Functional marker for muskmelon gummy stem blight resistance identification and application thereof

Abstract

The invention discloses a functional marker for muskmelon gummy stem blight resistance identification, and belongs to the technical field of molecular marker-assisted breeding. The marker is located in a CDS region of a muskmelon gummy stem blight resistance gene, belongs to an InDel molecular marker, has a nucleotide sequence as shown in SEQ ID NO: 1, has a total of 197 bp, and has a 9bp base insertion sequence difference with a susceptible material. The invention also discloses a method for identifying resistance of muskmelon gummy stem blight by using the functional marker. The method can be used for identifying muskmelon gummy stem blight resistant germplasm materials, and has important application value in muskmelon gummy stem blight resistant breeding and functional marker-assisted selection.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to a functional marker for identification of resistance to melon vine blight and an application thereof. Background Art

[0002] melon( Cucumis melo L . ) is an annual climbing herb of the Cucurbitaceae family Cucumis sativus species. China is one of the secondary origins of melons, with a long history of melon cultivation and a huge consumer market. Gummy stemblight (GSB) is one of the main diseases of melons. In recent years, the disease has become increasingly serious, seriously affecting the yield and quality of melons, and restricting the healthy development of the melon industry. At present, chemical agents are mainly used to control melon stemblight, but in high temperature and high humidity areas, chemical agents cannot effectively control the disease when the disease is serious, and chemical control causes great pollution to the environment and is costly. Using melon varieties with resistance to stem blight is the most economical and effective measure to prevent and control stem blight. Therefore, it is particularly important to breed high-quality disease-resistant melon varieties.

[0003] Conventional breeding of varieties resistant to vine blight requires artificial creation of disease conditions to complete the identification of resistance traits, and then hybridization and backcrossing are carried out. Due to the cumbersome identification and evaluation and the time-consuming process, the efficiency of resistance breeding is low. Molecular marker-assisted selection (MAS) technology uses molecular markers closely linked to resistance genes or specific primers of corresponding genes for marker-assisted selection breeding to improve the efficiency of disease-resistant selection and accelerate the breeding process of resistant varieties. At present, the widely used molecular marker technologies mainly include InDel (insertion-deletion) markers, KASP (kompetitive allele specific PCR) markers and CAPS (cleaved amplified polymorphic sequences) molecular markers.

[0004] According to the physical distance between the molecular marker and the target gene on the genome, molecular markers can be divided into linkage markers, co-segregation markers and functional markers. Linkage markers and target genes show a linkage-segregation relationship. They are physically far away from the target gene, and the linkage relationship is easily interrupted, resulting in inaccurate assisted selection. Co-segregation markers are genetically co-segregated with the target gene and are relatively close to the target gene physically, but they are not the target gene. In a large segregated population, the co-segregation relationship between the marker and the target gene may also be interrupted, resulting in inaccurate selection. Functional markers refer to markers developed based on allele sequence differences. They are located inside the gene and can directly select the target gene. Therefore, the selection accuracy is the highest. Summary of the invention

[0005] In view of the problems that phenotypic identification in melon vine blight resistance breeding is easily affected by the environment and the selection of disease-resistant materials is time-consuming and labor-intensive, the present invention provides a functional marker and method for identifying melon vine blight resistance.

[0006] The disease-resistant material 'R63' carries a dominant gene for resistance to vine blight, but the gene has not yet been cloned. Based on this, the applicant used 'R63' and the susceptible material 'S49' to construct a RIL population, and used high-throughput sequencing technology, combined with BSA and fine positioning, to clone the melon vine blight resistance gene, and annotated the gene as a WRKY transcription factor. The gene is 1575bp long and contains a complete open reading frame (ORF). In the disease-resistant material 'R63', when the virus-induced gene silencing (VIGS) technology was used to silence the gene, it was found that the disease-resistant material showed susceptible disease, which preliminarily proved that the gene is a resistance gene for melon vine blight. At present, the applicant is conducting stable overexpression experiments and further functional verification analysis.

