MAPT siRNA and application thereof

Abstract

Provided herein are small interfering ribonucleic acid (siRNA) agents that target the microtubule associated protein tau (MAPT) gene, and compositions comprising such siRNA agents.

Description

[0001] 1. Related Applications please Cross references

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 320,684, filed on March 16, 2022, and U.S. Provisional Application No. 63 / 320,687, filed on March 16, 2022, each of which is incorporated herein by reference in its entirety. 2. Technical field

[0003] Provided herein are small interfering ribonucleic acid (siRNA) agents targeting the microtubule-associated protein tau (MAPT) gene and compositions comprising such siRNA agents. 3. Background technology

[0004] Tau is normally a soluble protein associated with microtubules in neurons, and its most well-characterized function is microtubule polymerization under physiological conditions. However, under pathological conditions, Tau is highly phosphorylated and dissociates from microtubules to form intracellular soluble oligomeric species and insoluble aggregates rich in β-sheet structures. Certain Tau assemblies can be released and delivered to neurons in anatomically connected areas to induce or "seed" native monomeric Tau to oligomerize into aggregates, thereby propagating Tau aggregates in a prion-like manner. At present, the molecular mechanisms by which Tau exerts its pathogenic effects in Alzheimer's disease are unclear. However, it is clear that the pathogenic effects of Tau involve a gain of toxic function exerted by small or large aggregated forms of Tau protein species.

[0005] There is a need for compounds and agents that inhibit expression of the MAPT gene, for example, to study Alzheimer's disease. 4. Summary of the invention

[0006] In one aspect, provided herein is a non-naturally occurring small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand forming a double-stranded region.

[0007] In some embodiments, provided herein is a non-naturally occurring small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein: (a) the antisense strand comprises or consists of a nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences in Table 1; (b) the sense strand comprises or consists of a nucleotide sequence corresponding to any one of the sense strand nucleotide sequences in Table 1; or (c) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 1; and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense strand nucleotide sequence in the same row of Table 1.

[0008] In some embodiments, the antisense strand, sense strand or both of the siRNA reagents described herein include at least one modified nucleotide. In some embodiments, the antisense strand and sense strand of the siRNA reagents described herein each include three to twenty-three modified nucleotides. In some embodiments, the antisense strand of the siRNA reagents described herein includes all modified nucleotides. In some embodiments, the sense strand of the siRNA reagents described herein includes all modified nucleotides. In some embodiments, the antisense strand and sense strand of the siRNA reagents described herein each include all modified nucleotides. In a specific embodiment, the modified nucleotides are selected from the group consisting of nucleotides modified by 2'O-methyl, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, reverse abasic nucleotides, nucleotides comprising S-ethylene glycol nucleic acid (GNA), unlocked nucleic acids, 5'-vinylphosphonate-2'-O-methyl-uridine and combinations thereof.

[0009] In some embodiments, the antisense strand, sense strand, or both of the siRNA agents described herein comprise at least one modified internucleoside bond. In some embodiments, the antisense strand and sense strand of the siRNA agents described herein each comprise a modified internucleoside bond. In some embodiments, the antisense strand and sense strand of the siRNA agents described herein each comprise two to five modified internucleoside bonds. In some embodiments, the modified internucleoside bond is a phosphorothioate.

[0010] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein: (a) the antisense strand comprises a nucleotide sequence of any antisense strand nucleotide sequence in Table 2; (b) the sense strand comprises a nucleotide sequence of any sense strand nucleotide sequence in Table 2; or (c) the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 2, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row.

[0011] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein: (a) the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3; (b) the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3; or (c) the antisense strand comprises an antisense strand nucleotide sequence in a row in Table 3, and wherein the sense strand comprises a sense strand nucleotide sequence in the same row of Table 3.

[0012] In some embodiments, antisense strand, sense strand or both antisense strand and sense strand are conjugated with one or more lipophilic moieties.In some embodiments, one or more lipophilic moieties are conjugated with one or more terminal positions of siRNA reagents or the internal position of the double-stranded region of siRNA reagents.In some embodiments, one or more lipophilic moieties are conjugated by joints or carriers.In some embodiments, one or more lipophilic moieties are selected from the group consisting of cholesterol, L1, L2, L3, L4 (also referred to as "J2-CONC16U" herein), L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21 (also referred to as "J2-CONC16A" herein), L22 (also referred to as "J2-CONC16C" herein), L23 (also referred to as "J2-CONC16G" herein) and / or L24.

[0013] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein: (a) the antisense strand comprises a nucleotide sequence of any one of the antisense nucleotide sequences in Table 4; (b) the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4, wherein the sense strand is conjugated to cholesterol or a lipid moiety, as shown in Table 4 for the sense strand nucleotide sequence; or (c) the antisense strand comprises an antisense strand nucleotide sequence in a row in Table 4, and the sense strand comprises a sense strand in the same row in Table 4, wherein the sense strand is conjugated to cholesterol or a lipid, as shown in Table 4 for the sense strand nucleotide sequence.

[0014] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein: (a) the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5; (b) the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a cholesterol or lipid moiety, as shown in Table 5 for the sense strand nucleotide sequence; or (c) the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 5, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 5, and wherein the sense strand is conjugated to a cholesterol or lipid moiety, as shown in Table 5 for the sense strand.

[0015] In some embodiments, each strand of the siRNA agent is no more than 30 nucleotides in length. In some embodiments, each strand of the siRNA agent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides in length.

[0016] In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least 1 nucleotide. In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least 2 nucleotides. In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least 3 nucleotides. In some embodiments, both strands of the siRNA agent comprise a 3' overhang of at least 1 or at least 2 nucleotides.

[0017] In some embodiments, the length of the double-stranded region of the siRNA agent is 15 to 19 nucleotides. In some embodiments, the length of the double-stranded region of the siRNA agent is 20 to 25 nucleotides. In some embodiments, the length of the double-stranded region of the siRNA agent is 15 to 25 nucleotides. In some embodiments, the length of the double-stranded region is 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0018] In some embodiments, the siRNA agents described herein comprise a targeting ligand.

[0019] In another aspect, provided herein is a cell containing a siRNA agent as described herein. In a specific embodiment, the cell is in vitro or ex vivo.

[0020] In another aspect, provided herein is a composition comprising a siRNA agent described herein and a carrier.

[0021] In one aspect, provided herein is a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein

[0022] (a) The sense strand comprises 21 nucleotides having the following sequence:

[0023] UGCAAAUAGUCUACAAACCAA, where starting from the 5′ end

[0024] (i) the nucleotides at one or more positions selected from 1-6, 8 and 12-21 are optionally modified with a 2′-O-methyl group;

[0025] (ii) the nucleotide at position 6 or 7 optionally comprises a lipophilic moiety;

[0026] (iii) the nucleotides at one or more positions selected from 7 and 9-11 are optionally 2′-deoxy-2′-fluoro-modified;

[0027] wherein the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5′ end linked to the nucleotide at position 1 and / or an inverted abasic nucleotide (InvAb) at the 3′ end linked to the nucleotide at position 21, and

[0028] wherein the sense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end;

[0029] and

[0030] (b) The antisense strand comprises 21 nucleotides having the following sequence:

[0031] UUGGNNNGUAGACUAUUUGCA, from the 5′ end

[0032] (i) the nucleotide N at position 5 is U or T; the nucleotide N at position 6 is U or T; and the nucleotide N at position 7 is U or T;

