Molecular marker for detecting qse(fe).yaas-2d, qtl of selenium(iron) content in wheat kernel and application thereof

Abstract

The present invention discloses a method for detecting QTL of selenium (iron) content in wheat grains QSe(Fe).yaas-2D The molecular marker and its application, wherein the molecular marker is a KASP molecular marker having a nucleotide sequence as shown in SEQ ID No. 4. The KASP molecular marker of the present invention can be used to identify the main effect QTL loci related to selenium and iron content in wheat grains. QSe(Fe).yaas-2D The present invention is a major effect QTL locus related to selenium and iron content in wheat grains. QSe(Fe).yaas-2D It provides a good tool for effective use in breeding. This marker can quickly screen the selenium and iron content in wheat grains, facilitate the screening of wheat materials carrying excellent allelic variations, and improve breeding efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of wheat breeding, and particularly relates to a molecular marker for detecting selenium (iron) content QTL of wheat grains and application. QSe (Fe).yaas-2D BACKGROUND

[0002] Agricultural products provide almost all nutrients for human beings. Wheat, rice and corn are the three major crops in the world, but the trace elements in them are very low in both variety and abundance, so the deficiency of trace elements in the human body is quite common, among which zinc and iron are most deficient in diet, followed by copper, manganese and selenium. The malnutrition caused by trace element deficiency causes an annual loss of 30 billion yuan, and it is estimated that it will bring several hundred billion yuan of economic loss to China in the next 10 years. A series of trace element deficiency diseases are increasingly serious, especially in infants, women and the elderly. Iron in the human body is divided into two parts, one is functional iron, including myoglobin iron, transferrin iron and hemoglobin iron; the other is storage iron, including hematin and ferritin. Normal people need 20-25 mg of iron per day for hemopoiesis, mainly from the red blood cells destroyed by aging. In addition, iron is also involved in the synthesis or enhancement of hormone function, the maintenance of normal immune function of the body, the enhancement of the bactericidal and phagocytic functions of neutrophils, the assistance in the transport of ordinary elements, the maintenance of T and B cell proliferation, differentiation and antibody production (Folin et al. 1991). Selenium is an important component of glutathione peroxidase, which has strong antioxidant activity and plays an important role in scavenging free radicals and anti-aging, so selenium may inhibit a variety of incurable diseases such as liver cancer, lung cancer, colon cancer and leukemia. Deficiency of selenium will lead to reduced enzyme activity, insufficient enzyme synthesis, etc., affecting the normal life activities of the human body, and even causing premature aging (Wei Guanghui et al. 2020).

[0003] ​Most of the trace element content traits are quantitative traits, so it is difficult to detect in the genome. The increasingly developed molecular marker technology provides a powerful tool for elucidating the genetic mechanism of quantitative traits. Molecular marker-assisted breeding based on high-efficiency selection of key trait major genetic loci / gene is more and more common. At present, the most abundant in the genome is single nucleotide polymorphism (SNP), which has largely replaced simple sequence repeats (SSR). Kompetitive allele specific PCR (KASP) can perform high-precision allele genotyping for specified SNPs and InDels (insertions and deletions, InDels). Compared with other verification technologies, KASP has higher analysis stability and accuracy, lower reaction cost, larger throughput, and is a high-quality and low-cost genotyping technology (Chen et al. 2003; Yu et al. 2014). Previous genetic studies on wheat grain trace element content are less, and few major stable QTL loci are located, and related molecular markers that can be applied to breeding are rare. SUMMARY

[0004] In view of the problems that most of the trace element contents are quantitative traits and difficult to detect in the genome, the present application provides a molecular marker for detecting a wheat grain selenium (iron) content QTL QSe(Fe).yaas-2D and application. The present application uses wheat Wheat 55K SNP high-throughput gene chip to obtain genotype data, combines the phenotypic data of selenium and iron in two years and average value, performs QTL positioning, detects one major QTL site QSe(Fe).yaas-2D related to selenium and iron from Yangmai No. 4, and develops a KASP marker and primer set for high-efficiency screening of the high and low content of selenium and iron in wheat grain.

[0005] The present application uses wheat Wheat 55K SNP high-throughput gene chip to obtain genotype data, detects one major QTL site QSe(Fe).yaas-2D related to the content of selenium and iron in wheat grain from Yangmai No. 4 on 2D chromosome, and further develops a KASP marker and special primer set KASP-QSe(Fe)-2D .