[0007] One of the purposes of the present invention is to use the discovered WRKY resistance gene to provide a functional marker for identifying melon vine blight resistance. The marker is located in the CDS region of the WRKY resistance gene and is an InDel molecular marker. Its nucleotide sequence is shown in SEQ ID NO.1, with a total of 197 bp. The marker is named WRKY-197. Within the marker sequence, a 9 bp base insertion mutation occurred in the susceptible parent relative to the resistant parent. Specifically, the InDel molecular marker is a marker within the sequence of the melon vine blight resistance gene, which can be directly used for auxiliary selection of melon vine blight resistance breeding. The marker can be used to effectively distinguish the vine blight resistance of strains in a segregated population, thereby providing an efficient genetic tool for molecular breeding of disease-resistant melons.

[0008] The second object of the present invention is to provide a primer for amplifying the functional marker, which includes an upstream primer and a downstream primer, and its nucleotide sequence is shown as SEQ ID NO.2 and SEQ ID NO.3. The primer can be used to directly identify the resistance of melon germplasm to vine blight.

[0009] The third object of the present invention is to provide the application of the functional marker or its primer in the identification of melon vine blight resistance phenotype and variety breeding.

[0010] A fourth object of the present invention is to provide a kit for identifying the phenotype of melon vine blight resistance and breeding varieties, wherein the kit comprises the primers.

[0011] A fifth object of the present invention is to provide a method for identifying the phenotype of melon vine blight resistance and breeding the varieties, the method comprising the following steps: (1) Extracting genomic DNA from melon; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification using the primers described above; (3) The amplified product of step (2) is subjected to gel electrophoresis to identify the resistance to melon vine blight based on the size of the bands.

[0012] The PCR amplification system is 0.4 µL upstream and downstream primers (10 µmol / L), 1 µL DNA template (50-150 ng / µL), 2 × TaqMasterMix (DyePlus) 5 µL, and ddH2O is added to 10 µL.

[0013] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, a total of 34 cycles, final extension at 72°C for 10 min, and the product was stored at 4°C.

[0014] Specifically, the banding pattern of the PCR amplification product was recorded, and the resistance to melon vine blight was determined based on the fragment size. The judgment principle was as follows: (1) The band sizes amplified by the molecular marker primers in the resistant parent and the susceptible parent were significantly different; (2) When the molecular marker primer is used to amplify melon germplasm, if a specific band of the same size as that of the disease-resistant parent appears, that is, a fragment of 197 bp is amplified, then the strain is disease-resistant; (3) When the molecular marker primers are used to amplify melon germplasm, if only a specific band of the same size as that of the susceptible parent appears, that is, a fragment of 206 bp is amplified, then the strain is susceptible.

[0015] The beneficial effects of the present invention are: The present invention uses BSA and fine positioning methods to locate and clone the vine blight resistance gene CmWRKY ,according to CmWRKY Based on the sequence differences between the resistant and susceptible parents, a new functional marker of the melon vine blight resistance gene was developed, which can effectively distinguish the resistance phenotype of melon vine blight. At the same time, the marker is a functional marker, located inside the gene, and can directly select the target gene, thereby achieving accurate selection of the disease-resistant phenotype.

[0016] The identification result of the invention is accurate and reliable, and can be used for the early screening of melon vine blight-resistant germplasm, shortening the breeding period, and improving breeding efficiency. It also has the advantages of convenient and rapid detection and is not affected by environmental factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1It is a sequence alignment diagram of the insertion mutation of the susceptible parent 'S49' compared to the resistant parent 'R63' in the present invention.