[0033] (ii) the nucleotide at position 1 is optionally modified with vinylphosphonate 2′-O-methyl or cis-cyclobutylphosphonate 2′-O-methyl;

[0034] (iii) the nucleotides at one or more positions selected from 2, 6, 8, 9, 14 and 16 are optionally 2′-deoxy-2′-fluorine modified;

[0035] (iv) the nucleotides at one or more positions selected from 1, 3-13, 15 and 17-21 are optionally modified with a 2′-O-methyl group;

[0036] (v) optionally, the nucleotide at one or more positions selected from 4 to 7 is a deoxynucleotide;

[0037] (vi) optionally, the nucleotide at position 7 is a 3′-O-methyl modified nucleotide, a (L)-α-threofuranosyl modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA) having a 2′-5′ linked phosphate;

[0038] wherein the antisense strand optionally further comprises two nucleotides CA linked to the nucleotide at position 21, such that the antisense strand comprises 23 nucleotides having the sequence UUGGNNNGUAGACUAUUUGCACA, wherein the nucleotide C at position 22 and / or the nucleotide A at position 23 are optionally modified with a 2′-O-methyl group, and

[0039] wherein the antisense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and

[0040] Wherein the base pair at position 1 at the 5' end of the antisense strand of the duplex is an AU base pair.

[0041] In some embodiments, in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at three or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at five or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, nucleotides at each of positions 1-5, 8, and 12-20 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at two or more positions selected from 7 and 9-11 are modified with 2'-deoxy-2' fluorine. In some embodiments, in the sense strand, nucleotides at each of positions 9-11 are modified with 2'-deoxy-2' fluorine. In yet other embodiments, in the sense strand, the nucleotide at position 6 is modified with 2′-O-methyl and the nucleotide at position 7 comprises a lipophilic moiety. In some embodiments, the lipophilic moiety is L4. In some embodiments, in the sense strand, the nucleotide at position 6 comprises a lipophilic moiety and the nucleotide at position 7 is modified with 2′-deoxy-2′ fluorine. In some embodiments, the lipophilic moiety is L21. In some embodiments, the sense strand further comprises an InvAb at the 5′ end connected to the nucleotide at position 1. In some other embodiments, the sense strand comprises two phosphorothioate bonds at both the 5′ end and the 3′ end.

[0042] In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 1, 3-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at three or more positions selected from 1, 3-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at five or more positions selected from 1, 3-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at each position in position 1, 3, 10-13, 15 and 17-21 are modified by 2'-O-methyl. In some other embodiments, in the antisense strand, nucleotides at two or more positions selected from 2, 6, 8, 9, 14 and 16 are modified by 2'-deoxy-2' fluorine. In some embodiments, in the antisense strand, the nucleotides at each of positions 2, 14, and 16 are modified by 2'-deoxy-2' fluorine. In some other embodiments, in the antisense strand, the nucleotides at positions 4 and 5 are each modified by 2'-O-methyl. In some embodiments, in the antisense strand, the nucleotide at position 4 is modified by 2'-O-methyl and the nucleotide at position 5 is a deoxy nucleotide. In some embodiments, in the antisense strand, the nucleotide at position 4 is a deoxy nucleotide and the nucleotide at position 5 is modified by 2'-O-methyl. In some embodiments, in the antisense strand, the nucleotides at positions 4, 5, and 7 are each modified by 2'-O-methyl, and the nucleotide at position 6 is modified by 2'-deoxy-2' fluorine. In some embodiments, in the antisense strand, the nucleotides at positions 8 and 9 are both modified by 2'-O-methyl, or are both modified by 2'-deoxy-2' fluorine. In some embodiments, the antisense strand comprises two phosphorothioate bonds at both the 5' end and the 3' end.

[0043] In some embodiments, the sense strand comprises nucleotides having a sequence of SEQ ID NO: 335, 339, 341, 507, 509, 511, 513, 515, 521, 527, 531, 533, or 567. In some embodiments, the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 336, 340, 342, 508, 510, 512, 514, 516, 522, 528, 532, 534, or 568.

[0044] In another aspect, the present invention provides an siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises 21 nucleotides having the following sequence: CAAGUCCAAGAUCGGCUCCAA, wherein from the 5′ end

[0045] (i) the nucleotides at one or more positions selected from 1-6, 8 and 12-21 are optionally modified with a 2′-O-methyl group;

[0046] (ii) the nucleotides at one or more positions selected from 9 to 11 are optionally 2′-deoxy-2′ fluorine-modified;

[0047] (iii) the nucleotide at position 7 optionally comprises a lipophilic moiety;

[0048] wherein the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5′ end linked to the nucleotide at position 1 and / or an inverted abasic nucleotide (InvAb) at the 3′ end linked to the nucleotide at position 21, and

[0049] wherein the sense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end;

[0050] and

[0051] (a) The antisense strand contains 21 nucleotides with the following sequence:

[0052] UUGGAGCCGAUCUUGGACUUG, where starting from the 5′ end

[0053] (i) the nucleotide at position 1 is optionally modified with vinylphosphonate 2′-O-methyl or cis-cyclobutylphosphonate 2′-O-methyl;

[0054] (ii) the nucleotides at one or more positions selected from 2, 14 and 16 are optionally 2′-deoxy-2′ fluorine-modified;

[0055] (iii) the nucleotides at one or more positions selected from 1, 3-6, 8-13, 15 and 17-21 are optionally modified with a 2′-O-methyl group;

[0056] (iv) optionally, the nucleotide at one or more positions selected from 4, 5 and 7 is a deoxynucleotide;

[0057] (v) optionally, the nucleotide at position 7 is a 3′-O-methyl modified nucleotide having a 2′-5′ linked phosphate, a (L)-α-threofuranosyl (3′-2′) modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA);

[0058] wherein the antisense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and

[0059] Wherein the base pair at position 1 at the 5' end of the antisense strand of the duplex is an AU base pair.

[0060] In some embodiments, in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, nucleotides at three or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at five or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, nucleotides at each position of positions 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at two or more positions selected from 9-11 are modified with 2'-deoxy-2' fluorine. In some other embodiments, in the sense strand, nucleotides at each position of positions 9-11 are modified with 2'-deoxy-2' fluorine. In some embodiments, in the sense strand, the nucleotide at position 7 comprises a lipophilic moiety L22. In some embodiments, the sense strand further comprises an InvAb at the 5′ end linked to the nucleotide at position 1 and at the 3′ end linked to the nucleotide at position 21. In some embodiments, the sense strand comprises two phosphorothioate bonds at both the 5′ end and the 3′ end.

[0061] In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 1, 3-6, 8-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at three or more positions selected from 1, 3-6, 8-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at five or more positions selected from 1, 3-6, 8-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at each position in position 1, 3, 6, 8-13, 15 and 17-21 are modified by 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 2, 14 and 16 are modified by 2'-deoxy-2' fluorine. In some embodiments, in the antisense strand, wherein in the antisense strand, the nucleotides at each of positions 2, 14, and 16 are modified by 2′-deoxy-2′ fluorine. In some embodiments, in the antisense strand, the nucleotides at positions 4 and 5 are each modified by 2′-O-methyl. In some embodiments, in the antisense strand, the nucleotide at position 4 is modified by 2′-O-methyl and the nucleotide at position 5 is a deoxynucleotide. In some embodiments, in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified by 2′-O-methyl. In some embodiments, the antisense strand comprises two phosphorothioate bonds at both the 5′ end and the 3′ end. In some embodiments, the sense strand comprises nucleotides having a sequence of SEQ ID NO: 333, 541, 547, 557, or 569. In some embodiments, the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 334, 542, 548, 558, or 570.

