A molecular marker for distinguishing early and late flowering of brassica oleracea var. capitata and application thereof

Abstract

The application discloses a molecular marker for distinguishing early and late flowering of Brassica oleracea and application thereof, wherein the nucleotide sequence of the molecular marker exists in the non-coding region of chromosome 4 of the genome of early flowering Brassica oleracea, and does not exist in the non-coding region of chromosome 4 of the genome of late flowering Brassica oleracea; based on the molecular marker, a primer pair Bf5 is further designed, DNA of the Brassica oleracea is amplified by using the primer pair, and early flowering varieties or materials of the Brassica oleracea can be screened according to the presence or absence of the target band. The molecular marker and the primer pair provided by the application can be used for rapidly detecting early flowering varieties and materials of the Brassica oleracea, time and resources are greatly saved, selection efficiency is greatly improved, and thus the breeding process is accelerated.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a molecular marker for distinguishing early and late flowering of Brassica oleracea var. capitata and application thereof. BACKGROUND

[0002] Brassica oleracea var. capitata is a biennial vegetable crop of Brassica oleracea var. capitata in the Brassicaceae family, is a chloroplast vernalization type plant, completes vegetative growth in the first year, flowers and bears fruit in the second year, completes reproductive growth, and the main edible organ is leaf ball. The vernalization pathway, photoperiod pathway, circadian rhythm pathway and gibberellin pathway complement each other and jointly regulate the expression of flowering integrator, and affect the bolting and flowering of cabbage. In the actual production process of cabbage, if a cabbage variety with poor bolting resistance is used, or the spring encounters a cold spring phenomenon, and the cabbage leaf ball reaches a certain low temperature before maturation, the cabbage plant will quickly turn from vegetative growth to reproductive growth, causing premature bolting, which will prevent the growth of leaf ball, resulting in yield and quality reduction, and causing serious economic losses. Therefore, breeding of cabbage varieties that are not sensitive to low-temperature vernalization is an important way to solve this problem, and the prerequisite for achieving this breeding goal is to breed cabbage parent materials that are resistant to bolting and late flowering.

[0003] At present, there are mainly two methods for screening breeding materials. One is the traditional breeding method, which needs to select and identify the bolting and flowering traits across years, has a long cycle, a complicated operation procedure, a large workload, and is not accurate due to the close relationship between the bolting and flowering traits and environmental factors. The other method is the molecular marker assisted method developed in recent years, which combines molecular marker technology with traditional breeding, uses stable and reliable DNA molecular markers to replace phenotype markers that are easily affected by the environment, and screens breeding materials. Whole genome resequencing technology, i.e. resequencing the genomes of different individuals of the same species, analyzing the differences in the sequences of the individuals based on the published genome sequences, and identifying single nucleotide polymorphism sites (SNP), insertion and deletion sites (InDel) and copy number variation sites (CNV) through the data results of genome resequencing, which determine the differences between different individuals of the same species. The available phenotype assisted markers for traditional assisted marker selection breeding are very limited. Therefore, it is of great significance to develop a molecular marker for distinguishing early and late flowering of Brassica oleracea var. capitata by whole genome resequencing of different cabbage varieties or materials combined with traditional phenotype identification, to screen late flowering breeding materials at the seedling stage, and to improve the breeding efficiency. SUMMARY

[0004] One of the purposes of the present application is to provide an application of a molecular marker in identifying or screening early or late flowering time of Brassica oleracea var. capitata, the nucleotide sequence of the molecular marker is as follows:

[0005] TTTTAATTTCACCGGTTCAAATCTGCACACTTATTTGCCGTCCTGAATCCATATTC, which exists in the non-coding region of chromosome 4 of early flowering Brassica oleracea var. capitata genome and does not exist in the non-coding region of chromosome 4 of late flowering Brassica oleracea var. capitata genome.

[0006] The second purpose of the present application is to provide an application of primer pair Bf5 in identifying or screening early or late flowering time of Brassica oleracea var. capitata, the sequence of the primer pair Bf5 is as follows:

[0007] Bf5F: GCCGTCCTGAATCCATATTC;

[0008] Bf5R: TTGCTAGCATTACGGTCCGG.

[0009] The third purpose of the present application is to provide a method for identifying early flowering varieties or materials of Brassica oleracea var. capitata, comprising the following steps:

[0010] Step 1, extracting genomic DNA of the varieties or materials to be identified;

[0011] Step 2, using the DNA extracted in step 1 as a template, PCR amplification is carried out on the template by using primer pair Bf5, the sequence of primer pair Bf5 is as follows:

[0012] Bf5F: GCCGTCCTGAATCCATATTC

[0013] Bf5R: TTGCTAGCATTACGGTCCGG.