[0018] Figure 2 It is the result of PCR amplification of molecular marker primers in RIL population; Marker, melon vine blight resistant parent 'R63', melon vine blight susceptible parent 'S49' and RIL population that completed phenotypic identification are marked respectively. The bands of RIL single plant with resistant phenotype are consistent with those of resistant parents; the bands of RIL single plant with susceptible phenotype are consistent with those of susceptible parents. Among them, R represents single plant with resistant phenotype, and S represents single plant with susceptible phenotype.

[0019] Figure 3 It is a phenotypic diagram of RIL disease-resistant and susceptible plants. Among them, R represents a plant with a phenotype of disease resistance, and S represents a plant with a phenotype of disease sensitivity. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with specific examples. The following examples are only illustrative of the present invention, but not limiting. The various experimental operations involved in the examples are routine operations in the art that are not described in detail. For parts not specifically described in the text, ordinary technicians in the art can refer to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. to implement them. In this study, the disease-resistant parent 'R63' is a germplasm resource introduced from abroad, and the disease-susceptible parent 'S49' is a domestic local variety, which is currently stored in the College of Horticulture and Forestry of Huazhong Agricultural University and can be provided to the outside.

[0021] Example 1 Based on the melon vine blight resistance gene CmWRKY Developing molecular markers based on sequence differences in susceptible materials This example provides a functional marker for identifying resistance to melon vine blight. The primer sequences of the marker are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0022] Forward primer: 5'-GTCACCAGGTATCTTCAAGAA-3' (SEQ ID NO. 2) Reverse primer: 5'-AAGGTAGAAAGAGCTCGAGA-3' (SEQ ID NO. 3) The primers are designed as follows: PCR amplification of the resistant parent (the resistant parent is the wild melon species 'R63', and the susceptible parent is 'S49') CmWRKY The full-length sequence was sequenced. CmWRKYThe appropriate InDel site was selected based on the sequence difference of the gene in the resistant and susceptible materials. The base sequence containing 200 bp before and after the InDel site was selected. Primers were designed using the Primer3 online website (https: / / primer3.ut.ee / ). The primer length was 20-24 bp, the PCR product size was 100-200 bp, and the Tm value was 52-57℃.

[0023] In this study, a 9bp base insertion mutation occurred in the susceptible parent relative to the resistant parent at the InDel site.

[0024] Functional marker sequence of disease-resistant parent: >R63 GTCACCAGGTATCTTCAAGAAACGGCGTCACAGCCCAATCGGTAAAAGCGTTTGATTCCTCGACACTTTTTTTTCTTTAACTCTTTTGGGAAACGACACCCACGCTGGCGTCGGCGACCATAGGGTGCGGGTGACGGTGATCGCCCTCGTAGGTTACGAGGAGCATCGTTGGATCGTCTCGAGCTCTTTCTACCTT Functional marker sequence of susceptible parent: >S49 GTCACCAGGTATCTTCAAGAAACGGCGTCACAGCCCAATCGGTAAAAGCGTTTGATTCCTCGACACTTTTTCTTTTCTTTTTTTCTTTAACTCTTTTGGGAAACGACACCCACGCTGGCGTCGGCGACCATAGGGTGCGGGTGACGGTGATCGCCCTCGTAGGTTACGAGGAGCATCGTTGGATCGTCTCGAGCTCTTTCTCACCTT Example 2 Screening of melon vine blight-resistant germplasm resources using functional markers The molecular markers in Example 1 were used to screen for melon germplasm with resistance to vine blight. The specific implementation method was as follows: 1. PCR amplification and electrophoresis detection (1) Extract genomic DNA of the sample to be tested by CTAB method; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the molecular marker primers in Example 1. PCR amplification system: 0.4 µL upstream and downstream primers (10 µmol / L), 1 µL DNA template (50-150 ng / µL), 5 µL 2 × TaqMasterMix (DyePlus), and ddH2O to make up to 10 µL. The PCR reaction program was: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 60 s, a total of 34 cycles, 72°C final extension for 10 min, and the PCR product was stored at 4°C. The amplified product was detected by electrophoresis using 8% polyacrylamide gel, with a voltage of 200 V, a current of 200 mA, a power of 36 W, an electrophoresis time of 80 min, and finally silver staining for color development. 8% polyacrylamide gel formula: 24 mL 30% Acr-Bis (acrylamide-methylene bisacrylamide), 16 mL 5×TBE, 800 µL 10% APS (ammonium persulfate), 64 µL coagulant TEMED, and ultrapure water to 80 mL.

