A kit for human NK lymphocyte counting based on gene methylation detection

Abstract

The present invention provides a kit for realizing human NK lymphocyte counting based on gene methylation detection, and the kit is a kit for detecting methylation of killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4) gene in a sample. The present invention proposes for the first time that the unmethylated gene region of KIR2DL4 gene can be used as a biomarker for NK cell identification. The present invention quantifies the copy number of KIR2DL4 target gene and internal reference gene by PCR technology, and can conveniently and quickly perform relative quantitative analysis on NK cells in a small amount of blood or dried blood film. The target detected by the present invention is the methylation level of leukocyte DNA in the sample, and can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc., and the requirements for samples are greatly reduced.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a kit for realizing human NK lymphocyte counting based on gene methylation detection. Background Art

[0002] Lymphocytes are important cellular components that help the human body resist diseases and stimulate immune responses. They express differentiation antigens, namely CD molecules, during the differentiation and maturation process. Depending on the expression of CD molecules, lymphocyte subsets mainly include T lymphocytes, B lymphocytes and natural killer cells (NK cells). NK cells originate from bone marrow lymphoid stem cells, and their differentiation and development depend on the bone marrow and thymus microenvironment. Unlike T and B lymphocytes, NK cells mediate natural immune responses, which do not rely on antibodies and complement, and directly kill target cells, such as tumor cells or virus-infected cells. Commonly used markers for detecting NK cells are CD16, CD56, CD57, CD59, CD11b, CD94 and LAK-1.

[0003] The proportion, number and function of different lymphocyte subsets will directly affect the body's immune status. "Lymphocyte subset" detection is an important indicator for evaluating the body's current immune function and balance state, especially for patients with immunodeficiency. It is an indispensable diagnostic item. Under normal circumstances, each lymphocyte subset maintains a certain proportion and number, and works together to maintain the body's homeostasis. During the course of the disease, the proportion and number of immune cells will undergo pathological changes, leading to immune dysfunction. The application scenarios of lymphocyte counting are wide-ranging, mainly including early screening of abnormal total lymphocyte subsets in patients with infection and malignant tumors, verification after screening for primary immunodeficiency, auxiliary diagnosis of chronic lymphocytic leukemia (CLL), post-treatment detection and monitoring of HIV-positive patients, and immune and immune reconstruction monitoring, such as transplantation, autoimmunity and other immune conditions after immunosuppressive treatment, and evaluation of immune reconstruction after hematopoietic stem cell transplantation.

[0004] Currently, flow cytometry (FCM) is the standard method for counting lymphocyte subsets or NK cells. It uses different monoclonal antibodies to bind to CD antigens on the surface of lymphocytes, and then uses multi-color fluorescent dyes to simultaneously detect surface antigens of several lymphocytes, separate NK cells from white blood cells, and thus obtain the number and relative proportion of NK cells. There are several limitations in the use of flow cytometry for NK cell counting: First, the sample requirements are high. The cells to be tested must be complete, and the blood sample must be "fresh", and generally the test is required to be performed within 8 hours; second, because flow cytometry NK cells have high requirements for samples, blood collection is more problematic for certain application scenarios such as infants and young children; third, flow cytometry detects the fluorescent signal of the complex after the fluorescent-labeled antibody binds to the antigen on the cell surface, and it is necessary to determine the threshold between the positive and negative complexes. However, for the surface antigens of different cell subpopulations, their expression is not a process of presence or absence, but different expression levels of low, medium, and high. Therefore, NK cell subpopulations may be inaccurately counted due to inaccurate threshold determination; fourth, due to differences in samples, immunological detection techniques, and operating procedures, the test results of each laboratory vary greatly. Standardization of flow cytometry NK cell counting remains a challenge, and a standardized solution needs to be established.

[0005] During the differentiation and development of NK cells, DNA methylation modification plays an important role. By regulating the expression and shutdown of genes, it provides specific methylation markers for NK cells. For example, the promoter regions of some genes involved in the differentiation and development of NK cells are completely unmethylated in NK cells, but highly methylated in other cell subsets outside NK cells, such as T lymphocytes, B lymphocytes, and non-lymphocytes such as granulocytes and monocytes. These unmethylated CpG sites can be used as specific differentially methylated regions (DMRs), that is, as biomarkers, to identify NK cells and to quantify NK cells in peripheral blood. This type of NK cell is characterized not by cell morphology or surface markers, but by epigenetic means, which is expected to overcome the limitations of the above-mentioned flow cytometry method.