[0062] In one embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 333, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 334. In one embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 335, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 336. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 339, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 340. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 341, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 342. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 507, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 508. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 509, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 510. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 511, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 512. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 513, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 514. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 515, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 516. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 521, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 522.In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 527, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 528. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 531, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 532. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 533, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 534. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 541, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 542. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 547, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 548. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 557, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 558. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 567, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 568. In another embodiment, a siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex is provided, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 569, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 570.

[0063] On the other hand, a kind of compositions comprising the siRNA reagent and carrier of any one aspect or embodiment of this paper is provided herein.On the other hand, a kind of method of suppressing MAPT gene expression in cell or cell group is provided herein, the method comprises making cell or cell group contact with the siRNA of any one aspect or embodiment of this paper, or contact with the compositions of any one aspect or embodiment of this paper. 5. Description of the drawings

[0064] Figure 1 A to Figure 1 B shows the effect of cholesterol-siRNA conjugates on MAPT mRNA expression in human iPSC neurons. Figure 1 A depicts a graph showing knockdown of MAPT mRNA in human iPSC neurons by cholesterol-siRNA conjugates, and Figure 1 B provides a table showing the IC50 (95% CI confidence interval) of the same cholesterol-siRNA conjugates.

[0065] Figure 2 A to Figure 2 B shows the effect of lipid-siRNA conjugates on MAPT mRNA expression in human iPSC neurons. Figure 2 A depicts a graph showing knockdown of MAPT mRNA in human iPSC neurons by lipid-siRNA conjugates, and Figure 2 B provides IC showing the same lipid-siRNA conjugate 50 (95% CI confidence interval) table.

[0066] Figure 3 The chemical structures of the 3'-terminal and / or 5'-terminal lipid derivatives and the internal 2'-O-lipid derivatives are provided. The structure of Chol4 is also depicted.

[0067] Figure 4 A to Figure 4 D shows the effect of lipid-siRNA conjugates on MAPT mRNA and Tau protein expression in the brain of Tau mouse model hTAU KI mice. Figure 4 A to Figure 4 B depicts a graph showing human MAPT mRNA levels (expressed as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after lipid-siRNA conjugate injection. Figure 4 C to Figure 4 D depicts a graph showing human Tau protein levels (expressed as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at various time points following lipid-siRNA conjugate injection.

[0068] Figure 5 A to Figure 5 B shows the effects of different lipid-siRNA conjugates on MAPT mRNA expression in the brain of Tau mouse model hTAU KI mice. Figure 5 A to Figure 5 B depicts a graph showing human MAPT mRNA levels (expressed as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after injection of lipid-siRNA conjugates.

[0069] Figure 6 Demonstrated efficiency of MAPT lipid-siRNA conjugate in knocking down MAPT mRNA in human iPSC neurons. Figure 6 Depicted is a graph showing MAPT mRNA expression (expressed as % of vehicle control) in human iPSC neurons following 7 days of incubation with 1 μM and 250 nM MAPT lipid-siRNA conjugates. 6. Specific implementation methods

[0070] The siRNA agent of the present invention inhibits the expression of the MAPT gene. As used herein, the term "MAPT" gene (also referred to as MTBT1 gene, PPP1R103 gene, FTDP-17 gene, Tau-40 gene, MTBT2 gene, MAPTL gene, PPND gene, MSTD gene, Tau gene and microtubule-associated protein Tau gene) refers to a gene encoding a protein called microtubule-associated protein Tau.

[0071] The human MAPT gene encoding Tau protein is located on chromosome 17q23.1, spanning about 150kb and comprising 16 exons. 11 of the 16 exons are expressed in the central nervous system (CNS). In the human brain, six isoforms of Tau with 0, 1 or 2 N-terminal repeats (0N, 1N or 2N) and 3 or 4 microtubule-bound repeats (3R or 4R) are produced by alternative splicing of exons 2, 3 and 10. Larger splicing variants including exon 4a or exon 6 are mainly found in the peripheral nervous system or spinal cord and skeletal muscle, respectively. Tau protein is mainly expressed in CNS neurons and is located in axons and dendrites. It is reported that the half-life of Tau is about 7 days in human iPSC-derived neuronal cultures and 23±6.4 days in human CNS (Sato, C. et al. (2018). "Tau Kinetics in Neurons and the Human Central Nervous System." Neuron 98(4): 861-864). Studies have shown that a portion of newly synthesized Tau protein is truncated at the C-terminus and released from neurons into the cerebrospinal fluid (CSF) with a delay of 3 days, and the CSF Tau production rates estimated from amyloid-negative and -positive populations are 22.9±7.2 pg / mL / day and 27.8±7.0 pg / mL / day, respectively (Sato, C. et al. (2018). "Tau Kinetics in Neurons and the Human Central Nervous System." Neuron 98(4): 861-864).

[0072] As used herein, the term "small interfering RNA agent" or "siRNA agent" means an RNA or RNA-like (e.g., chemically modified RNA oligonucleotide molecule) containing both a sense strand and an antisense strand. In some embodiments, the siRNA sense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, or 17 nucleotides in length. In some embodiments, the siRNA antisense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, or 17 nucleotides in length. The sense and / or antisense strand of the siRNA agent can comprise another moiety (e.g., a lipid moiety). For example, the lipid moiety can be incorporated into the sense strand of the siRNA agent. The sense and / or antisense strand of the siRNA agent can be directly or indirectly bound to another moiety (e.g., a lipid moiety). ) connected or conjugated. For example, the sense strand of the siRNA agent can be directly or indirectly connected or conjugated to another part (e.g., a lipid part). In a specific embodiment, the siRNA agent is a double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide comprising a sense strand and an antisense strand forming a double-stranded region. The double-stranded region can be the entire length of the sense strand, the antisense strand, or both. Alternatively, the double-stranded region can be less than the entire length of the sense strand, the antisense strand, or both. The double-stranded region can be the result that the antisense strand is fully complementary, partially complementary, or substantially complementary to the sense strand. In a specific embodiment, the antisense strand of the siRNA agent is partially complementary to the target RNA transcript. In another specific embodiment, the antisense strand of the siRNA agent is substantially complementary to the target RNA transcript. In another specific embodiment, the antisense strand of the siRNA agent is fully complementary to the target RNA transcript.

[0073] The two strands forming the double-stranded region or duplex structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules.

[0074] When the two substantially complementary strands of the siRNA agent consist of separate RNA molecules, these molecules need not, but may be covalently linked. In certain embodiments, the two strands are covalently linked by a continuous nucleotide chain between the 3' end of one strand and the 5' end of the corresponding other strand that forms a duplex structure, and the connecting structure is referred to as a "joint". The RNA strands of the siRNA agent may have the same or different numbers of nucleotides. In some embodiments, one or both strands of the siRNA agent include an overhang. In other embodiments, the siRNA agent is blunt-ended.

[0075] In specific embodiments, the siRNA agents described herein mediate the inhibition of messenger RNA (mRNA) degradation or mRNA translation in a sequence-specific manner. In specific embodiments, the siRNA agents described herein inhibit MAPT gene expression through the RNA-induced silencing complex (RISC) pathway.

