Specific primer probe combination for detecting jaw nematode and application of specific primer probe combination
Patent Information
- Application Number
- CN202411821140.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-11
- Publication Date
- 2025-01-28
Smart Images
Figure CN119372339A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and in particular to a specific primer-probe combination for detecting Gnathostoma spinulosa and application thereof. Background Art
[0002] Gnatostomatosis is a serious zoonotic parasitic disease that not only causes significant economic losses to the world's animal husbandry and fisheries, but also causes serious public health problems on a global scale. The host range of Gnatostomatidae is very wide, and it can parasitize carnivorous mammals, fish, birds, reptiles and other animals including humans. There are more than 100 species of naturally infected second intermediate hosts of Gnatostomatidae, among which freshwater fish are the most important intermediate hosts of Gnatostomatidae. The common route of infection for humans is infection through eating raw second intermediate hosts such as fish and frogs. After humans are infected with Gnatostomatidae, the diseased sites are widespread, almost all over the body. Among the common cases of human infection with Gnatostomatidae in my country, the main species is Gnatostomatidae spinulosa, with occasional cases of Gnatostomatidae rigidus and Gnatostomatidae dubrevici.
[0003] At present, the detection methods of Gnatostoma nematodes are mainly morphological identification methods and molecular biological identification methods. Morphological identification is mainly based on the position and morphology of the small hooks on the head ball of the third-stage larvae of Gnatostoma nematodes, the position of the cervical papilla and the excretory pore, and the number of rings of spines on the body surface by scanning with a microscope and an electron microscope. However, the morphological characteristics of larvae between different species are relatively small, and the size of the same worm species in different intermediate hosts is also different. It is also highly subjective and requires high skills and experience from the operator. In comparison, molecular biological methods are simple, objective, highly sensitive, and highly accurate. With the rapid development of molecular biology, molecular biological detection technologies such as PCR technology, real-time fluorescence quantitative PCR technology, and isothermal amplification technology have been developed and applied in the field of parasites.
[0004] In the field of molecular biology detection of jaw nematodes, conventional PCR methods are easy to operate, but time-consuming and dependent on precision test instruments. LAMP technology can complete amplification under isothermal conditions (generally 60℃~65℃), and usually uses 4 pairs of primers to amplify 6 target sequence regions. Therefore, the primer design requirements are high and difficult, and compared with traditional PCR, the design is difficult. Therefore, there is an urgent need for a method with high accuracy, simple operation and rapid reaction for detection. Recombinase-mediated isothermal amplification technology (RAA) only needs to design a probe, which has the advantages of convenient operation, rapid amplification and constant reaction temperature. Combined with agarose gel electrophoresis, fluorescent dyes, fluorescent probes, lateral flow analysis, CRISPR-Cas12a and other technologies to analyze the amplified products, visual operation can be achieved. Rapid reaction is the outstanding advantage of this technology. The entire reaction can be completed within 20 minutes. Due to its low requirements for the environment, operating skills and test equipment, it has great development advantages and is especially suitable for on-site instant detection. Summary of the invention
[0005] The purpose of the present invention is to provide a specific primer-probe combination for detecting Gnathostomum spinulosum and its application, so as to solve the problems existing in the above-mentioned prior art. The method for detecting Gnathostomum spinulosum based on RAA method established by using the specific primer-probe combination of the present invention has strong specificity, good repeatability and high sensitivity, and the minimum detection limit can reach 30 copies / μL, and has no cross reaction with common parasites of freshwater fish such as Capillaria, Gastrocystis and Angiostrongylus cantonensis.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The invention provides a specific primer-probe combination for detecting Gnathostomum spinulosa, comprising an upstream primer GncoxF6, a downstream primer GncoxR6 and a probe GncoxP;
[0008] The nucleotide sequence of the upstream primer GncoxF6 is shown in SEQ ID NO.11;
[0009] The nucleotide sequence of the downstream primer GncoxR6 is shown in SEQ ID NO.12;
[0010] The probe GncoxP is composed of the sequence shown in SEQ ID NO.13, tetrahydrofuran and the sequence shown in SEQ ID NO.14 connected in sequence.
[0011] Optionally, the 29th base from the 5' end of the sequence shown in SEQ ID NO.13 is modified with a fluorescent reporter group; the 1st base from the 5' end of the sequence shown in SEQ ID NO.14 is modified with a fluorescent quencher group, and the 3' end is blocked.
[0012] Optionally, the fluorescent reporter group includes FAM, and the fluorescent quencher group includes BHQ1.
[0013] Optionally, the blocking treatment includes labeling C3 Spacer at the 3' end of the sequence shown in SEQ ID NO.14.