[0006] At present, there are few reports on epigenetic DNA methylation biomarkers as a method for NK cell counting. Patent CN 108026577 B reported that NK cells were identified and quantified based on the demethylation or lack of methylation status of at least one CpG position in the gene region of mevalonate (diphosphate) decarboxylase (MVD), and they were distinguished from all other cells in complex samples (such as other blood cells or immune cells). However, the validation of MVD as a specific marker for NK cells is not sufficient, and cell type specificity has only been demonstrated by plasmid DNA. In addition, the description and data of the implementation of the method in whole blood and / or tissues without trypsin digestion are unclear. Summary of the invention

[0007] In order to overcome the above problems, the present invention provides a kit for realizing human NK lymphocyte counting based on gene methylation detection, wherein the kit is a kit for detecting KIR2DL4 gene methylation in a sample.

[0008] In one embodiment, a kit for achieving human NK cell counting based on gene methylation detection is characterized in that the kit is a kit for detecting KIR2DL4 gene methylation in a sample.

[0009] In one embodiment, the kit is a kit for detecting fragments in the differentially methylated region hg38 chr19: 54803010-54803922 on the KIR2DL4 gene.

[0010] In one embodiment, the kit is a kit for detecting the differentially methylated region hg38 chr19: 54803360-54803463 on the KIR2DL4 gene.

[0011] In one embodiment, the kit is a kit for detecting a gene region comprising at least one of the differentially methylated sites hg38 chr19: 54803382, hg38 chr19: 54803424, hg38 chr19: 54803429 and hg38 chr19: 54803517 on the KIR2DL4 gene.

[0012] In one embodiment, the kit calculates the ratio of human NK cells to human leukocytes by detecting the copy numbers of the internal reference gene and the KIR2DL4 gene.

[0013] In one embodiment, the internal reference gene is the RPP30 gene.

[0014] In one embodiment, the kit is a sequencing kit, a quantitative PCR kit, or a digital PCR kit.

[0015] In one embodiment, the kit includes: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr19: 54803360-54803463 and primers and probes for detecting the copy number of an internal reference gene.

[0016] In one embodiment, the kit comprises: an upstream primer SEQ ID No. 1: TGAGTGTAGAATTTAATTGTTTTG, a downstream primer SEQ ID No. 2: AACTACAAACTAAACTTATCACTTC, and a probe SEQ ID No. 3: TGGTTGTTGTGTATGA.

[0017] In one embodiment, the sample is selected from the group consisting of a body fluid, a tissue sample and an organ sample.

[0018] In one embodiment, the sample is selected from the group consisting of peripheral blood samples, capillary blood samples or venous blood samples or subfractions thereof, peripheral blood mononuclear cells, blood clots and dried blood spots.

[0019] Based on the above situation, in order to overcome the current technical limitations of cytological NK cell counting and expand its applicability, the present invention first proposed that the unmethylated gene region of the KIR2DL4 gene can be used as a biomarker for NK cell identification.

[0020] The β value of the CpG site in the methylation chip represents the degree of methylation. Comparing the β difference (Δβ value) of the corresponding CpG points between each group of samples can screen the differential methylation sites. The larger the absolute value of the Δβ value, the greater the difference in the degree of methylation of the site, and the stronger the specificity of the site. When screening the differential CpG sites of NK cells based on the above principle, the present invention creatively sets another screening condition: the Δβ values ​​of the adjacent 4-5 CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thereby meeting the needs of potential biological markers. According to this screening condition, the present invention finally identified four differentially methylated sites on the KIR2DL4 gene with large Δβ values ​​and relatively dense distribution: cg18948661 (hg38 chr19: 54803382), cg01454237 (hg38 chr19: 54803424), cg08326410 (hg38 chr19: 54803429) and cg24838349 (hg38 chr19: 54803517).

[0021] In view of the fact that a gene sequence is used for regulating genes or for methylation detection, a differential methylation region must be determined from the differential methylation sites screened above, which is used as a specific marker for distinguishing NK cells. At the same time, the CpG sites covered by the probe in the methylation chip are also non-continuous. The present invention uses the 4 differential methylation sites screened as the base point, and verifies the methylation status of the 20 CpG sites contained in the sequence of about 500bp before and after them by Sanger sequencing after bisulfite conversion and PCR amplification. In NK cells, these sites are all unmethylated, while in other subgroups, these CpG sites are all methylated, which is completely consistent with the methylation status of the 4 differential methylation sites screened, thereby determining a differential methylation region of about 920bp consisting of 20 methylation sites (hg38 chr19:54803010-54803922) as a specific unmethylated region of NK cells.