[0076] As used herein, the term "complementary" when used to describe the relationship between a first nucleotide sequence (e.g., the sense strand of an siRNA agent or a target mRNA) and a second nucleotide sequence (e.g., the antisense strand of an siRNA agent or a single-stranded antisense oligonucleotide) means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helix structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. Complementary sequences include Watson Crick base pairs or non-Watson Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics that at least meet the above hybridization requirements. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, fA and mA are complementary to U (or T) and are identical to A.

[0077] As used herein, the term "fully complementary" in the context of two nucleotide sequences means that all (100%) bases in the contiguous sequence of the first nucleotide sequence will hybridize with the same number of bases in the contiguous sequence of the second nucleotide sequence to form a duplex. When two nucleotide sequences are designed to form one or more single-stranded overhangs after hybridization, such overhangs should not be considered mismatches in terms of the determination of complementarity. For example, for the purposes described herein, an siRNA agent comprising an oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length is considered "fully complementary", wherein the 23-nucleotide oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the 21-nucleotide oligonucleotide. In a specific embodiment, the two nucleotide sequences are "fully complementary" when all (100%) bases in the first nucleotide sequence hybridize with all (100%) bases in the second nucleotide sequence to form a duplex. In a specific embodiment, the two nucleotide sequences hybridize under stringent conditions. In another specific embodiment, the two nucleotide sequences hybridize under very stringent conditions.

[0078] As used herein, the term "partial complementarity" in the context of two nucleotide sequences means that at least 65% but less than 80% of the bases in the contiguous sequence of the first nucleotide sequence will hybridize with the same number of bases in the contiguous sequence of the second nucleotide sequence to form a duplex. In a specific embodiment, the two nucleotide sequences hybridize under stringent conditions. In another specific embodiment, the two nucleotide sequences hybridize under very stringent conditions.

[0079] As used herein, the term "substantially complementary" in the context of two nucleotide sequences means that at least 80% but less than 100% of the bases in the continuous sequence of the first nucleotide sequence will hybridize with the same number of bases in the continuous sequence of the second nucleotide sequence to form a duplex. In some embodiments, when at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% but less than 100% of the bases in the continuous sequence of the first oligonucleotide will hybridize with the same number of bases in the continuous sequence of the second oligonucleotide to form a duplex, the two nucleotide sequences are substantially complementary. In a specific embodiment, the two nucleotide sequences hybridize under stringent conditions. In another specific embodiment, the two nucleotide sequences hybridize under very stringent conditions.

[0080] As used herein, when referring to a numerical value, the terms "about" and "approximately" encompass the numerical value and a variation within + / - 20%. For example, about 20% would encompass values ​​between 16% and 24%, including 20%. In one embodiment, when referring to a numerical value, the terms "about" and "approximately" encompass the numerical value and a variation within + / - 15%. In another embodiment, when referring to a numerical value, the terms "about" and "approximately" encompass the numerical value and a variation within + / - 10%. In another embodiment, when referring to a numerical value, the terms "about" and "approximately" encompass the numerical value and a variation within + / - 5%.

[0081] As used herein, when referring to hybridization, the term "stringent" means that under "stringent conditions" or "stringent hybridization conditions", a first nucleotide sequence will hybridize to a second nucleotide with minimal hybridization to other sequences. In a specific embodiment, the antisense sequence will hybridize to its target sequence under stringent conditions with minimal targeting to other sequences. Stringent conditions depend on the sequence (e.g., sequence length, complementarity) and vary under different environmental parameters (e.g., assay conditions, physiological environment). Examples of stringent hybridization conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Those skilled in the art will appreciate that variations in hybridization stringency are inherently described.

[0082] As used herein, when it comes to hybridization, the term "very stringent" means that under "very stringent conditions" or "very stringent hybridization conditions", only the first nucleotide sequence will be observed to hybridize with the second nucleotide. In a specific embodiment, it will be observed that the antisense sequence hybridizes with its target sequence only under very stringent conditions. In addition, very stringent conditions may not allow hybridization between partially complementary sequences. Very stringent conditions depend on the sequence (e.g., sequence length, complementarity) and vary under different environmental parameters (e.g., assay conditions, physiological environment). Compared with stringent conditions under the same circumstances, very stringent conditions can include higher temperatures, lower ionic strengths and / or shorter reaction times. For example, very stringent conditions can include hybridization temperatures of about 71°C, about 72°C, about 73°C, about 74°C, about 75°C, about 76°C, about 77°C, about 78°C, about 79°C, about 80°C or higher. It will be understood by those skilled in the art that the variation of hybridization stringency is inherently described.

[0083] As used herein, "target sequence" refers to a continuous portion of the nucleotide sequence of the RNA molecule formed during the transcription of the MAPT gene, including an mRNA (e.g., a MAPT mRNA produced by alternative splicing) as an RNA processing product of the primary transcription product. In one embodiment, the continuous portion of the nucleotide sequence is at least long enough to serve as a substrate for the cutting guided by RNAi at or near the nucleotide sequence portion of the mRNA molecule formed during the transcription of the MAPT gene. In a specific embodiment, the length of the target sequence is about 15-30 nucleotides. For example, the target sequence can be about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65 In some embodiments, the target sequence is 19-25 nucleotides in length. In some embodiments, the target sequence is 21-23 nucleotides in length. Ranges and lengths intermediate to the above ranges and lengths are also considered part of the present disclosure.

[0084] As used herein, the phrases "a nucleotide sequence corresponding to any antisense strand nucleotide sequence", "a nucleotide sequence corresponding to an antisense strand nucleotide sequence", "a nucleotide sequence corresponding to any sense strand nucleotide sequence", "a nucleotide sequence corresponding to a sense strand nucleotide sequence", "a nucleotide sequence corresponding to any nucleotide sequence", or "a nucleotide sequence corresponding to any SEQ ID NO" refer to an oligonucleotide comprising a nucleotide chain comprising the unmodified nucleotide, or one or more modified nucleotides, or one or more conjugated moieties (e.g., moieties described herein, such as lipids, or modified nucleotides conjugated to moieties described herein). It is known to those skilled in the art that the unmodified nucleotides may be replaced by other moieties without substantially altering the base pairing properties of the oligonucleotide comprising the nucleotide bearing such replacement moieties. For example, a nucleotide comprising inosine as its base may base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine may be replaced by a nucleotide containing, for example, inosine. In another example, adenine and cytosine may be replaced by guanine and uracil, respectively, to form GU wobble base pairing with a target mRNA.

[0085] As used herein, the phrase "non-naturally occurring small interfering ribonucleic acid (siRNA) agent," "non-naturally occurring small interfering ribonucleic acid agent," or "non-naturally occurring siRNA agent" refers to an siRNA agent that is not found in nature. Non-naturally occurring siRNAs may contain one or more modified nucleotides.

[0086] As used herein, the term "overhang" in the context of a 5' or 3' nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of the siRNA agent. For example, when the 3' end of one strand of the siRNA agent extends beyond the 5' end of the other strand, or vice versa, there is a nucleotide overhang. In some embodiments, the overhang is present at the 3' end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3' overhang is present in the antisense strand. In another embodiment, the 3' overhang is present in the sense strand. In some embodiments, the overhang is present at the 5' end of the sense strand, the antisense strand, or both strands. In one embodiment, the 5' overhang is present in the antisense strand. In another embodiment, the 5' overhang is present in the sense strand. The overhang may be due to one strand being longer than the other, or being the result of two strands of the same length being staggered. In some embodiments, the overhang forms a mismatch with the target sequence. In other embodiments, the overhang is complementary to the targeted gene sequence. The nucleotides in the overhang region of the siRNA agent can each independently be a modified or unmodified nucleotide (eg, a 2'-fluoro-modified nucleotide, a 2'-O-methyl modified nucleotide, a deoxynucleotide, or a combination thereof).