[0014] The present invention also provides a RAA detection kit for detecting Gnathostoma spinulosa, comprising the specific primer-probe combination.
[0015] Optionally, it also includes RAA reaction solution, Buffer B, negative quality control and positive quality control; the RAA reaction solution is a buffer solution containing recombinase, single-strand binding protein and strand displacement DNA polymerase; and the Buffer B is a magnesium acetate solution.
[0016] The present invention also provides the use of the specific primer-probe combination or the RAA detection kit in the RAA detection of Gnathostoma spinulosa.
[0017] The present invention also provides a RAA detection method for detecting Gnathostoma spinulosa, comprising the steps of using the sample DNA to be detected as a template and using the specific primer-probe combination to perform RAA reaction.
[0018] Optionally, the RAA reaction system includes 29.4 μL of RAA reaction solution, 2.5 μL of Buffer B, 4 μL of upstream and downstream primers, 0.9 μL of probe, 2 μL of DNA template and 7.2 μL of distilled water; the concentrations of the upstream and downstream primers are both 0.2 μmol / μL to 0.8 μmol / μL; the concentration of the probe is 0.09 μmol / μL to 0.18 μmol / μL.
[0019] Optionally, the RAA reaction conditions are 37-41° C., 40 cycles, and each cycle is 30 s.
[0020] The present invention discloses the following technical effects:
[0021] The present invention designs a primer-probe combination capable of detecting the spiny jawstomum nematode according to the co1 gene sequence of the mitochondria of the spiny jawstomum nematode, and finally establishes a method for detecting the spiny jawstomum nematode based on the RAA method by optimizing the reaction conditions. The method has strong specificity, good repeatability, high sensitivity, and a minimum detection limit of 0.1 fg / μL, and has no cross-reaction with common parasites of freshwater fish such as Capillaria, Gastrocystis, and Angiostrongylus cantonensis. The detection is rapid, providing a convenient and simple method for on-site screening of the spiny jawstomum nematode, and has high scientific research and practical value.
[0022] Compared with traditional morphological tests, the detection method of the present invention has low requirements for detection personnel. Compared with other molecular biological tests, it has the characteristics of short time consumption and low demand for detection equipment. It can complete the reaction within 20 minutes and is suitable for outdoor and breeding site operations. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0024] Figure 1 The screening results of some RAA primers of the present invention; wherein M is the molecular standard mass of DL2000; lanes 1 to 4 are the amplification results of primers GncoxF2 / GncoxR2 when the template is 0.01μg / μL, 0.001μg / μL, 0.1ng / μL, and 0.01μg / μL respectively; lanes 5 to 8 are the amplification results of primers GncoxF4 / GncoxR2 when the template is 0.01μg / μL, 0.001μg / μL, 0.1ng / μ Lanes 9 to 12 are the amplification results of primers GncoxF4 / GncoxR2 when the template is 0.01μg / μL, 0.001μg / μL, 0.1ng / μL, 0.01μg / μL, respectively; Lanes 13 to 16 are the amplification results of primers GncoxF6 / GncoxR6 when the template is 0.01μg / μL, 0.001μg / μL, 0.1ng / μL, 0.01ng / μL, respectively;
[0025] Figure 2 It is the detection result of different reaction temperatures of the present invention;
[0026] Figure 3 The results of the different primer concentration tests of the present invention are as follows;
[0027] Figure 4The detection results of different probe concentrations of the present invention;
[0028] Figure 5 The specificity and sample detection results of the present invention; 1 is Gnathostoma thornii (China), 2 is Gnathostoma thornii (Myanmar), 3 is Gnathostoma thornii (Indonesia), 4 is Gnathostoma thornii (Bangladesh), 5 to 8 are Capillaria, Gastrocystis, Angiostrongylus cantonensis and controls without template;
[0029] Figure 6 These are the sensitivity test results of different template concentrations of the present invention; 1 is 100 fg / μL, 2 is 10 fg / μL, 3 is 1 fg / μL, 4 is 0.1 fg / μL, and 5 is 0.01 fg / μL. DETAILED DESCRIPTION
[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0035] Example 1 Design and synthesis of real-time fluorescent RAA primers and probes
[0036] According to the characteristics of the co1 gene sequence of Gnathostoma spinosa in GeneBank and referring to the RAA primer and probe design guidelines, recombinase-specific primers and probes were designed.
[0037] The co1 gene of Gnathostoma spinigerum (MK033987.1) in GeneBank was used as the detection target, and the RAA primers and RAA-exo probes of Gnathostoma spinigerum were designed according to the primer and probe design principles of recombinase isothermal amplification, as shown in Table 1. Both primers and probes were synthesized by Liuhe BGI Co., Ltd.