[0006] The present application provides a molecular marker for detecting a wheat grain selenium (iron) content QTL QSe(Fe).yaas-2D , the molecular marker is a KASP molecular marker with the nucleotide sequence as shown in SEQ ID No. 4.

[0007] The second aspect of the present application provides a primer set for detecting whether the allelic variation at position 36 of the nucleotide sequence shown in SEQ ID No. 4 is CC, TT or C and T, which is a complete primer set consisting of the upstream primers shown in SEQ ID No. 1 and SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0008] Further, the upstream primers are designed according to the deoxyribonucleotide at position 36 of the nucleotide sequence shown in SEQ ID No. 4 and the sequence upstream thereof on chromosome 2D in the wheat genome, and the 3' terminal deoxyribonucleotide of one of the upstream primers is C and the 3' terminal deoxyribonucleotide of the other of the upstream primers is T;

[0009] The downstream primer is designed according to the sequence downstream of the deoxyribonucleotide at position 36 of the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome.

[0010] Further, the 5' terminal of the upstream primer shown in SEQ ID No. 1 is connected to the fluorescent label sequence FAM, and the 5' terminal of the upstream primer shown in SEQ ID No. 2 is connected to the fluorescent label sequence HEX.

[0011] The third aspect of the present application provides a reagent or kit containing the above-mentioned primer set.

[0012] The fourth aspect of the present application provides the use of the above-mentioned primer set or reagent or kit in any one of the following:

[0013] (A) identifying or assisting in identifying the selenium (iron) content trait of wheat grains;

[0014] (B) comparing the selenium (iron) content of the wheat grains to be tested;

[0015] (C) breeding or screening wheat single plants or strains or lines or varieties with relatively high selenium (iron) content in wheat grains;

[0016] (D) breeding or screening wheat single plants or strains or lines or varieties with relatively low selenium (iron) content in wheat grains;

[0017] (E) preparing products for comparing the selenium (iron) content of the wheat grains to be tested;

[0018] (F) preparing products for breeding or screening wheat single plants or strains or lines or varieties with relatively high selenium (iron) content in wheat grains;

[0019] (G) products for selecting or screening wheat plants or lines or strains or varieties with relatively low selenium (iron) content in the grain.

[0020] The fifth aspect of the present application provides a method for detecting whether the 36th allelic variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome is CC, TT or C and T, comprising the following steps (1) or (2):

[0021] (1) direct sequencing;

[0022] (2) PCR amplification of the wheat genomic DNA to be tested using the primer set or reagent or kit containing the primer set described above, and then scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome to be tested is CC, TT or C and T according to the following method:

[0023] If the fluorescence signal data of the amplification product of the wheat to be tested is analyzed by Kluster Caller software to show red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome to be tested is a homozygote of C;

[0024] If the fluorescence signal data of the amplification product of the wheat to be tested is analyzed by Kluster Caller software to show blue, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome to be tested is a homozygote of T;

[0025] If the fluorescence signal data of the amplification product of the wheat to be tested is analyzed by Kluster Caller software to show green, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome to be tested is a heterozygote of C and T.

[0026] The sixth aspect of the present application provides any one of the following methods:

[0027] Method A: a method for comparing the selenium (iron) content of wheat grains to be tested, comprising the following steps:

[0028] (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome is CC, TT or C and T;

[0029] (A2) the selenium (iron) content of the test wheat grain is higher than that of the test wheat in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is homozygous T or heterozygous C and T;

[0030] Method B: a method for breeding or screening a wheat single plant or strain or line or variety with relatively high selenium (iron) content in wheat grain, comprising the following steps:

[0031] (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the wheat genome is CC, TT or C and T;

[0032] (B2) selecting the test wheat in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is homozygous C as the parent for breeding, and selecting the wheat in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is homozygous C in each generation of breeding, and finally obtaining a wheat single plant or strain or line or variety with relatively high selenium (iron) content in grain;

[0033] Method C: a method for breeding or screening a wheat single plant or strain or line or variety with relatively low selenium (iron) content in wheat grain, comprising the following steps:

[0034] (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the wheat genome is CC, TT or C and T;

[0035] (C2) selecting the test wheat in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is homozygous T as the parent for breeding, and selecting the wheat in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is homozygous T in each generation of breeding, and finally obtaining a wheat single plant or strain or line or variety with relatively low selenium (iron) content in grain.

[0036] Specifically, in the method A, the method B and the method C, the method for detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the wheat genome is CC, TT or C and T is the method of the fifth aspect of the present application.