[0022] In the approximately 920 bp differentially methylated region verified above, multiple amplicon detection fragments with relatively concentrated CpG sites and covering different methylation sites were selected, such as AMP3377, AMP3574, and AMP3815. Primers and probes for the corresponding methylation conversion fragments were designed, and the ΔCt values ​​(Ct 阴性 -Ct 阳性 ), the higher the ΔCt value, the better the specificity for NK cells, thus selecting a 104bp differentially methylated region (hg38 chr19: 54803360-54803463) corresponding to the amplicon AMP3377 on the KIR2DL4 gene, which has better specificity and sensitivity and can be used as a biomarker for NK cell identification.

[0023] The technical solution adopted by the present invention is: first, the gDNA of the sample to be tested is extracted, and the extracted gDNA is used as a DNA template after bisulfite conversion. Then, double qPCR amplification is performed using primer probes specific to the amplicon of the KIR2DL4 target gene and primer probes specific to the internal reference gene RPP30. The amplification reaction is run on a qPCR instrument, and the amplification result is given in the form of a fluorescence curve. Purified NK cells are selected as the reference system, and the fluorescence curve and 2 -ΔΔCtThe relative content of NK cells in leukocytes can be calculated by the method. In addition, the digital PCR detection platform can also be used to directly detect the copy number of the KIR2DL4 target gene and the RPP30 reference gene. According to the corresponding relationship between the copy number of the reference gene and the number of cells (the copy number of RPP30: the number of cells = 2:1), the formula: the relative content of NK cells (%) = the copy number of the KIR2DL4 target gene / the copy number of the reference gene × 100 can be used to calculate the relative content of NK cells in leukocytes. The RPP30 reference gene detection fragment selected by the present invention is stably expressed in all leukocytes, and the cytosines in the sequence are all in an unmethylated state.

[0024] The target of the present invention is the methylation level of leukocyte DNA in the sample, which can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc. The requirements for samples are greatly reduced, and there is no requirement for the storage state of the samples; secondly, DNA amplification detection requires a small amount of samples, and trace DNA can meet the detection requirements; thirdly, the detection signals obtained by PCR are digital, which represent a positive or negative value for each cell, rather than an arbitrarily defined "positive" threshold like the flow cytometry method; finally, epigenetic qPCR can be performed in an automated, operator-independent manner, and reduce sensitivity to reagent variability. The kit of the present invention is not only a beneficial supplement to traditional flow cytometry detection, but also can serve the screening of severe combined immunodeficiency (SCID) in newborns. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 is the DMR sequence of the KIR2DL4 gene used to identify NK cells;

[0027] Figure 2 is the bisulfite-converted DMR sequence used to identify the KIR2DL4 gene of NK cells;

[0028] Figure 3 This is the PCR amplification curve result of plasmid DNA to verify TPG specificity;

[0029] Figure 4 This is the PCR amplification curve result of plasmid DNA to verify CPG specificity;

[0030] Figure 5This is the PCR amplification curve of the methylation standard to verify the TPG specificity;

[0031] Figure 6 This is the PCR amplification curve of the methylation standard to verify the CPG specificity;

[0032] Figure 7 It is a bar graph of gradient methylation standards to verify the specificity of the PCR system;

[0033] Figure 8 It is a linear plot of gradient methylation standards to verify the specificity of the PCR system;

[0034] Fig. 9 This is a graph showing the digital PCR results of purified cells to verify the marker specificity. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the technical solutions in the present application, the present invention will be further described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present application. In the following embodiments, unless otherwise specified, all are conventional methods.

[0036] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various chemical reagents used in the examples are all commercially available products.