[0014] Step 3, electrophoretic separation is carried out on the PCR amplification product of step 2 to obtain the banding pattern of each sample, if a 520bp fragment is obtained, it indicates that the varieties or materials to be identified are early flowering.

[0015] Further, the reaction system for PCR amplification in step 2 is 20µL, wherein: 1µL of genomic DNA template, 1µL of each of the upstream and downstream primers, and 10µL of 2×EasyTaq PCR SuperMix for PAGE.

[0016] Further, the reaction conditions for PCR amplification in step 2 are as follows: 94℃ pre-denaturation for 3min; 94℃ denaturation for 50S, 56℃ for 50S, 72℃ extension for 60S, 35 cycles; and 72℃ extension for 10min.

[0017] The application obtains the difference segment gene sequence of early flowering cabbage and late flowering cabbage by counting the flowering time of early flowering cabbage and late flowering cabbage; through identification, the sequence is deleted in the non-coding region of the genome of late flowering cabbage, and the sequence is contained in the non-coding region of the genome of early flowering cabbage. Then, the primer pair Bf5 is designed according to the sequence information, which can be used for rapid and efficient identification of early flowering varieties or materials of cabbage.

[0018] The application overcomes the defects of long time period, high cost, inaccuracy and the like of the traditional method, and can realize seedling selection, reduce workload and improve selection efficiency; meanwhile, the application is beneficial to the establishment of a late flowering molecular marker assisted breeding system of cabbage. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Table 1 is the flowering time statistics of early flowering cabbage and late flowering cabbage.

[0020] Figure 2 Table 2 is the difference gene comparison result of early flowering cabbage and late flowering cabbage.

[0021] Figure 3 Figure 1 is the agarose gel electrophoresis result diagram of the marker primer Bf5 after PCR amplification of different varieties of cabbage, in which M is DL2000 Marker, and the electrophoresis result is shown in the figure. As can be seen from the figure, the early flowering varieties in lanes 2, 3, 4, 5, 6, 7 and 8 can all amplify a 520bp fragment, and the late flowering varieties in lanes 1, 9, 10, 11, 12, 13, 14, 15 and 16 do not have a 520bp fragment. DETAILED DESCRIPTION

[0022] The preferred embodiments of the application will be described in detail below with reference to the examples. It should be understood that the following examples are given only for the purpose of illustration and are not intended to limit the scope of the application. Those skilled in the art can make various modifications and replacements to the application without departing from the spirit and principles of the application.

[0023] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0024] The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified. Example 1

[0025] Flowering time statistics of early flowering and late flowering cabbage: Field flowering time investigation of different cabbage was conducted, and 39 early flowering cabbage and 37 late flowering cabbage were screened. The flowering time of early flowering cabbage and late flowering cabbage was counted for three consecutive years, and the results were as follows: the average flowering time of early flowering cabbage in 2018 was 198.21±6.76 days, and the average flowering time of late flowering cabbage was 202.13±7.32 days, which was about 4 days later than early flowering cabbage; the average flowering time of early flowering cabbage in 2019 was 203.22±6.15 days, and the average flowering time of late flowering cabbage was 208.37±7.73 days, which was about 5 days later than early flowering cabbage; the average flowering time of early flowering cabbage in 2020 was 201.38±8.18 days, and the average flowering time of late flowering cabbage was 204.05±8.75 days, which was about 3 days later than early flowering cabbage; as shown in Figure 1 , the flowering time of late flowering cabbage was significantly later than that of early flowering cabbage (P<0.01).

[0026] According to the results of resequencing the genomes of early and late flowering cabbage materials, the differences in genome sequences of different flowering characteristics materials were analyzed, the target difference segments were screened by functional analysis of the difference sequences, the primer pairs were designed, and the early and late flowering cabbage with sample number greater than 25 were selected for PCR amplification, and the segments with statistical difference in the genomes of early and late flowering cabbage were compared and screened; further sequencing verification was carried out, and the difference segment gene sequence of early flowering and late flowering cabbage was obtained, and the nucleotide sequence information of the difference segment was obtained by comparison combined with the anchored statistical difference segment; according to the nucleotide sequence information of the difference segment, the primer pairs were designed, and the genomic DNA of cabbage was amplified and verified; combined with the flowering period phenotype data of early flowering and late flowering cabbage, the molecular marker was identified, and the insertion and deletion sequence was:

[0027] TTTTAATTTCACCGGTTCAAATCTGCACACTTATTTGCCGTCCTGAATCCATATTC.