[0037] The seventh aspect of the present application provides application of the above KASP molecular marker, primer set, reagent or kit, and the above method in molecular marker assisted breeding of wheat grain selenium (iron) content.

[0038] By the above technical solution, the present application achieves the following beneficial effects:

[0039] The KASP molecular marker of the present application can be used for molecular marker assisted selection breeding of the wheat grain selenium and iron content related major QTL site QSe (Fe).yaas-2D The present application provides a good tool for effective use of the wheat grain selenium and iron content related major QTL site QSe(Fe).yaas-2D in breeding, which can quickly screen the wheat grain selenium and iron content, provides convenience for screening wheat materials carrying excellent allelic variation, and improves breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0040] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiment description will be briefly introduced as follows:

[0041] Figure 1 The KASP marker of the present application is QSe(Fe).yaas-2D Positioning map of the RIL population of Yangmai 4 / Yanduan 1

[0042] Figure 2 The KASP marker of the present application is QSe(Fe).yaas-2D KASP marker KASP-QSe(Fe)-2D Genotyping results amplified in 149 strains and effects of the site on selenium and iron.

[0043] Figure 3 The KASP marker of the present application is QSe(Fe).yaas-2D KASP marker KASP-QSe(Fe)-2D Genotyping results amplified in 149 strains and effects of the site on selenium and iron. DETAILED DESCRIPTION

[0044] The specific embodiments of the present application will be described in detail below in combination with the embodiments. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present application, and are not used to limit the present application.

[0045] Yangmai 4 (YM4) is a high-yield and disease-resistant wheat variety bred by Jiangsu Lixihe Agricultural Science Institute. Yanzhan 1 (YZ1) is a high-yield and early-mature wheat variety bred in the Huanghuai wheat region. In this study, a recombinant inbred line (RIL) population was created by crossing Yangmai 4 as the female parent and Yanzhan 1 as the male parent. A genetic map was constructed using the Wheat 55K SNP chip, and the phenotypic data of selenium and iron in two years and the average value were used to mine the genetic regulation sites of these grain trace element contents and develop the corresponding KASP markers, in order to provide materials and methods for breeding trace element-enriched wheat varieties.

[0046] Example 1 Screening of stable QTL sites significantly associated with wheat grain selenium and iron content and verification

[0047] 1. Materials and methods

[0048] 1.1 Test materials and field test

[0049] In the early stage, Yangmai 4 was used as the female parent and Yanzhan 1 was used as the male parent for hybridization. A RIL population containing 151 RILs (F 10 Generation) was obtained by single-seed descent method. The RIL population was planted in Jiangsu Lixihe Agricultural Science Institute Wanfu Test Base (Yangzhou, Jiangsu) in 2019 and 2020, respectively. The wheat planting date in Yangzhou was unified as October 25th in the test year. The test used a randomized block design, with 3 rows of each line, 2 replications, 40 grains per row, row length 1.33 m, and row spacing 0.23 m. The field fertilization and management referred to the local field cultivation production, and timely prevention and control of diseases, pests and weeds. At maturity, each line was manually harvested according to the plot. In 2020 and 2021, the grains were harvested at the maturity of wheat. The wheat seeds were washed with deionized water three times, dried, and baked in an incubator until constant weight, ground and sieved for sample preparation for the following analysis and testing. In 2022, the planting method of 149 wheat high-generation lines and the determination method of trace elements were referred to the RIL population.

[0050] 1.2 Trace element determination method

[0051] The trace element determination was completed by Nanjing Yiknow Source Detection Technology Co., Ltd. The manganese, iron, copper and zinc determination method was as follows: 0.2 g of sample was weighed (accurate to 0.0001 g), placed in a fluorotank, 5 mL of concentrated nitric acid and 2 mL of hydrogen peroxide were added, placed on a graphene electric heating plate, heated and digested at 150 DEG C, nitric acid was supplemented in the middle until the solution was transparent, set 170 DEG C to chase acid, until the solution was left about 1 mL, after cooling, diluted to 50 mL with pure water, filtered, and the iron content was determined by a Thermo Scientific double-channel inductively coupled plasma atomic emission spectrometer (ICP-AES). A blank test was also performed. The mixed standard solution was injected into the ICP-AES, the signal response values of the elements and the internal standard elements were determined, the concentration of the elements was taken as the abscissa, and the ratio of the response signal values of the elements and the selected internal standard elements was taken as the ordinate, to draw a standard curve. The blank solution and the sample solution were injected into the ICP-AES respectively, the signal response values of the elements and the internal standard elements were determined, and the concentration of the elements in the digestion solution was obtained according to the standard curve. The content of the element to be determined in the sample was calculated according to formula (1).

