Development of DTT-mediated CRISPR / Cas12a system and HPV detection application

Abstract

The invention relates to the technical field of biological detection, in particular to development of a DTT-mediated CRISPR / Cas12a system and HPV (human papillomavirus) detection application. The DTT-mediated CRISPR / Cas12a system is constructed, the PAM-sequence-free nucleic acid is targeted, the nucleic acid detection range of the CRISPR / Cas12a system is remarkably expanded, and meanwhile the analysis sensitivity and specificity of the CRISPR / Cas12a system are improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a new method for rapid detection of HPV. Background Art

[0002] The clustered regularly interspaced short palindromic repeats (CRISPR) system is an adaptive immune system of prokaryotes. The CRISPR system is mainly composed of Cas proteins and crRNA. The Cas protein is a crRNA-guided nuclease that guides its binding to an activator, thereby activating the nuclease activity of Cas12a. Typically, the target sequence is amplified by polymerase chain reaction or isothermal amplification analysis to activate Cas12 or Cas13 family proteins for trans-cleavage of reporter probes. With the increasing demand for the flexibility and practicality of CRISPR / Cas tools, CRISPR-based technologies are expanding. crRNA-guided target dsDNA hybridization is initiated by PAM sequence recognition, which facilitates target DNA double-stranded unwinding, strand invasion of crRNA in target dsDNA, and R-loop formation. In target dsDNA detection, CRISPR-Cas requires PAM recognition, and this requirement limits the ability of CRISPR / Cas to target any sequence. The low frequency of PAM motifs in the human genome limits the universality of CRISPR / Cas. Therefore, it is crucial to break through the dependence on PAM sequences.

[0003] ssDNA can activate the DNA enzyme activity of Cas in a PAM-independent manner. Current studies have used enzymatic digestion and asymmetric primer extension amplification to produce ssDNA activators. However, these PAM-independent assays and strategies that introduce more enzymes are costly, complex, and time-consuming, and sacrifice the specificity of CRISPR / Cas. In addition, more studies focus on introducing additional PAM sites upstream of the recognition fragment. Although the PAM requirements are relaxed, these methods require strict primer design and are prone to false positive results. A promising approach is to find PAM-free Cas nucleases through protein engineering. However, this method is technically complex and difficult to achieve, and the engineered proteins prolong the time of target recognition and increase the risk of off-target.

[0004] To solve the above problems, the present invention provides a DTT-mediated CRISPR / Cas12a system development and HPV detection application, adding DTT to the CRISPR / Cas12a and crRNA systems to promote CRISPR / Cas12a / crRNA targeting of PAM-free targets and activate the exonuclease activity of CRISPR / Cas12a. By utilizing the trans-cleavage activity of CRISPR / Cas12a, real-time fluorescence detection of PAM-free sequence nucleic acid targets in biological samples is achieved, greatly improving the scope of DNA detection in biological samples. By integrating DTT with the CRISPR-Cas12a system, a more powerful CRISPR / Cas12a detection system has been developed, which is further applied to the ultrasensitive detection of HPV viral nucleic acids in clinical samples, proving the practical application potential of the detection method of the present invention. Summary of the invention

[0005] The purpose of the present invention is to provide a DTT-mediated CRISPR / Cas12a system for development and HPV detection application, aiming to expand the detection range of the CRISPR / Cas12a system in the prior art, break through the PAM dependence on double-stranded deoxyribonucleic acid recognition, and develop a new CRISPR / Cas detection system by integrating DTT with CRISPR / Cas12a and crRNA systems, which can be applied to the amplification detection of HPV viruses.

[0006] The development of the DTT-mediated CRISPR / Cas12a system of the present invention, wherein the detection system comprises:

[0007] Providing a CRISPR / Cas system, wherein the CRISPR / Cas system includes a CRISPR / Cas12a reaction system and a ssDNA probe;

[0008] The CRISPR / Cas12a reaction system includes Cas12a protein, crRNA and DTT;

[0009] Providing a crRNA targeting an HPV sample to be detected, wherein the crRNA comprises a universal sequence and a recognition sequence, wherein the recognition sequence is complementary to a sequence of the HPV sample to be detected;

[0010] The two ends of the ssDNA probe are modified with 6-carboxyfluorescein (HEX) and a quencher (BHQ1) respectively.

