhibit the proliferation of EB virus-positive nasopharyngeal carcinoma cells, and the right figure is statistical; Figure 7 B shows that overexpression of RPL14 inhibits the migration ability of EB virus-positive nasopharyngeal carcinoma cells, and the right figure shows statistics; Figure 7 The CD in vivo tumorigenesis experiment showed that the in vivo tumor growth rate of CNE2-EBV cells overexpressing RPL14 was attenuated (C) and the tumor weight was reduced (D). These experiments revealed that RPL14 plays a tumor suppressor function in NPC.

[0082] The present invention uses transcriptome sequencing data analysis of 87 nasopharyngeal carcinoma tissues and 10 rhinitis control tissues (nasopharyngeal tissues of rhinitis patients without nasopharyngeal carcinoma) to reveal that RPL14 is significantly reduced in nasopharyngeal carcinoma tumor tissues compared with control tissues ( Figure 8 , A). At the same time, using another set of 88 NPC tissue transcriptome data sets, survival analysis revealed that NPC patients with low RPL14 expression had a worse prognosis ( Figure 8 , B).

[0083] It is worth noting that the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by technicians in this technical field within the essential scope of the present invention should also fall within the scope of protection of the present invention.

Claims

1. A set of SNP markers associated with the risk of nasopharyngeal carcinoma, characterized in that: The SNP markers include: rs2276868, rs3917410, and / or their strongly linked sites.

2. The SNP marker according to claim 1, characterized in that: The SNP markers also include the completely linked site rs5361 of rs3917410.

3. A set of genetic markers associated with the risk of nasopharyngeal carcinoma, including: The markers include: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F and HLA amino acid HLA-B_66_I, and / or their strong linkage sites.

4. A model for assessing the risk of nasopharyngeal carcinoma, characterized in that: The model was constructed based on the following SNP markers: rs2276868, rs391741, and / or their strongly linked sites.

5. A model for assessing the risk of nasopharyngeal carcinoma, characterized in that: The model was constructed based on the following genetic markers: rs1572072, rs9510787, rs6498114, rs6774494, rs31489, rs1412829, rs3917410, rs2276868, rs186509115, HLA-DQB1*03:01:01, rs1131204, rs1050462, HLA amino acid HLA-A_62_Q, HLA amino acid HLA-DRB1_67_F, HLA amino acid HLA-B_66_I, and / or their strongly linked sites.

6. A method for constructing a risk assessment model for nasopharyngeal carcinoma, characterized in that include: The SNP markers rs2276868, rs3917410 and / or their strongly linked loci were included, combined with known GWAS loci, and the scores were weighted summed using the correlation coefficient of the single locus as the weight and the number of alleles carried by the individual as the metric.

7. Use of a reagent for detecting the SNP marker according to claim 1 or 2 in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma.

8. Use of a reagent for detecting the genetic marker according to claim 3 in preparing a kit for assessing the risk of nasopharyngeal carcinoma.

9. Use of a set of reagents for detecting gene expression in the preparation of a kit for assessing the risk of nasopharyngeal carcinoma, wherein the gene is at least one of RPL14, SELE, NOTCH3 and FGFR3.

10. Use of a reagent for detecting the RPL14 gene in the preparation of a drug for evaluating EBV infection and replication, disease-related phenotypes and prognosis of nasopharyngeal carcinoma.

Images