[0052] X= (1)

[0053] In the formula: X- the element content in the sample (mg / kg); P- the mass concentration of the element in the sample solution (mg / L); P 0- the mass concentration of the element in the sample blank solution (mg / L); V- the constant volume of the sample digestion solution (mL); f- the sample dilution multiple; m- the sample weighing mass (g).

[0054] The trace element selenium determination method was as follows: 0.5 g of sample was weighed (accurate to 0.0001 g), placed in a fluorotank, 5 mL of concentrated nitric acid and 2 mL of hydrogen peroxide were added, placed on a graphene electric heating plate, heated and digested at 150 DEG C, nitric acid was supplemented in the middle until the solution was transparent, set 170 DEG C to chase acid, until the solution was left about 1 mL, after cooling, diluted to 50 mL with pure water, filtered, and the selenium content was determined by an atomic fluorescence spectrometer (AFS-933). A blank test was also performed. The mixed standard solution was injected into the atomic fluorescence spectrometer, the signal response values of the selenium and the internal standard elements were determined, the concentration of the selenium was taken as the abscissa, and the ratio of the response signal values of the selenium and the selected internal standard elements was taken as the ordinate, to draw a standard curve. The blank solution and the sample solution were injected into the atomic fluorescence spectrometer respectively, the signal response values of the selenium and the internal standard elements were determined, and the concentration of the selenium in the digestion solution was obtained according to the standard curve. The content of the selenium in the sample was calculated according to formula (1).

[0055] 1.3 Statistical analysis of phenotype data

[0056] SPSS 22.0 and Excel 2019 were used for processing and statistical analysis of the phenotype data, mainly descriptive statistics, variance analysis and T test.

[0057] 1.4 Construction of genetic map and QTL mapping

[0058] The seedlings of the tested materials were taken, and the CTAB method was used to extract the genomic DNA. The Illumina SNP Genotyping technology test platform (Beijing Boao Biotechnology Co., Ltd.) Bead Array technology was used to detect the Wheat 55 K SNP markers of the tested parents and RIL population, and the corresponding KASP markers of the control genes of important traits of wheat, including Rht-B1 、 Rht-D1 and TaGW2-6A , were integrated into the polymorphic markers. After filtering and screening the genotypes of all polymorphic markers, 7974 polymorphic SNP markers were obtained, 1546 SNPs were obtained after redundancy removal, and finally a genetic linkage map covering 21 chromosomes of wheat with a length of 3574.10 cM was constructed. The upper graph was marked with 1440 SNPs, and the average genetic distance between markers was 2.58 cM. MapChart 2.3 (https: / / www.wur.nl / en / show / Mapchart.htm) was used to draw the genetic map of each chromosome. Inclusive composite interval mapping (ICIM) was used to detect QTLs significantly related to the content of trace elements in wheat grains, and the LOD threshold was set to 2.5. The genetic positions of the peaks detected on a chromosome were less than 10 cM apart, which were considered to be the same. The flanking marker sequences of the QTLs located in this study and the flanking marker sequences of similar sites reported in the past were compared with the Chinese Spring reference genome sequence in the EnsemblPlants database (http: / / plants.ensembl.org / ) to determine the novelty of the QTL sites located in this study.

[0059] 1.5 KASP marker development and detection

[0060] According to the QTL positioning results, KASP markers (PolyMarker, http: / / polymarker.tgac.ac.uk / ) were developed for the flanking SNP sequences of the major loci, two SNP-specific primers (SEQ ID NO. 1 / SEQ ID NO. 2) and one universal primer (SEQ ID NO. 3) were designed for each marker, and a specific sequence capable of binding to FAM fluorescence was added to the tail of F1, and a specific sequence capable of binding to HEX fluorescence was added to the tail of F2. Polymarker (http: / / www.polymarker.info / ) was used to design KASP primers, which were synthesized by Beijing Jiacheng Biotechnology Co., Ltd. The developed KASP markers were used for PCR detection of the original 151 RIL populations and 149 wheat lines, PCR reactions were performed on an ABI Veriti384 PCR instrument (Thermo Fisher), and the Omega F SNP genotyping detector (LGC Genomics Ltd, KBS-0024-002) was used to scan and read the fluorescence values of the PCR amplification products. Kluster CallerTM (KBioscience) was used for genotyping, and the genotypes of the SNP markers were determined according to the analysis results.