[0087] In some embodiments, the 5' or 3' overhang of the sense strand or antisense strand of the siRNA agent is phosphorylated. In certain embodiments, the 5' or 3' overhang of the sense strand and antisense strand of the siRNA agent is phosphorylated. In some embodiments, the overhang region contains two nucleotides with a phosphorothioate between the two nucleotides, and the two nucleotides can be the same or different.

[0088] In some embodiments, the siRNA agent contains only a single overhang, which can enhance the interference activity of the siRNA agent without affecting its overall stability. For example, the single-stranded overhang can be located at the 3' end of the sense strand of the siRNA agent, or alternatively, at the 3' end of the antisense strand of the siRNA agent. The siRNA agent can also have a blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa. In some embodiments, the antisense strand of the siRNA agent has a nucleotide overhang at the 3' end, and the 5' end is blunt.

[0089] In some embodiments, one strand of the siRNA agent comprises at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, one strand of the siRNA agent comprises at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides but no more than 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In some embodiments, one strand of the siRNA agent comprises 1 nucleotide, 2 nucleotides, or 3 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, one strand of the siRNA agent comprises 1 to 2 nucleotides, 1 to 3 nucleotides, 1 to 4 nucleotides, or 1 to 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In some embodiments, one strand of the siRNA agent comprises 2 to 3 nucleotides, 2 to 4 nucleotides, or 2 to 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, one strand of the siRNA agent comprises a 5' end, a 3' end, or both a 5' end and a 3' end overhang of 3 to 4 nucleotides or 4 to 5 nucleotides. The strand can be an antisense strand or a sense strand. The nucleotide overhang can comprise or consist of a nucleotide analog or a nucleoside analog.

[0090] In some embodiments, each strand of the siRNA agent comprises at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, each strand of the siRNA agent comprises at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides but no more than 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In some embodiments, each strand of the siRNA agent comprises 1 nucleotide, 2 nucleotides, or 3 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, each strand of the siRNA agent comprises 1 to 2 nucleotides, 1 to 3 nucleotides, 1 to 4 nucleotides, or 1 to 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In some embodiments, each strand of the siRNA agent comprises 2 to 3 nucleotides, 2 to 4 nucleotides, or 2 to 5 nucleotides at the 5' end, 3' end, or both 5' and 3' end overhangs. In certain embodiments, each strand of the siRNA agent comprises a 3 to 4 nucleotide, or 4 to 5 nucleotide 5', 3', or both 5' and 3' overhang. The nucleotide overhang may comprise or consist of a nucleotide analog or a nucleoside analog.

[0091] As used herein, in the context of siRNA agents, the term "blunt end" or "blunt-ended" refers to the absence of unpaired nucleotides or nucleotide analogs at a given end of the siRNA agent, i.e., no nucleotide overhangs. In some embodiments, one end of the siRNA agent is blunt-ended. In other words, the 5' end of one strand and the 3' end of the other strand do not include unpaired nucleotides or nucleotide analogs. In some embodiments, both ends of the siRNA agent are blunt-ended. In other words, there are no nucleotide overhangs at either end of the siRNA agent.

[0092] As used herein, in the context of siRNA agents, the term "antisense strand" or "guide strand" refers to the strand that contains the region that is complementary to the target sequence.

[0093] As used herein, in the context of a siRNA agent, the term "sense strand" or "passenger strand" refers to the strand of the siRNA agent that includes a region that is complementary to a region of the antisense strand.

[0094] As used herein, in the context of the nucleobases of siRNA agents, the term "modified" refers to nucleobases that are not naturally present in RNA molecules. Naturally occurring RNA sequences include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). For examples of modified nucleobases, see Section 6.2 below.

[0095] As used herein, in the context of nucleotides of siRNA agents, the term "modified" refers to nucleotides that are not naturally present in RNA molecules. See Section 6.2 below for examples of modified nucleotides.

[0096] As used herein, unless otherwise specified, the term "isomer" refers to different compounds with the same molecular formula. "Stereoisomers" are isomers that differ only in the arrangement of atoms in space. "Atropisomers" are stereoisomers that are hindered from rotating about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any ratio may be referred to as a "racemic" mixture. "Diastereomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0097] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0098] It should be noted that if there is a discrepancy between the depicted structure and the name of that structure, the depicted structure will be given more weight.

[0099] As used herein, the terms "comprising" and "including" can be used interchangeably. The terms "comprising" and "including" should be interpreted as specifying the presence of the features or components mentioned, but not excluding the presence or addition of one or more features, components, or combinations thereof. In addition, the terms "comprising" and "including" are intended to include examples covered by the term "consisting of". Therefore, the term "consisting of" can be used instead of the terms "comprising" and "including" to provide more specific embodiments.

[0100] As used herein, the term "or" should be interpreted as an inclusive "or", meaning any one or any combination. Thus, "A, B, or C" means any of the following: A; B; C; A and B; A and C; B and C; A, B, and C. An exception to this definition will only occur if a combination of elements, functions, steps, or actions are inherently mutually exclusive in some way.

[0101] As used herein, the phrase "and / or" as used in phrases such as "A and / or B" is intended herein to include both A and B; A or B; A (alone); and B (alone). Similarly, the phrase "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0102] 6.1 Nucleotide sequence

[0103] Provided herein is an siRNA agent that inhibits (e.g., partially or completely) MAPT gene (e.g., human MAPT gene) expression. In a specific embodiment, in a determination known to those skilled in the art or as described herein (e.g., in Section 6.8 below or Section 7 below), relative to a negative control (e.g., PBS or siRNA for RNA molecules formed during gene transcription other than MAPT), siRNA as described herein inhibits the expression of MAPT gene (e.g., human MAPT gene) by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%. In another specific embodiment, in a determination known to those skilled in the art or as described herein (e.g., in Section 6.8 below or Section 7 below), relative to a negative control (e.g., PBS or siRNA for RNA molecules formed during gene transcription other than MAPT), siRNA as described herein inhibits the expression of MAPT gene (e.g., human MAPT gene) by at least about 70%, at least 75%, at least 80% or at least 85%. In another specific embodiment, in an assay known to those skilled in the art or described herein (e.g., in Section 6.8 below or Section 7 below), relative to a negative control (e.g., PBS or siRNA for RNA molecules formed during transcription of genes other than MAPT), the siRNA described herein inhibits the expression of a MAPT gene (e.g., human MAPT gene) by at least about 90%, at least 95%, at least 96%, at least 97%, or at least 98%. In another specific embodiment, in an assay known to those skilled in the art or described herein (e.g., in Section 6.8 below or Section 7 below), relative to a negative control (e.g., PBS or siRNA for RNA molecules formed during transcription of genes other than MAPT), the siRNA described herein inhibits the expression of a MAPT gene (e.g., human MAPT gene) by 25% to 50%, 50% to 75%, 75% to 85%, 85% to 95%, 90% to 95%, or 95% to 99%. In another specific embodiment, in the assay known to those skilled in the art or described herein (e.g., in Section 6.8 below or Section 7 below), relative to a negative control (e.g., PBS or siRNA for RNA molecules formed during transcription of genes other than MAPT), siRNA described herein inhibits the expression of MAPT gene (e.g., human MAPT gene) by 100%. In a specific embodiment, the inhibition of MAPT gene (e.g., human MAPT gene) expression is assessed using the in vitro assay described in Section 7 below. In a specific embodiment, siRNA reagents described herein exhibit in vitro or ex vivo knockdown efficiency, such as described in Section 7 below.In specific embodiments, the siRNA agents described herein exhibit in vivo knockdown efficiency in a mouse model, such as described below in Section 7. In specific embodiments, the siRNA agents described herein exhibit one, two, three or more properties of the RNA molecules described below in Section 7.