[0011] In a second aspect, the present invention also provides a novel method for detecting HPV using CRISPR / Cas mediated by DTT, wherein the detection method is specifically as follows:

[0012] The DTT is mixed with crRNA and CRISPR / Cas protein in a buffer to prepare a premixed reaction solution;

[0013] The HPV sample is amplified by PCR, and then the amplicon is premixed with the above-mentioned DTT, crRNA and Cas protein in a reaction solution, and then an ssDNA probe is added for real-time fluorescence detection.

[0014] The real-time fluorescence detection is to place the reaction system in a real-time fluorescence quantitative PCR instrument to measure the fluorescence signal.

[0015] In summary, this study proposed a new DTT-mediated CRISPR / Cas detection method for a CRISPR molecular diagnostic platform without PAM nucleic acid sequences, and proposed a universal and highly sensitive nucleic acid detection method, which has great clinical application potential in the detection of HPV virus.

[0016] Compared with the prior art solutions, the present invention has the following beneficial effects:

[0017] 1) The new DTT-mediated CRISPR / Cas detection method detects PAM-free targets in biological samples and accurately identifies target DNA complementary to the crRNA sequence in the environment, thus improving the accuracy and sensitivity of the detection.

[0018] 2) The present invention can detect target double-stranded DNA without PAM, breaking through the sequence restriction that the target double-stranded DNA must contain TTTX, and expanding the detection range of CRISPR / Cas12a.

[0019] 3) The present invention can be combined with amplification methods such as RPA and PCR. When applied to amplification methods, it can not only improve the accuracy of sample processing, but also improve the reliability of results. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present invention is further described below with reference to the accompanying drawings and specific embodiments:

[0021] Figure 1 : The DTT-mediated CRISPR / Cas system described in the embodiments of the present invention shows a feasibility diagram of the trans-cleavage activity of three PAM-free DNA targets, T790M, HPV16, and HPV18, at low nucleic acid concentrations of 0.1 nM and high nucleic acid concentrations of 1 nM.

[0022] Figure 2 : The DTT-mediated CRISPR / Cas system described in the embodiment of the present invention is combined with PCR to detect the sensitivity analysis of different concentrations of PAM-free DNA targets in HPV16.

[0023] Figure 3: The DTT-mediated CRISPR / Cas system described in the embodiment of the present invention is combined with PCR to detect the sensitivity analysis of different concentrations of PAM-free DNA targets in HPV18.

[0024] Figure 4 : The embodiment of the present invention enables the detection of HPV16 virus in 26 clinical samples.

[0025] Figure 5 : The embodiment of the present invention enables the detection of HPV18 virus in 26 clinical samples.

[0026] Figure 6 : ROC curve analysis of detection accuracy in the clinical application described in the embodiment of the present invention.

[0027] Figure 7 : Detection principle diagram described in an embodiment of the present invention. DETAILED DESCRIPTION

[0028] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0030] A novel DTT-mediated CRISPR / LbCas12a detection method of an embodiment of the present invention is characterized in that the LbCas12a protein is first combined with a synthetic crRNA, and under the action of DTT, the specific sequence on the crRNA recognizes and combines with any HPV sequence without a PAM target in a biological sample to form a LbCas12a protein / crRNA / target DNA ternary complex; ssDNA is a small molecule with different labels at both ends, which stimulates the exonuclease activity of the LbCas12a protein, cuts the ssDNA probes labeled at both ends, and generates a fluorescent signal.

[0031] In this embodiment, unless otherwise specified, all methods are conventional, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels. Specifically, the steps are as follows:

[0032] (1) Prepare instruments / reagents / samples

[0033] Instrument: Fluorescence quantitative PCR detector.

[0034] Reagents: including ssDNA probe, crRNA, LbCas12a protein, DTT, buffer.

[0035] Samples: include synthesized nucleic acid plasmids and DNA from biological samples to be tested.