[0061] 2. Results

[0062] One QTL related to selenium and iron content was detected, located on chromosome 2D, QFe.yaas-2D which can be detected in a one-year environment, and the enhancing allele variation comes from Yangmai 4, with a phenotypic contribution rate of 8.04%. QSe.yaas-2D which can be detected in a two-year environment and average value, and the enhancing allele variation comes from Yangmai 4, with a phenotypic contribution rate of 11.52-20.11% (Table 1, Figure 1 ).

[0063] Table 1 Information of QTL related to selenium and iron content

[0064]

[0065] After alignment, it was found that the site was a new selenium (iron) content related site. Further using the flanking sequence information of the site, downloading its flanking sequence SEQ ID No. 4: ACCTCGCCTGTAGCACGTCACTGTCGAGATGCGAC[A / G]GGAAGAATATGATGTTTCCCCTTCGTTTCTTGTCC, using Polymarker (http: / / polymarker.tgac.ac.uk / ) to design KASP primer, the primer was synthesized by Beijing Ji Cheng Biological Technology Co., Ltd., and finally the flanking sequence was successfully converted into KASP marker KASP-QSe(Fe)-2D , and the corresponding variation site is C / T, which is the reverse complement of [A / G] at position 36 in the nucleotide sequence shown in SEQ ID No. 4.

[0066] This embodiment designs KASP-QSe(Fe)-2D a primer set, which includes a nucleotide sequence of an upstream primer as shown in SEQ ID No. 1, a nucleotide sequence of another upstream primer as shown in SEQ ID No. 2, and a nucleotide sequence of a common downstream primer as shown in SEQ ID No. 3. At the same time, the 5' end of the upstream primer SEQ ID No. 1 is connected with a fluorescent label sequence FAM, and the 5' end of the other upstream primer SEQ ID No. 2 is connected with a fluorescent label sequence HEX. The 3' end of the upstream primer is the allelic variation base C / T of the site, and the downstream primer ensures the 2D chromosome specificity of PCR amplification. The primer sequences are shown in Table 2.

[0067] Table 2 QSe(Fe).yaas-2D KASP molecular marker primer information of the interval

[0068]

[0069] Note: The underlined part is the linker sequence FAM and HEX.

[0070] Preparation of KASP marker primer working solution:

[0071] Take 12 μL (100 μM) of each of the upstream primers (nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2), take 30 μL (100 μM) of the downstream primer (nucleotide sequence as shown in SEQ ID No. 3), supplement with sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP marker primer working solution.

[0072] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (approximately 30 ng / μL), 0.08 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and then add sterile ultrapure water to 5 μL.

[0073] PCR reaction procedure: Step 1: pre-denaturation at 95°C for 15 min; Step 2: denaturation at 95°C for 20 s, followed by 60 s at 65–57°C (1°C decrease per cycle), for a total of 9 cycles; Step 3: denaturation at 95°C for 20 s, followed by annealing at 57°C for 1 min, for a total of 32 cycles; Storage at 10°C. Blank controls (NTCs) were also included in the experiment, with no template DNA added to the reaction system. One or more blank controls were included on each plate.

[0074] Wheat seedlings were taken and the genomic DNA of the wheat to be tested was extracted using the PVP-40 method.

[0075] Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the above-mentioned KASP primer set and PCR reagents to obtain PCR amplification products. The PCR reaction was performed on an S1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the PCR amplification products were scanned and read using a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength for FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength for VIC was 535 nm and the emission wavelength was 556 nm; the excitation wavelength for the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. KlusterCaller software (KBioscience) was used for genotyping, and the loci significantly associated with selenium / iron content were determined based on the analysis results. QSe (Fe).yaas-2D genotype.

[0076] 151 RIL populations and 149 wheat lines were amplified as described above. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis (blue) in the fluorescence signal coordinate system of the typing results, indicating that the genotype of these wheats at the 36th base (SNP site) of the nucleotide sequence flanking the SNP site (such as SEQ ID No. 4) was C; and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the Y-axis (red) in the coordinate system, indicating that the genotype of these wheats at the SNP site was T. KASP-QSe(Fe)-2D The typing results after amplification were the same as those of the original SNP. The KASP typing results of 149 wheat lines are shown in the attached figure.Figure 2 Selenium and iron content of 149 varieties in 2022 and QSe(Fe).yaas-2D The typing results are shown in Table 3.