[0038] Table 1 RAA primer names and sequences
[0039]
[0040] In the sequence of the probe GncoxP, the last thymine nucleotide from the 5' end of the sequence shown in SEQ ID NO.13 is modified with a FAM fluorescent reporter group (6-FAM-dT), and the first thymine nucleotide from the 5' end of the sequence shown in SEQ ID NO.14 is modified with a BHQ1 fluorescent quencher group (BHQ1-dT); THF (tetrahydrofuran) is contained between the SEQ ID NO.13 sequence and the SEQ ID NO.14 sequence; the 3' end of the SEQ ID NO.14 sequence is blocked to block sequence extension.
[0041] Example 2 Screening of real-time fluorescent RAA primers and probes
[0042] A pair of primers were designed based on the co1 gene of Gnathostoma spinigerum (MK033987.1), and the primer sequences were F1: GGAATTGTTAGTCAGAGTAGTT (SEQ ID NO.15) and R1: AACATTACACCAGTCAACCCC (SEQ ID NO.16). The genomic DNA of Gnathostoma spinigerum was used as a template, and F1 and R1 were used for PCR amplification. The PCR product was 321 bp in length. After purification, the product was connected to the pMD19-T vector to construct a recombinant plasmid named pMD19-T-Gncox. After PCR verification and sequencing identification, the concentration of the recombinant plasmid was determined using a full wavelength reader and converted to copy number concentration. The recombinant plasmid was verified by PCR sequencing, the concentration was determined, and the copy number was calculated, and it was used as a plasmid standard for fluorescent RAA.
[0043] The genomic DNA of Gnathostomum spinulosum was extracted and diluted 10 times. The genomic DNA of Gnathostomum spinulosum at concentrations of 0.01 μg / μL, 0.001 μg / μL, 0.1 ng / μL, and 0.01 ng / μL was used as a template, and the upstream and downstream primers in Table 1 were cross-combined for PCR amplification. The reaction system was: 2×PCR buffer 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL, and H2O was added to 25 μL. The reaction conditions were: 94℃ pre-denaturation for 5 min: 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ post-extension for 5 min.
[0044] The electrophoresis results of some primers are as follows Figure 1 As shown, the primer pair GncoxF6 / GncoxR6 with the highest sensitivity and amplification efficiency was finally selected from these primers.
[0045] Example 3 Real-time fluorescence RAA detection method for Gnathostoma spinulosa
[0046] Using pMD19-T-Gncox as a template, the primer pair GncoxF6 / GncoxR6 and the probe GncoxP were used to perform RAA reaction and detect the fluorescence signal. The specific steps are as follows:
[0047] The RAA detection system is 50 μL, including 29.4 μL of RAA reaction solution. 4 μL of upstream and downstream primers (10 μM), 0.9 μL of probe (10 μM), 2 μL of DNA template, 7.2 μL of distilled water, the reaction mixture is shaken and mixed to fully dissolve the lyophilized powder in the reaction tube, and finally 2.5 μL of Buffer B (280 mM) is added to each reaction tube. After mixing and centrifugation, the reaction tube is quickly placed in a fluorescence quantitative amplification detector to start a constant temperature reaction at 39 ° C for 20 minutes, and the fluorescence signal is detected every 30 seconds. Among them, the RAA reaction solution is a buffer containing recombinase, single-strand binding protein, and strand displacement DNA polymerase, and Buffer B is a magnesium acetate solution. RAA reaction solution and lyophilized powder were obtained from Anpu Future (Changzhou) Biotechnology Co., Ltd.
[0048] Example 4 RAA reaction conditions optimization
[0049] The optimal reaction conditions for RAA detection method were established by optimizing the reaction temperature, primer concentration and probe concentration.
[0050] The RAA detection system is 50 μL, including 29.4 μL RAA reaction solution, 4 μL upstream and downstream primers, 0.9 μL probe, 2 μL DNA template and 7.2 μL distilled water. The reaction mixture is shaken to mix well to fully dissolve the lyophilized powder in the reaction tube. Finally, 2.5 μL Buffer B (280 mM) is added to each reaction tube. After mixing and centrifugation, the reaction tube is quickly placed in a fluorescence quantitative amplification detector to start constant temperature reaction for 20 minutes, and the fluorescence signal is detected every 30 seconds.
[0051] The fixed probe concentration was 0.18 μmol / μL, the primer concentration was 0.8 μmol / μL, and the reaction temperature was 37℃, 38℃, 39℃, 40℃, and 41℃, respectively, and the RAA reaction was carried out to screen the best reaction temperature. The results showed that the RAA reaction could be carried out at 37℃ to 41℃. Figure 2 .