[0104] In specific embodiments, the siRNA agents described herein are effective in the assays described herein (e.g., in Section 7, below) at an IC of 10 nM to 200 nM. 50 Inhibit the expression of a MAPT gene (e.g., a human MAPT gene) in a neuron (e.g., a human iPSC neuron). In a specific embodiment, the siRNA agent described herein is effective in an assay described herein (e.g., in Section 7 below) at an IC of 10 nM to 100 nM. 50 Inhibit the expression of a MAPT gene (e.g., a human MAPT gene) in a neuron (e.g., a human iPSC neuron). In a specific embodiment, the siRNA agent described herein is effective in an assay described herein (e.g., in Section 7 below) at an IC of 10 nM to 50 nM. 50 The expression of a MAPT gene (eg, a human MAPT gene) in neurons (eg, human iPSC neurons) is inhibited.

[0105] In specific embodiments, the siRNA agents described herein are stable in vitro or ex vivo in one, two or all of the following: mouse brain homogenate, human liver lysosomes and rat liver tritosomes. The stability of such siRNA agents can be assessed using methods known to those skilled in the art or as described herein (e.g., in Section 6.8 or Section 7 below).

[0106] In a specific embodiment, the siRNA agent is a double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide comprising a sense strand and an antisense strand that anneal to form a double-stranded region or duplex. The antisense strand includes a region that is substantially complementary to the target sequence and is generally fully complementary. The sense strand includes a region that is complementary to the antisense strand so that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described herein and as known in the art, the complementary sequence of the siRNA agent can also be included as a self-complementary region of a single nucleic acid molecule, rather than being located on a separate oligonucleotide. In a specific embodiment, the annealing of the sense strand and the antisense strand sequence forms a stable duplex, as assessed by a melting temperature (Tm) of about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, about 45°C or higher. See, for example, Section 6.8 below, for determination of melting temperature.

[0107] The sense strand and antisense strand of siRNA agents described herein can be the same length or different lengths. The sense strand and antisense strand of siRNA agents described herein can each be 15 to 30 nucleotides in length. In a specific embodiment, the sense strand and antisense strand of siRNA agents described herein are each no more than 30 nucleotides in length. In some embodiments, the sense strand and antisense strand of siRNA agents described herein are each independently 15 to 30 nucleotides in length. In certain embodiments, the sense strand and antisense strand of siRNA agents described herein are each independently 16 to 30 nucleotides in length. In some embodiments, the sense strand and antisense strand of siRNA agents described herein are each independently 17 to 30 nucleotides in length. In certain embodiments, the sense strand and antisense strand of siRNA agents described herein are each independently 18 to 30 nucleotides in length. In some embodiments, the sense strand and antisense strand of siRNA agents described herein are each independently 19 to 30 nucleotides in length. In certain embodiments, the sense and antisense strands of the siRNA agents described herein are each independently 20 to 30 nucleotides in length. In certain embodiments, the sense and antisense strands of the siRNA agents described herein are each independently 21 to 30 nucleotides in length.

[0108] In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 15 to 25 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 16 to 25 nucleotides in length. In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 17 to 25 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 18 to 25 nucleotides in length. In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 19 to 25 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 20 to 25 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 21 to 25 nucleotides in length.

[0109] In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 19 to 23 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 19 to 22 nucleotides in length. In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 19 to 21 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 19 nucleotides in length. In some embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 20 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 21 nucleotides in length. In certain embodiments, the sense strand and antisense strand of the siRNA agents described herein are each independently 22 nucleotides in length.

[0110] The double-stranded region formed by hybridization of the antisense strand and sense strand of the siRNA agent described herein can be the entire length of the two strands. For example, the length of the antisense strand of the siRNA agent described herein can be 19 nucleotides, the length of the sense strand of the siRNA agent can be 19 nucleotides, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In another example, the length of the antisense strand of the siRNA agent described herein can be 21 nucleotides, the length of the sense strand of the siRNA agent can be 21 nucleotides, and the double-stranded region formed by hybridization of the strands is 21 nucleotides. The double-stranded region formed by hybridization of the antisense strand and sense strand of the siRNA agent described herein can be less than the entire length of one or two strands. For example, the length of the antisense strand of the siRNA agent described herein can be 19 nucleotides, the length of the sense strand of the siRNA agent can be 21 nucleotides, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of the siRNA agent described herein can be 21 nucleotides in length, the sense strand of the siRNA agent can be 19 nucleotides in length, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of the siRNA agent described herein can be 21 nucleotides in length, the sense strand of the siRNA agent can be 21 nucleotides in length, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In a specific embodiment, the double-stranded region of the siRNA agent described herein is long enough to serve as a substrate for the Dicer enzyme.

[0111] In certain embodiments, the length of the double-stranded region of the siRNA agents described herein is 15 to 30 base pairs. For example, the length of the double-stranded region of the siRNA agents described herein can be 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 1 In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 15 to 25 base pairs. In certain embodiments, the length of the double-stranded region of the siRNA agents described herein is 16 to 25 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 17 to 25 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 18 to 25 base pairs. In certain embodiments, the length of the double-stranded region of the siRNA agents described herein is 19 to 25 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 20 to 25 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 21 to 25 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 19 to 23 base pairs. In certain embodiments, the length of the double-stranded region of the siRNA agents described herein is 19 to 22 base pairs. In some embodiments, the length of the double-stranded region of the siRNA agents described herein is 19 to 21 base pairs. In certain embodiments, the length of the double-stranded region of the siRNA agents described herein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs. In specific embodiments, the length of the double-stranded region of the siRNA agents described herein is 19, 20, 21, 22, or 23 base pairs. Ranges and lengths intermediate to the above ranges and lengths are also considered part of the present disclosure.

[0112] In some embodiments, the siRNA agents described herein are blunt-ended. In other embodiments, the sense strand or antisense strand of the siRNA agents described herein comprises an overhang. The overhang may be located at the 5' end, 3' end, or 5' end and 3' end of the sense strand or antisense strand of the siRNA agent. In some embodiments, the sense strand and antisense strand of the siRNA agents described herein comprise an overhang. The overhang of the sense strand may be located at the 5' end of the sense strand, and the overhang of the antisense strand may be located at the 3' end of the antisense strand. Alternatively, the overhang of the sense strand may be located at the 3' end of the sense strand, and the overhang of the antisense strand may be located at the 5' end of the antisense strand. In certain embodiments, the overhang of the strand of the siRNA agent comprises at least 1 nucleotide. In some embodiments, the overhang of the strand of the siRNA agent comprises at least 2 nucleotides. In certain embodiments, the overhang of the strand of the siRNA agent comprises at least 3 nucleotides. In some embodiments, the overhang of the strand of the siRNA agent comprises at least 4 nucleotides. In certain embodiments, the overhang of the chain of the siRNA agent comprises at least 5 nucleotides. In some embodiments, the overhang of the chain of the siRNA agent comprises 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides or more. In certain embodiments, the overhang of the chain of the siRNA agent comprises 1 to 5 nucleotides, 1 to 4 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. In some embodiments, the overhang of the chain of the siRNA agent comprises 2 to 5 nucleotides, 2 to 4 nucleotides, 2 to 3 nucleotides, 3 to 4 nucleotides, 3 to 4 nucleotides, or 4 to 5 nucleotides.