[0025] 2. RIL Group Construction The melon vine blight susceptible material 'S49' is an excellent local melon variety in my country, with thin skin, thick flesh, fine texture, high sugar content, good flavor, but poor disease resistance; the resistant material 'R63' is a wild melon variety, with small fruits, sour flavor, low edible value, but carries the vine blight resistance gene CmWRKY , which is a high-quality germplasm resource resistant to vine blight. In the early stage of the study, a recombinant inbred line population was obtained. The population was constructed as follows: high-generation inbred lines 'S49' and 'R63' were used as the female and male parents, respectively, and then self-pollinated to obtain the F2 generation. The single-son propagation method was used to self-pollinate the F2 generation to produce strains. Each strain retained one single plant, and self-pollinated for 7 consecutive generations, and finally a genetically stable RIL population containing 118 strains was obtained.

[0026] 3. Identification of resistance to vine blight based on individual plant phenotypes of RIL populations In order to verify the accuracy of the developed functional marker in identifying the melon vine blight resistance phenotype, the marker was verified by population analysis using the constructed RIL population. Figure 1 It shows that in this population, all strains phenotypically identified as resistant have the same genotype as the resistant parent, that is, a fragment of 197 bp appears, and all strains phenotypically identified as susceptible have the same genotype as the susceptible parent, that is, a fragment of 206 bp appears. This population is a RIL population, and this result shows that the functional marker can distinguish between resistant and susceptible materials, and is specific for the melon vine blight resistance gene. CmWRKYThe functional markers screened by the present invention can be used to assist in the screening of resistant and susceptible melon seedlings, which will overcome the shortcomings of conventional disease-resistant breeding, simplify the phenotypic identification method, and provide a genetic tool for functional marker-assisted breeding of vine blight resistance, which will further accelerate the process of breeding vine blight-resistant varieties.

Claims

1. A functional marker for identification of melon vine blight resistance, the marker is located in the CDS region of the melon vine blight resistance gene, belongs to the InDel molecular marker, and is characterized by: The nucleotide sequence of the functional marker is shown in SEQ ID NO: 1, which is 197 bp in total and has a 9 bp base insertion sequence difference from the susceptible material.

2. A primer for amplifying the functional marker according to claim 1, characterized in that: The primers consist of an upstream primer and a downstream primer, and the nucleotide sequences thereof are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. Use of the functional marker according to claim 1 or the primer according to claim 2 in identification of resistance to melon vine blight.

4. A kit for identifying resistance to melon vine blight, comprising the primers according to claim 2.

5. A method for identifying resistance to melon vine blight, characterized in that The following steps are involved: (1) Extracting genomic DNA from the sample to be tested; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification using the primers described in claim 2; (3) Performing electrophoresis on the amplified product of step (2) and identifying the resistance to melon vine blight based on the size of the bands.

6. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: The PCR amplification system is as follows: 0.4 µL of 10 µmol / L upstream and downstream primers, 1 µL of 50-150 ng / µL DNA template, 5 µL of 2×TaqMasterMix, and ddH2O to make up to 10 µL.

7. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, a total of 34 cycles, final extension at 72°C for 10 min, and storage at 4°C.

8. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: In step (3), if a specific band of the same size as that of the disease-resistant parent appears, that is, a fragment of 197 bp is amplified, the phenotype of the melon plant is disease-resistant; if only a specific band of the same size as that of the susceptible parent appears, that is, a fragment of 206 bp is amplified, the phenotype of the melon plant is susceptible.

Images