[0037] Example 1 Discovery of differentially expressed genes and differentially methylated regions

[0038] In order to find the NK cell-specific DNA methylation region, the present invention first analyzed the 450K and 850K methylation chip data from Illumina, and obtained the methylation β value through operations such as probe filtering. Then the β threshold was set to 0.2 and 0.8. After processing and analysis in the confirmation data set and the validation data set, the differential sites were obtained by comparing the overall methylation levels of different lymphocyte subset samples and data quality control and standardization operations. The difference of the site was measured by the Δβ value. The larger the absolute value of the Δβ value, the more obvious the difference between the groups. According to the absolute value of the Δβ value greater than 0.5, the Q value is less than 0.01 (Q<0.01 represents a significant difference). Based on this, the present invention preferably selects the differential genes KIR2DL4 and MVD with more differential sites. The KIR2DL4 gene encodes a NK cell surface receptor protein, which regulates the activation and inhibition of NK cells by recognizing the MHC class I molecules on the cell membrane. MVD genes are a group of genes that play an important role in cells. They participate in key biological activities such as regulating cell processes, metabolism and signal transduction. They can affect the internal and external environment of cells by regulating protein expression levels or changing the functions of specific cell molecules, and have an impact on cell development, proliferation, differentiation, etc. On the basis of obtaining differentiated genes, the present invention sets another screening condition: the Δβ values ​​of 4-5 adjacent CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thereby meeting the needs of potential biological markers. As can be seen from Table 1, the Δβ value of the candidate gene MVD is large, but there are fewer continuous and dense sites. The present invention screened four differential methylation sites with large Δβ values ​​and relatively dense distribution on the differential gene KIR2DL4: cg18948661, cg01454237, cg08326410 and cg24838349, that is, the specific positions corresponding to the KIR2DL4 gene are hg38 chr19: 54803382, hg38 chr19: 54803424, hg38 chr19: 54803429 and hg38 chr19: 54803517.

[0039] Table 1 Screened differential genes and differential sites.

[0040]

[0041] Next, the present invention confirms the differential sites by experimental methods. Using gDNA of purified NK cells from fresh peripheral blood converted by bisulfite as a positive template and gDNA of non-NK cells from the same source converted by bisulfite as a negative template, Sanger sequencing and pyrophosphate sequencing were performed after qPCR amplification. As shown in the verification results in Table 2, the four differentially methylated sites (cg18948661, cg01454237, cg08326410 and cg24838349) on the KIR2DL4 gene are indeed differentially methylated sites.

[0042] In view of the fact that it is a gene sequence that regulates the gene or is used for methylation detection, a DMR must be determined from the differential methylation sites screened above, which is used as a specific marker to distinguish NK cells. At the same time, the CpG sites covered by the probe in the methylation chip are also non-continuous. The present invention uses the four differential methylation sites screened above as the base point, expands the possible range of differential sites in the sequence of about 500bp upstream and downstream of the gene (the region with a gene fragment length of 1000bp and relatively dense CG points), and then searches for possible differential methylation region DMR. The gDNA derived from purified NK cells is converted by bisulfite, and multiple pairs of universal primers are designed to amplify the target gene fragments where multiple possible differential methylation sites are located, followed by Sanger sequencing. It can be seen from the sequencing results shown in Table 3 that the sequencing results of each site to be tested are "T" (unmethylated state) when the positive template is amplified, and the sequencing results are "C" (methylated state) when the negative template is amplified, which is completely consistent with the methylation state of the four differential methylation sites screened. Based on this, the present invention determined a DMR composed of the above 20 differential methylation sites (hg38 chr19: 54803010-54803922), and the DMR is distributed in the promoter region of the KIR2DL4 gene.

[0043] Table 2 Sanger sequencing and pyrosequencing validation results of the four differentially methylated sites on the KIR2DL4 gene.

[0044]

[0045] Table 3 Sanger sequencing results of each tested site.

[0046]

[0047] In particular, Figure 1 The DNA sequence, CpG site analysis, and specific gene localization of the four differentially methylated sites of the DMR of the KIR2DL4 gene used to identify NK cells are shown. Figure 1The four differentially methylated sites are bold and underlined.

[0048] Example 2 Determined Amplicon and Specific Primer Probe

[0049] Figure 2 Bisulfite-converted DNA sequences of the identified DMR regions are shown. Figure 2 The horizontal boxes in correspond to the CpG positions (CpG1, 2, …, 20) in the analyzed KIR2DL4 gene, and the positions indicated (hg38 chr19: 54803010, hg38 chr19: 54803087 …, hg38 chr19: 54803922) correspond to CpG1, 2, …, CpG20. To further determine the optimal target gene amplicon sequence, three sets of primers and probes were designed according to the MethyLight rule for the amplicon AMP3377 (CpG5-CpG8, specific genomic location is hg38chr19: 54803360-54803463), AMP3574 (CpG10-CpG15, specific genomic location is hg38 chr19: 54803555-54803652) and AMP3815 (CpG17-CpG19, specific genomic location is hg38 chr19: 54803784-54803880), and the primers and probes were optimized to achieve the best specificity and sensitivity. As shown in Table 4, SEQ ID No. 1-15 shows the specific primer and probe sequences used according to the present invention. The present invention uses positive samples (gDNA extracted and transformed from NK cells) and negative samples (gDNA extracted and transformed from non-NK cells) as templates for the TPG system of the qPCR detection platform, and uses ΔCt (Ct 阴性 -Ct 阳性 )) The specificity of the amplicon for identifying NK cells was evaluated. The higher the ΔCt value, the better the specificity for NK cells. The results of qPCR are shown in Table 5. The primer probe corresponding to AMP3377 showed the largest ΔCt, which particularly indicated that this amplicon had good specificity and sensitivity and could be used as a biomarker for NK cell identification.