[0077] Table 3 Selenium and iron content of 149 varieties and QSe(Fe).yaas-2D KASP typing results

[0078]

[0079] Table 4 Selenium and iron content of varieties with different genotypes of the locus QSe(Fe).yaas-2D t test results of selenium and iron content of varieties with different genotypes of the locus

[0080]

[0081] Table 4 is QSe(Fe).yaas-2D the comparison results of selenium and iron content of varieties with different genotypes of the locus, which is a two-sample t test using Excel 2019 data analysis. The results are shown in Table 4. Figure 3 The results show that under the experimental conditions in 2022, the selenium and iron content of the variety with genotype C (Yangmai No. 4) is 30.65% higher than that of the variety with genotype T (Yanzhan No. 1), and the t test result QSe(Fe).yaas-2D = 0.000156, which is significantly different at the level of P <0.01, indicating that the selenium and iron content of wheat with allele C (Yangmai No. 4) is higher than that of wheat with allele T (Yanzhan No. 1). P <0.01 level, indicating that the selenium and iron content of wheat with allele C is higher than that of wheat with allele T. P <0.01 level, indicating that the selenium and iron content of wheat with allele C is higher than that of wheat with allele T. P <0.01 level, indicating that the selenium and iron content of wheat with allele C is higher than that of wheat with allele T.

[0082] At the same time, it is shown that the primer set and genotype detection system of the KASP marker KASP-QSe(Fe)-2D can be applied to molecular marker assisted selection breeding of wheat grain selenium and iron content.

[0083] From the above experimental results, it can be concluded that by using the primer set of the application to amplify the wheat genomic DNA by PCR, the genotype at the locus can be directly detected by KASP, the detection method is simple to operate, the detection result is very intuitive, and the detection effect is obvious and effective. Using this molecular marker for screening can greatly improve the efficiency of molecular marker assisted selection of wheat breeding for high and low selenium (iron) content of wheat grain.

[0084] The preferred embodiments of the present application are described in detail above, but the present application is not limited to the specific details of the above-described embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.

[0085] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined in any appropriate manner without contradiction, and in order to avoid unnecessary repetition, the present application will not further describe various possible combinations.

[0086] In addition, various different embodiments of the present application can also be combined in any manner, as long as it does not deviate from the idea of the present application, and it should also be considered as disclosed by the present application.

Claims

1. Use of a primer set for detecting molecular markers for the QTL QSe(Fe).yaas-2D for selenium and iron content in wheat grains in any of the following: (A) Identify or assist in identifying wheat grain selenium and iron content traits; (B) Comparison of selenium and iron content in the tested wheat grains; (C) Breeding or screening wheat plants, lines, strains, or varieties with relatively high selenium and iron content in wheat grains; (D) Breeding or screening wheat plants, lines, strains, or varieties with relatively low selenium and iron content in wheat grains; (E) preparing a product for comparing the selenium and iron contents of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high selenium and iron content in wheat grains; (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively low selenium and iron content in wheat grains; The molecular marker is a KASP molecular marker with a nucleotide sequence as shown in SEQ ID No.

4. The selenium and iron contents of wheat grains to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the genome is homozygous for G, are higher than the selenium and iron contents of wheat grains to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the genome is homozygous for A or a heterozygous for A and G. The primer set for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No. 4 is GG, AA or AG, consists of the upstream primers shown in SEQ ID No. 1 and SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

2. Use any of the following methods: Method A: A method for comparing the selenium and iron contents of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome is GG, AA, or AG; (A2) determining the selenium and iron contents of the wheat grains to be tested as follows: the selenium and iron contents of the wheat grains to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is G, are higher than the selenium and iron contents of the wheat grains to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome is A, or is a heterozygote of A and G; Method B: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively high selenium and iron content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome is GG, AA, or AG; (B2) selecting a wheat plant to be tested that is homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome as a parent for breeding, and selecting wheat plants that are homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or cultivars having relatively high selenium and iron contents in their grains; Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low selenium and iron content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D in the wheat genome is GG, AA, or AG; (C2) selecting a wheat plant to be tested that is homozygous for the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome as A as a parent for breeding, and selecting wheat plants that are homozygous for the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 2D of the genome as A in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties with relatively low selenium and iron contents in the grains; The primer set for detecting whether the allele variation at position 36 in the nucleotide sequence shown in SEQ ID No. 4 is GG, AA or AG consists of the upstream primers shown in SEQ ID No. 1 and SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

3. Application of the method according to claim 2 in molecular marker-assisted breeding of selenium and iron content in wheat grains.

Images