[0036] (2) Preparation of crRNA:

[0037] After synthesizing the crRNA of the specified sequence, HPLC purification was performed to obtain a dry powder state of the crRNA. After centrifugation at 10,000 rpm for 2 minutes, the corresponding volume of nuclease-free water was added according to the number of nmol per OD, and the mixture was allowed to stand at room temperature for 2 minutes. After vortex mixing and centrifugation, a 1 μM crRNA working solution was prepared and placed at -20°C for later use.

[0038] (3) Preparation of ssDNA probe:

[0039] After ssDNA probes were labeled with different small molecules at both ends, they were purified by HPLC to obtain dry powder. After centrifugation at 10,000 rpm for 2 minutes, a corresponding volume of nuclease-free water was added according to the nmol number of each OD, and the mixture was allowed to stand at room temperature for 2 minutes. After vortex mixing and centrifugation, a 1 μM ssDNA working solution was prepared and stored at -20°C for later use. The ssDNA probes were labeled with small molecules HEX at the 5' end and BHQ at the 3' end.

[0040] (4) Incubation of CRISPR / LbCas12a reaction system:

[0041] In the case of LbCas12a protein, crRNA, ssDNA, and DTT, different final concentrations of PAM-free plasmid DNA were added to the CRISPR / LbCas12a reaction system and incubated at 37°C for 30 minutes. Each concentration gradient DNA target and sample needed to be tested three times, and the reaction well without DNA target was used as a blank control.

[0042] (5) Detection of final fluorescence value:

[0043] The fluorescence signal of the final CRISPR reaction system in step S4 was measured for 60 minutes using a fluorescence quantitative PCR detector.

[0044] (6) Furthermore, in step S1, the buffer solution has a pH of 7.9 and includes 500 mM potassium acetate, 200 mM triacetic acid, and 100 mM magnesium acetate.

[0045] (7) Further, in step S3, the sequence of ssDNA is: 5'-6-HEX-TTATTTATTTAA-BHQ1 (SEQ ID NO.1). Further, in step S4, the final configured CRISPR / LbCas12a reaction system is: LbCas12a protein final concentration 20nM; crRNA final concentration 20nM. Depending on the content of the experiment, different concentration gradients or different categories of DNA targets are selected; the final concentration of ssDNA is 250nM.

[0046] (8) Configuration of PCR reaction system:

[0047] For a PCR system with a total volume of 50 μl, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 4 μL of dNTPs, 0.25 μL of Taq enzyme, 5 μL of buffer, 31.75 μL of DEPC H2O, and 5 μL of HPV 16 or HPV18 plasmid. The PCR system was first denatured at 95 °C for 5 minutes, then denatured at 95 °C for 10 seconds, annealed at 60 °C for 15 seconds, and extended at 72 °C for 30 seconds for 30 cycles. The final extension step was performed at 72 °C for 10 minutes. 5 μL of PCR product was added to the CRISPR / Cas12a system, which contained 0.4 μL of 1 μM Cas12a, 0.4 μL of 1 μM crRNA, 5 μL of 1 μM FQ reporter gene, 5.2 μL of DEPC H2O, 2 μL of DTT, and 2 μL of 10× reaction buffer, and the reaction was incubated at 37 °C for 30 minutes.

[0048] The following is a further explanation of a novel HPV detection method based on DTT-assisted CRISPR / LbCas12a of the present invention through specific examples:

[0049] Example 1

[0050] In order to verify the feasibility of the detection method of DTT combined with LbCas12a described in the present invention, fluorescence detection was performed using the detection system of the present invention.

[0051] Among them, the crRNA sequence targeting HPV16 is:

[0052] UAAUUUCUACUAAGUGUAGAUUAACCAUAGAACCACUAGGU(SEQ ID NO.2)

[0053] The crRNA sequence targeting HPV18 is:

[0054] UAAUUUCUACUAAGUGUAGAUACAAUAGAGCCACUUGGAGA(SEQ ID NO.3)

[0055] The crRNA sequence targeting T790M is:

[0056] UAAUUUCUACUAAGUGUAGAUGCAUGAGCUGCAUGAUGAGC(SEQ ID NO.4)

[0057] The target DNA used in this example is double-stranded DNA, and its target sequence information is as follows:

[0058] The HPV16-specific targeting sequence is as follows: 5′-GACATTTATTTAATAGGGCTGGTGCTGTTGGTGAAAATGTACCAGACGATTTATACATTAAAGGCTCTGGGTCTACTGCAAATTTAGCCAGTTCAAATTATTTTCCTACACCTAGTGGTTCTATGGTTACCTCTGATGCCCAAATATTCAATAAACCTTATTGGTTACAACGAGCACAGGGCCACAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTGTTGTTGATACTACACGCAGT ACAAATATGTCATTATGTGCTGCCATATCTACTTCAGAAACTACATATAAAAATACTAACTTTAAGGAGTACCTACGACATGGGGAGGAATATGATTTACAGTTTATTTTTCAACTGTGCAAAATAACCTT AACTGCAGACGTTATGACATACATACATTCTATGAATTCCACTATTTTGGAGGACTGGAATTTTGGTCTACAACCTCCCCCAGGAGGCACACTAGAAGATACTTATAGGTTTGTAACATCCCAGG-3'(SEQ ID NO.5)

[0059] The HPV18 specific targeting sequence is as follows: 5’-GAGCAGGTACTATGGGTGACACTGTGCCTCAATCCTTATATATTAAAGGCACAGGTATGCGTGCTTCACCTGGCAGCTGTGTGTATTCTCCCTCTCCAAGTGGCTCTATTGTTACCTCTGACTCCCAGTTGTTTAATAAACCATATTGGTTACATAAGGCACAGGGTCATAACAATGGTGTTTGCTGGCATAATCAATTATTTGTTACTGTGGTAGATACCACTCGCAGTACCAATTTAACAATATGTGCTTCTACACAGTCTCCTGTACCTGGGCAATATGATGCTACCAAATTTAAGCAGTATAGCAGACATGTTGAGGAATATGATTTGCAGTTTATTTTTCAGTTGTGTACTATTACTTTAACTGCAGATGTTATGTCCTATATTCATAGTATGAATAGCAGTATTTTAGAGGATTGGAACTTTGGTGTTCCCCCCCCGCCAACTACTAGTTTGGTGGATACATATCGTTTTGTACAATCTGTTGCTATTACCTGTC-3’ (SEQ ID NO.6)

[0060] T790M specific targeting sequence is as follows: 5'--3' (SEQ ID NO.7)

[0061] The LbCas12a protein, crRNA and three plasmids were mixed in a reaction buffer to prepare a reaction solution, and incubated at 37°C for 30 minutes. The reaction system formed a ternary complex, and then the ssDNA probe was added. The fluorescence was detected in real time at 37°C for 1 hour, and the signal was recorded every 30 seconds. The results are shown in Figure 1 Whether at low or high concentrations, T790M plasmids, HPV16 plasmids, and HPV18 plasmids without PAM sequences can only produce significant fluorescence signals after 60 minutes of CRISPR / LbCas12a trans-cleavage when DTT is added.

[0062] Example 2

[0063] The DTT-mediated CRISPR / LbCas12a system was combined with PCR to detect plasmids without PAM HPV16 and HPV18, and the minimum detection concentration was reduced. The PCR amplification primers and forward primer sequences used for HPV16 were: TTAAAGGCTCTGGGTCTACTGC (SEQ ID NO.8), and the reverse primer sequence was: TTTGGGCATCAGAGGTAACCA (SEQ ID NO.9); the primers used for HPV18, the forward primer sequence was: TCTCCCTCTCCAAGTGGCTC (SEQ ID NO.10), and the reverse primer sequence was: ATTGCCCAGGTACAGGAGACT (SEQ ID NO.11). The results are as follows Figure 2 , which shows that the DTT-mediated CRISPR / Cas12a system combined with PCR can detect 1aM of HPV16 nucleic acid target, such as Figure 3 It was demonstrated that the CRISPR / LbCas12a and DTT combined system combined with PCR can detect 1aM of HPV18 nucleic acid target with high sensitivity.