[0052] The RAA reaction was performed at a reaction temperature of 39°C, a probe concentration of 0.18 μmol / μL, and primer concentrations of 0.2 μmol / μL, 0.4 μmol / μL, 0.6 μmol / μL, and 0.8 μmol / μL, respectively, to screen out the best primer concentration. The results showed that the RAA reaction could be performed under primer concentrations of 0.2 μmol / μL to 0.8 μmol / μL, see Figure 3 .
[0053] The RAA reaction was performed under the conditions of fixed primer concentration of 0.8 μmol / μL and probe primer concentration of 0.09 μmol / μL, 0.12 μmol / μL, 0.15 μmol / μL and 0.18 μmol / μL, respectively, to screen out the best probe concentration. The results showed that RAA reaction could be performed under the conditions of probe concentration of 0.09 μmol / μL to 0.18 μmol / μL, see Figure 4 .
[0054] Example 5 Analysis of specificity and repeatability of RAA detection method
[0055] The genomic DNA of Gnathostoma spp. (Indonesia), Gnathostoma spp. (Bangladesh), Gnathostoma spp. (Myanmar), Gnathostoma spp. (China), Capillaria nematodes, Gastrocystis nematodes, and Angiostrongylus cantonensis were used as templates for constant temperature fluorescence reaction. The results showed that only Gnathostoma spp. could be amplified, while other nematodes could not be amplified. Figure 5 .
[0056] Example 6 RAA detection method sensitivity analysis
[0057] 1×10 2 fg / μL~1×10 -2fg / μL standard plasmid was diluted 10 times, and the primer concentration was 0.8μmol / μL, the probe concentration was 0.18μmol / μL, the reaction temperature was 39℃, and the reaction time was 20min. The results showed that the minimum detection limit of this method was 0.1fg / μL, see Figure 6 .
[0058] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A specific primer-probe combination for detecting Gnathostoma spinulosa, characterized in that: It includes an upstream primer GncoxF6, a downstream primer GncoxR6 and a probe GncoxP; The nucleotide sequence of the upstream primer GncoxF6 is shown in SEQ ID NO.11; The nucleotide sequence of the downstream primer GncoxR6 is shown in SEQ ID NO.12; The probe GncoxP is composed of the sequence shown in SEQ ID NO.13, tetrahydrofuran and the sequence shown in SEQ ID NO.14 connected in sequence.
2. The specific primer-probe combination according to claim 1, characterized in that: The 29th base from the 5' end of the sequence shown in SEQ ID NO.13 is modified with a fluorescent reporter group; the 1st base from the 5' end of the sequence shown in SEQ ID NO.14 is modified with a fluorescent quencher group, and the 3' end is blocked.
3. The specific primer-probe combination according to claim 2, characterized in that: The fluorescent reporter group includes FAM, and the fluorescent quencher group includes BHQ1.
4. The specific primer-probe combination according to claim 2, characterized in that: The blocking treatment includes labeling C3 Spacer at the 3' end of the sequence shown in SEQ ID NO.
14.
5. A RAA detection kit for detecting Gnathostoma spinulosa, characterized in that: The method comprises the specific primer-probe combination according to any one of claims 1 to 4.
6. The RAA detection kit according to claim 5, characterized in that: It also includes RAA reaction solution, Buffer B, negative quality control and positive quality control; the RAA reaction solution is a buffer solution containing recombinase, single-strand binding protein and strand displacement DNA polymerase; and the Buffer B is a magnesium acetate solution.
7. Use of the specific primer-probe combination according to any one of claims 1 to 4 or the RAA detection kit according to claim 5 or 6 in the detection of RAA of Gnathostoma thornii.
8. A RAA detection method for detecting Gnathostoma spinulosa, characterized in that: The method comprises the steps of using the sample DNA to be tested as a template and performing RAA reaction using the specific primer-probe combination described in any one of claims 1 to 4.
9. The method according to claim 8, characterized in that The RAA reaction system includes 29.4 μL of RAA reaction solution, 2.5 μL of Buffer B, 4 μL of upstream and downstream primers, 0.9 μL of probe, 2 μL of DNA template and 7.2 μL of distilled water; the concentrations of the upstream and downstream primers are both 0.2 μmol / μL to 0.8 μmol / μL; the concentration of the probe is 0.09 μmol / μL to 0.18 μmol / μL.
10. The method according to claim 8, characterized in that The RAA reaction conditions are 37-41° C., 40 cycles, and 30 seconds per cycle.
Citation Information
Patent Citations
Multiple PCR detection method of G. spinigerum, G. nipponicum and G. doloresi and primer for detection
CN102363809A