[0113] In certain embodiments, the sense strand of the siRNA agents described herein is 19 nucleotides in length, and the antisense strand of the siRNA agents is 21 nucleotides in length. In some embodiments, the sense strand of the siRNA agents described herein is 20 nucleotides in length, and the antisense strand of the siRNA agents is 21 nucleotides in length. In certain embodiments, the sense strand of the siRNA agents described herein is 21 nucleotides in length, and the antisense strand of the siRNA agents is 21 nucleotides in length. In some embodiments, the sense strand of the siRNA agents described herein is 21 nucleotides in length, and the antisense strand of the siRNA agents is 19 nucleotides in length. In certain embodiments, the sense strand of the siRNA agents described herein is 21 nucleotides in length, and the antisense strand of the siRNA agents is 20 nucleotides in length. In some embodiments, the sense strand of the siRNA agents described herein is 19 nucleotides in length, and the antisense strand of the siRNA agents is 19 nucleotides in length. In some embodiments, the sense strand of the siRNA agents described herein is 20 nucleotides in length, and the antisense strand of the siRNA agents is 20 nucleotides in length.

[0114] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1.

[0115] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1.

[0116] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 1, and wherein the sense strand comprises a nucleotide sequence corresponding to a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 1. In a specific embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to a nucleotide sequence of an antisense strand nucleotide sequence of UM25, UM28, UM96, UM165, or UM177 in Table 1, and the sense strand comprises a nucleotide sequence corresponding to a nucleotide sequence of a sense strand nucleotide sequence of UM25, UM28, UM96, UM165, or UM177 in Table 1, respectively.

[0117] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0118] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0119] In some embodiments, the siRNA reagent does not include chemical modifications or conjugations such as those known in the art and described herein. See, for example, Section 6.2 below and Section 7 below, for siRNA reagents comprising chemical modifications or conjugations. In specific embodiments, the siRNA reagent includes chemical modifications or conjugations such as those known in the art and described herein. In specific embodiments, the siRNA reagent includes one or more chemical modifications and / or conjugations described herein (e.g., Section 6.2 below and / or Section 7 below). In certain embodiments, the core base of the nucleotide is modified. In some embodiments, the sugar of the nucleotide is modified. In certain embodiments, the phosphate backbone of the nucleotide is modified.

[0120] The siRNA reagent may contain only naturally occurring nucleotides, or may contain one or more modified nucleotides. In certain embodiments, the nucleobase of the nucleotide is modified. In some embodiments, the sugar of the nucleotide is modified. In certain embodiments, the phosphate backbone of the nucleotide is modified.

[0121] In specific embodiments, the modified nucleotides include one or more modified nucleotides described herein (e.g., in Section 6.2 or Section 7, below). In specific embodiments, the modified nucleotides are selected from the group consisting of 2'O-methyl modified nucleotides, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, 3'-O-methyl modified nucleotides, 3'-O-methyl modified nucleotides with a 2'-5' linked phosphate, inverted abasic nucleotides, nucleotides containing S-glycol nucleic acid (GNA), unlocked nucleic acids, 5'-vinylphosphonate-2'-O-methyl-uridine, cis-cyclobutylphosphonate modified nucleotides, 5'-cis-cyclobutylphosphonate-2'-O-methyl modified nucleotides, (L)-α-threofuranosyl modified nucleotides, and combinations thereof.

[0122] In specific embodiments, the antisense strand of a siRNA agent described herein comprises at least one modified internucleoside linkage.

[0123] In specific embodiments, the sense strand of the siRNA agents described herein comprises at least one modified internucleoside linkage.

[0124] In specific embodiments, the antisense strand and the sense strand of the siRNA agents described herein each comprise at least one modified internucleoside linkage. In specific embodiments, the modified internucleoside linkage comprises phosphorothioate.

[0125] In specific embodiments, the siRNA agents described herein comprise one or more of the following: phosphorothioate (PS) bonds, 2′-fluororibose (2′-F), 2′-methoxyribose (2′-OMe), deoxyribose, 2′-O-(2-methoxyethyl)ribose (2′-MOE), inverted bonds (inverted abasic sites, InvAb), unlocked nucleic acids (UNA), and glycol nucleic acids (GNA).

[0126] In specific embodiments, the siRNA agents described herein exhibit stability as assessed by an assay described herein (e.g., in Section 6.8 or Section 7, below) or known to those of skill in the art. In certain embodiments, the siRNA agents described herein comprising one or more modified nucleotides exhibit increased stability relative to the same siRNA agent without those one or more modified nucleotides, as assessed using methods known to those of skill in the art or described herein (e.g., in Section 6.8 or Section 7, below).

[0127] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2.

[0128] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 2, and wherein the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 2.

[0129] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0130] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0131] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 3, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 3.

[0132] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0133] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0134] In some embodiments, the siRNA reagents described herein are conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, delivery polymers or delivery vehicles. See, for example, Section 6.3 below, for more information on siRNA reagents conjugated to one or more non-nucleotide groups. In specific embodiments, one or more non-nucleotide groups are one or more of the non-nucleotide groups described herein (e.g., in Section 6.3 or Section 7 below).

[0135] In specific embodiments, the antisense strand of the siRNA agents described herein is conjugated directly or indirectly to one or more lipophilic moieties. Regarding lipophilicity, see, e.g., S. Winiwarter, M. A.-L Ungell, TB Andersson, I. Zamora, Use of Molecular Descriptors for Absorption, Distribution, Metabolism, and Excretion Predictions. Comprehensive Medicinal Chemistry II, Vol. 5, 2007, pp. 531-554. In a specific embodiment, the sense strand of the siRNA agent described herein is directly or indirectly conjugated to one or more lipophilic moieties. In a specific embodiment, the antisense strand and sense strand of the siRNA agent described herein are each directly or indirectly conjugated to one or more lipophilic moieties. One or more lipophilic moieties can be conjugated to one or more terminal positions of the siRNA agent. For example, the lipophilic moiety can be conjugated to the 5' end and / or 3' end of one or both chains of the siRNA agent. Alternatively, or in addition, one or more lipophilic moieties can be conjugated to one or more internal positions of the double-stranded region of the siRNA agent. In certain embodiments, the lipophilic moiety is conjugated to one or more terminal positions of the siRNA agent and one or more internal positions of the siRNA agent. In some embodiments, one or more lipophilic moieties are conjugated via a linker or carrier. In specific embodiments, the linker is a linker as described herein (e.g., in Section 6.3 below). For example, the linker may comprise one of the following structures:

[0136]