[0064] Example 3

[0065] This example detects 26 HPV16 and HPV18 samples. 26 cervical exfoliated cell samples were collected, and the nucleic acid extracts were first released by high-temperature lysis with cell lysis buffer, and the nucleic acid extracts of the samples were amplified by PCR. The reaction system included: 2μL 10μM forward primer, 2μL 10μM reverse primer, 4μL dNTPs, 0.25μL Taq enzyme, 5μL buffer, 31.75μL DEPC H2O and 5μL HPV 16 or HPV18 plasmid. The PCR system was first denatured at 95°C for 5 minutes, then denatured at 95°C for 10 seconds, annealed at 60°C for 15 seconds, and extended at 72°C for 30 seconds, and cycled 30 times. The final extension step was performed at 72°C for 10 minutes. 5 μL of PCR product was added to the CRISPR / LbCas12a system, which contained 0.4 μL 1 μM LbCas12a, 0.4 μL 1 μM crRNA, 5 μL 1 μM FQ reporter gene, 5.2 μL DEPC H2O, 2 μL DTT and 2 μL 10× reaction buffer, and the reaction was incubated at 37°C for 30 minutes. The fluorescence signal of the final CRISPR reaction system was measured for 60 minutes using a fluorescent quantitative PCR detector.

[0066] The HPV16 primer is the same as that in Example 2, and the HPV18 primer is the same as that in Example 3.

[0067] HPV16 sample test results are as follows Figure 4 , the HPV18 sample test results are as follows Figure 5 .

[0068] Example 4

[0069] This example performs ROC curve analysis on the detection accuracy of clinical applications, evaluates the diagnostic performance of a new method for HPV detection without PAM mediated by CRISPR / LbCas12a proposed in the present invention, and calculates the cutoff value based on the obtained ROC curve. The results are as follows: Figure 6 The ROC curve showed that the AUC (area under the curve) was 0.9500 for HPV16 and 0.8762 for HPV18, and the sensitivity and specificity for detecting HPV16 and HPV18 were 90.9% and 96.97%, respectively. These results show that the new detection method of the present invention is an effective molecular diagnostic toolkit that can be used for rapid and accurate detection, and its good discrimination ability shows its potential in clinical diagnosis.

[0070] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Development of a DTT-mediated CRISPR / Cas12a system and its application in HPV detection, characterized in that The Cas12a protein first binds to the synthetic crRNA. Under the action of DTT, the crRNA recognizes any PAM-free sequence on the target to form a ternary complex of Cas12a protein / crRNA / target; the exonuclease activity of the Cas12a protein is activated, the ssDNA fluorescent probe is cut, and a fluorescent signal is generated. The development of a DTT-mediated CRISPR / Cas12a system and the application of HPV detection specifically include the following steps: (1) Design and synthesize the crRNA sequence targeting the HPV target sequence to be detected. (2) DTT, crRNA and Cas protein are placed in a buffer and mixed to prepare a premixed reaction solution. (3) The HPV sample to be tested is amplified using a standard nucleic acid amplification procedure, and then the amplicon and ssDNA probe are added to the premixed reaction solution, and the fluorescence signal of the final reaction system is measured using a fluorescence quantitative PCR detector.

2. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: The Cas protein includes class 2 CRISPR system types V protein.

3. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: The end of the ssDNA probe is labeled with a fluorophore and a fluorescence quencher at the same time. The fluorophore includes any one of ROX, HEX, TexasRed, FAM, and SIMA; the fluorescence quencher includes any one of BHQ1, BHQ2, and TAMRA.

4. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: In the step (1), the crRNA includes a fixed sequence and a variable target sequence, which is at least 1-100 nt; the final concentration of the crRNA is 1 nM to 10 μM, and the final concentration of the Cas enzyme is 1 nM to 10 μM.

5. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: The final concentration of DTT in step (2) is 100 μM to 100 mM.

6. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: In the step (3), the nucleic acid amplification procedure includes polymerase chain reaction (PCR), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP) and rolling circle amplification (RCA).

7. The development of a DTT-mediated CRISPR / Cas12a system and HPV detection application as claimed in claim 1, characterized in that: The volume of the amplicon is 1 μL to 100 μL, the final concentration of the ssDNA probe is 1 nM to 10 μM, the reaction temperature or detection temperature is 1 to 100° C., and the detection time is at least 1 minute.

Images