[0050] Preferably, Figure 2The underlined positions (genomic locations hg38 chr19: 54803360-54803463) show the CPG sites analyzed on the amplicons determined for the identification of KIR2DL4 target genes in NK cells. The horizontal boxes correspond to the CPG positions (CPG5, 6, ... 8) in the best amplicons analyzed, and the gene positions indicated are hg38 chr19: 54803377, hg38 chr19: 54803382 ... hg38 chr19: 54803429, corresponding to CPG5, 6 ... 8.

[0051] SEQ ID No. 16 and SEQ ID No. 17 show the DNA sequences of the target gene amplicons converted by bisulfite according to the qPCR and digital PCR detection systems of the present invention. The CPG system refers to the differential methylation sites of "CG" sites that remain "CG" after the DNA sequences of the target gene amplicons are converted by bisulfate, and the specific primers and probes for detecting the sites. The TPG system refers to the differential methylation sites of "TG" sites that are converted by unmethylated "CG" sites after the DNA sequences of the target gene amplicons are converted by bisulfate, and the specific primers and probes for detecting the sites.

[0052] Preferably, the CPG (methylation site detection) system-specific amplicon (SEQ ID No. 16):

[0053] GTGAGTGTAGAATTTAATCGTTTCGTGTAGGGGTAAGTGAGTTTGAGATGTGTTTTGAGTTTGGTCGTTGCGTATGATGTGAAGTGATAAGTTTAGTTTGTAGTT

[0054] Preferably, the TPG (detection of unmethylated sites) system-specific amplicon (SEQ ID No. 17):

[0055] GTGAGTGTAGAATTTAATTGTTTTGTGTAGGGGTAAGTGAGTTTGAGATGTGTTTTGAGTTTGGTTGTTGTGTATGATGTGAAGTGATAAGTTTAGTTTGTAGTT

[0056] Table 4 Sequences of primers and probes specific for target gene KIR2DL4

[0057]

[0058] Table 5 qPCR amplification results of three sets of primer probes.

[0059]

[0060] Example 3 Validation of TPG and CPG specific PCR systems

[0061] The specificity of the PCR system was verified using a test template (plasmid DNA). Two templates with different concentration gradients were set up. The sequence of the C plasmid was the same as SEQ ID No. 16, and the sequence of the T plasmid was the same as SEQ ID No. 17. The TPG and CPG systems were tested by PCR amplification. The results were as follows: Figure 3 and Figure 4 shown.

[0062] Depend on Figure 3 It can be seen that when the added template is a high-concentration T plasmid or a high-concentration T plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration C plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the TPG system has good specificity.

[0063] Depend on Figure 4 It can be seen that when the added template is a high-concentration T plasmid or a high-concentration C plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration T plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the CPG system has good specificity.

[0064] In addition, methylation standards with a methylation rate of 0% and 100% were used to verify the specificity of the TPG and CPG systems. The methylation standards were from QIAGEN. Figure 5 and Figure 6 It is known that when the 0% methylation standard is used as a template, the TPG system produces a typical amplification curve, while the CPG system does not. Similarly, when the 100% methylation standard is used as a template, the CPG system produces a typical amplification curve, while the TPG system does not. The above results show that the primer probe specificity of the TPG and CPG systems is good.

[0065] Considering the differences in methylation levels in actual samples, the specificity of the PCR system was further verified using gradient methylation standards. To this end, a methylation standard with a methylation rate of 0% was mixed with a methylation standard with a methylation rate of 100% to simulate methylation values ​​in the range of 0%-100%. Then, the ratio (%) of TPG templates in these mixtures was detected using the assay of the present invention. The results are shown in FIG. Figure 7 and Figure 8 As shown in Figure 2, when the methylation ratio changes from 0% to 100%, the ratio calculated by the digital PCR test also changes in the same way, showing a good linear relationship (R2 = 0.9963). The test results of the gradient methylation standard fully demonstrate that the TPG and CPG systems have good specificity and can distinguish different methylation levels.