[0028] The molecular marker is located at the position of non-coding region 4239,3723-4239,3779 of chromosome 4, with a length of 56 bp, and the non-coding region of late flowering cabbage genome lacks the molecular marker, and the non-coding region of early flowering cabbage genome contains the molecular marker, as shown in Figure 2 . Example 2

[0029] The embodiment provides a method for identifying the flowering time of cabbage, comprising the following steps:

[0030] Step 1: Extraction of Brassica oleracea var. capitata L. leaf genomic DNA

[0031] Take 0.1 g of young leaves of Brassica oleracea var. capitata L., grind in liquid nitrogen, add 500 μL of CTAB lysis solution into a 1.5 mL centrifuge tube, take out after 0.5-1 h in a 65℃ water bath, add an equal volume of chloroform / isoamyl alcohol mixture, shake gently, centrifuge at 12000 r / min for 8-10 min, extract the supernatant with chloroform / isoamyl alcohol mixture for 1-2 times, add pre-cooled isopropanol, stand at 4℃ for more than 3 hours, collect the flocculent DNA, wash with 70% ethanol, dry, dissolve the flocculent DNA in TE buffer, store, detect the purity and concentration of the DNA, dilute to 50 ng / μL, and store in a -20℃ refrigerator for standby use;

[0032] The CTAB lysis solution has the following composition: 2% CTAB (volume fraction), 2 mol / L NaCl2, 20 mmol / L EDTA, 100 mmol / L Tris-HCl, pH=8.0, and 0.2% β-mercaptoethanol (volume fraction); the chloroform / isoamyl alcohol mixture has a volume ratio of chloroform to isoamyl alcohol of 24:1.

[0033] Step 2, amplification of primer pair Bf5 in Brassica oleracea var. capitata L. genome

[0034] The PCR reaction system is 20 μL, containing 1 μL of genomic DNA template, 1 μL of each of the upstream and downstream primers, and 10 μL of 2×EasyTaq PCR SuperMix for PAGE.

[0035] The sequence of primer pair Bf5 is as follows:

[0036] Bf5F: GCCGTCCTGAATCCATATTC;

[0037] Bf5R: TTGCTAGCATTACGGTCCGG.

[0038] The PCR reaction conditions are as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 S, 56℃ for 50 S, 72℃ extension for 60 S, 35 cycles; 72℃ extension for 10 min, and then storage at 4℃.

[0039] Step 3, agarose gel electrophoresis detection

[0040] After the PCR amplification is completed, 1.2% agarose gel electrophoresis is adopted, the electrophoresis buffer is 1×TAE buffer, 10 μL is loaded, electrophoresis is performed at 150 V for 20 min, and then observation and photography are performed on a gel imaging instrument.

[0041] The electrophoresis results are as follows Figure 3 It can be seen that the early flowering varieties in lanes 2, 3, 4, 5, 6, 7, 8 and 17 can all amplify a 520bp fragment, and the late flowering varieties in lanes 1, 9, 10, 11, 12, 13, 14, 15 and 16 do not have a 520bp fragment.

[0042] From the above results, it can be seen that when the marker primer Bf5 is used to amplify the early or late flowering varieties or materials of Brassica oleracea, if a 520bp fragment can be amplified, it indicates that the Brassica oleracea has an early flowering trait.

Claims

1. Use of primer pair Bf5 in identifying or screening early or late flowering time of cabbage, characterized in that: The sequence of the primer pair Bf5 is as follows: Bf5F:GCCGTCCTGAATCCATATTC; Bf5R: TTGCTAGCATTACGGTCCGG.

2. A method for identifying early flowering cabbage varieties, characterized in that: The following steps are involved: Step 1, extracting genomic DNA of the variety to be identified; Step 2: Using the DNA extracted in step 1 as a template, perform PCR amplification using primer pair Bf5. The sequence of primer pair Bf5 is as follows: Bf5F: GCCGTCCTCTGAATCCATATTC Bf5R: TTGCTAGCATTACGGTCCGG; Step 3: Perform electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 520 bp fragment is obtained, it indicates that the variety to be identified is early flowering.

3. The method according to claim 2, wherein The PCR amplification reaction system in step 2 is 20 µL, which contains: 1 µL of genomic DNA template, 1 µL of upstream and downstream primers, and 10 µL of 2×EasyTaq PCR SuperMix for PAGE.

4. The method according to claim 2, wherein The reaction conditions for PCR amplification in step 2 were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, and extension at 72°C for 60 s, for 35 cycles; and extension at 72°C for 10 min.

Images