[0066] Example 4 Validation of KIR2DL4 target gene as a NK cell-specific marker.

[0067] Purified cells were used to verify the specificity of KIR2DL4 as a NK cell marker. To this end, the DNA extracted and transformed from lymphocytes (T lymphocytes, CD4+ T lymphocytes, CD8+ T lymphocytes, B lymphocytes and NK cells) purified by magnetic bead sorting was used as a template, and the copy number of the target gene KIR2DL4 and the internal reference gene RPP30 was directly obtained using a digital PCR platform. The relative content of each cell subset can be directly calculated using the formula: relative content of cell subsets (%) = copy number of KIR2DL4 target gene / copy number of internal reference gene × 100. Fig. 9 It can be seen that the purity of NK cells detected by the TPG system is very high, with the purity of T lymphocytes and CD8+ T lymphocytes being 14% and 13%, respectively, while the proportion of B cells and CD4+ T cells tested is very low (<5%), and the test results are very consistent with those of flow cytometry. The above results indicate that the KIR2DL4 target gene can be used as a marker specific to NK cells.

[0068] Example 5 Determination of NK cell content in actual samples.

[0069] The KIR2DL4 primer probe of the present invention is used to quantify the NK lymphocyte content (%) in the neonatal dry blood sample. SCID is an immunodeficiency disease caused by a series of gene mutations (involving more than 20 genes). Children have T and B lymphocyte function defects, significantly low T lymphocyte counts, with or without low B lymphocyte counts, NK cell function defects or low numbers. The SCID sample used in the present invention is a sample with a significantly reduced number of NK cells verified by flow cytometry results. Digital PCR detection obtains the copy number of the KIR2DL4 gene and the internal reference gene, and the relative content of NK cells in leukocytes can be calculated using the formula: NK cell proportion (%) = KIR2DL4 target gene copy number / reference gene copy number × 100. As shown in Table 6, the target gene copy number of the SCID sample is 0-3 copies / µL, accounting for 0-0.3% in leukocytes, while the target gene copy number of the normal neonatal sample is 13-125 copies / µL, accounting for 0.9-10.6% in leukocytes. The above results indicate that the method provided by the present invention can significantly distinguish SCID patients from normal newborns and can serve for newborn SCID screening.

[0070] Table 6 Quantification of KIR2DL4 gene and proportion of NK cells in dried blood samples.

[0071]

[0072] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0073] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A method for realizing human NK lymphocyte counting based on gene methylation detection, characterized in that: The method is to detect the methylation of the KIR2DL4 gene in the sample, and the method is to detect the differentially methylated region hg38chr19: 54803010-54803922 on the KIR2DL4 gene.

2. The method according to claim 1, characterized in that: The method is to detect the differentially methylated region hg38 chr19: 54803360-54803463 on the KIR2DL4 gene.

3. The method according to claim 1, characterized in that The method is to detect a gene region comprising at least one of the differentially methylated sites hg38 chr19: 54803382, hg38 chr19: 54803424, hg38 chr19: 54803429 and hg38 chr19: 54803517 on the KIR2DL4 gene.

4. The method according to claim 1, characterized in that: The method calculates the proportion of human NK cells to human leukocytes by detecting the copy numbers of the internal reference gene and the KIR2DL4 gene.

5. The method according to claim 4, characterized in that The internal reference gene is the RPP30 gene.

6. The method according to claim 4, characterized in that The method is a sequencing method, a quantitative PCR method or a digital PCR method.

7. The method according to claim 6, characterized in that The method includes using primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr19:54803360-54803463 and primers and probes for detecting the copy number of an internal reference gene.

8. The method according to claim 7, characterized in that The method includes using the following primers: upstream primer SEQ ID No. 1: TGAGTGTAGAATTTAATTGTTTTG, downstream primer SEQ ID No. 2: AACTACAAACTAAACTTATCACTTC, and probe SEQ ID No. 3: TGGTTGTTGTGTATGA.

9. The method according to claim 1, characterized in that: The sample is selected from the group consisting of peripheral blood samples, capillary blood samples or venous blood samples or sub-fractions thereof, peripheral blood mononuclear cells, blood clots and dried blood spots.

Images