[0137] In specific embodiments, the lipophilic moiety comprises a lipophilic moiety as described herein (e.g., in Section 6.3, Section 6.4, or Section 7, below). In specific embodiments, the lipophilic moiety is cholesterol. In specific embodiments, the lipophilic moiety is selected from one or more of the following: L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L20, L21, L22, L23, and / or L24 (see Figure 3In specific embodiments, the lipophilic moiety includes cholesterol-triethylene glycol; 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((Z)-octadec-9-en-1-yl)oxy)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; N,N′-((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2,3-diyl)bis(oxy))bis(propane-3,1-diyl))dipalmitamide; N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)palmitamide; (2R ,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropionamide; 1-((2R,3R,4R,5R)-3-(2-(hexadecyloxy)ethoxy)*4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; ((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropionamide (2R,3R,4R,5R)-5-(heptadecyloxy)-2-(hydroxymethyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4-(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran-3-ol; (2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4,5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)- 4S,5R)-5,6-bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol; 1-((2R,3R,4R,5R)-3-((15-((3r,5r,7r)-adamantan-1-yl)pentadecyl)oxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; (1s,4s)-4-heptadecanamidecyclohexane-1-carboxyl-; 16-oxo-16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl)oxy)hexadecanoyl-; 16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl)oxy)hexadecanoyl-;1] heptane-2-yl)oxy) hexadecanoyl-; 15-((3r,5r,7r)-adamantan-1-yl)pentadecanoyl-; 2-(2-(N-hexadecyl palmitamide)-N-methylacetamide)ethanone-; 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxohexadecanoyl-; 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)hexadecanoyl-; (2R,3R,4R,5R)-2-(6-amino-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran -3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydro-2H-pyran-3-ol. In specific embodiments, a lipophilic moiety (such as described in Section 7) is conjugated to the sense strand of the siRNA agent in a manner described in Section 7. .

[0138] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 9, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 9. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, and wherein the sense strand is conjugated to cholesterol as shown in Table 9, which is conjugated to the sense strand of the siRNA agent. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 9, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 9, and wherein the sense strand is conjugated to cholesterol as shown in Table 9, which is conjugated to the sense strand of the siRNA agent.

[0139] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0140] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and wherein the sense strand of the siRNA agent is as shown in Table 9 with cholesterol or, for example, Figure 3 In some embodiments, the present invention provides a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to cholesterol or, for example, Figure 3 In certain embodiments, the present invention provides a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to cholesterol or, for example, Figure 3 conjugated to another lipid moiety as described in.

[0141] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0142] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, wherein the sense strand is conjugated to cholesterol as shown in Table 9, the cholesterol is conjugated to the sense strand of the siRNA agent, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, wherein the sense strand is conjugated to cholesterol as shown in Table 9, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 9, wherein the sense strand is conjugated to cholesterol as shown in Table 9, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0143] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4, and wherein the sense strand is conjugated to cholesterol or another lipid as shown in the same row of Table 4. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and wherein the sense strand is conjugated to cholesterol or another lipid (e.g., Figure 3 In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 4, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 4, wherein the sense strand is conjugated to cholesterol or another lipid as shown in the same row in Table 4.

[0144] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and wherein the sense strand is bound to cholesterol or another lipid (e.g., Figure 3 In some embodiments, the present invention provides a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand, and wherein the sense strand is conjugated to cholesterol or another lipid (e.g., Figure 3 In certain embodiments, the present invention provides a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand, and wherein the sense strand is conjugated with cholesterol or another lipid (e.g., Figure 3 Lipids in the conjugation.

[0145] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 5.

[0146] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and wherein the sense strand is conjugated to a lipophilic portion as described herein.

[0147] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 5, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 5, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 5, and wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 5.

[0148] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein.

[0149] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 5, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 5, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 5, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0150] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 33.

[0151] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and wherein the sense strand is conjugated to a lipophilic portion as described herein.

[0152] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 33, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 33, and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row in Table 33, and wherein the sense strand is conjugated to a lipid moiety as shown in the same row of Table 33.

[0153] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic portion as described herein.

[0154] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid portion as shown in the same row of Table 33, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid portion as shown in the same row of Table 33, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid portion as shown in the same row of Table 33, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0155] In specific embodiments, siRNA agents described herein comprise the antisense strand and sense strand of one named in Table 1, Table 2, Table 3, Table 4, Table 5, Table 9, or Table 33. In specific embodiments, siRNA agents described herein comprise the antisense strand and sense strand corresponding to the antisense strand and sense strand of any one of UM25, UM28, UM96, UM165, or UM177 in Table 1. In specific embodiments, siRNA agents described herein comprise the antisense strand and sense strand of any one of UM25, UM28, UM96, UM165, or UM177 in Table 2. In specific embodiments, siRNA agents described herein comprise the antisense strand and sense strand of one named in Table 3, Table 4, Table 5, Table 9, or Table 33. In some embodiments, the sense strand of the siRNA agent is conjugated to a lipid moiety described herein (e.g., Figure 3 ). In specific embodiments, the siRNA agent is an agent described in Section 7, below.

[0156] In some embodiments, siRNA reagents described herein also include non-nucleotide groups, such as ligands (e.g., targeting ligands). Non-nucleotide groups (such as ligands (e.g., targeting ligands)) can be directly or directly conjugated to the antisense strand or sense strand of siRNA reagents. Non-nucleotide groups (such as ligands (e.g., targeting ligands)) replace one or more nucleotides in the internal position of the double-stranded region of siRNA reagents described herein. In certain embodiments, non-nucleotide groups (such as ligands (e.g., targeting ligands)) are conjugated to the strand of siRNA reagents by joints or carriers (e.g., delivery vehicles). In specific embodiments, non-nucleotide groups (such as ligands (e.g., targeting ligands)) are non-nucleotide groups described in Section 6.3 below.

[0157] Table 3: Modified nucleotide sense and antisense sequences (5' to 3')

[0158] Modifications: mN = 2′OMe; fN = 2′F; ps = phosphorothioate; VP = vinylphosphonate; invAb = inverted abasic

[0159]

[0160]

[0161]

[0162]

[0163] 6.2 Chemical modification of nucleotides

[0164] In specific embodiments, the siRNA agents described herein include one or more nucleotide modifications. Nucleotide modifications include, for example, terminal modifications, such as 5' terminal modifications (e.g., phosphorylation, conjugation, reverse connection) or 3' terminal modifications (e.g., conjugation, DNA nucleotides, reverse connection, etc.); base modifications, such as replacement of bases with stable bases, destabilizing bases, or bases paired with amplified partner libraries, removal of bases (absence of base nucleotides) or conjugation of bases; sugar modifications (e.g., at 2' or 4' positions) or sugar replacements; or backbone modifications, including modification or replacement of phosphodiester bonds. In some embodiments, the siRNA agent includes at least one modification selected from the group consisting of modified internucleoside bonds, modified nucleobases, modified sugars, and any combination thereof. Without limitation, such modifications may be present at any position in the siRNA agent (e.g., in the sense strand, antisense strand, or both strands).

[0165] In some embodiments, the siRNA agent comprises one or more modified sugar modifications, such as one or more substituted sugar moieties. In some embodiments, the siRNA agent described herein comprises one of the following at the 2' position: H; F; or OCH3(OMe).

[0166] In some embodiments, the siRNA agents described herein include one or more glycol nucleic acids (GNAs). Typically, GNAs are acyclic nucleic acid analogs in which the repeating glycol units are linked by phosphodiester bonds, unlike the ribose-phosphodiester backbone of RNA.

[0167] In certain embodiments, the siRNA agents described herein include one or more terminal modifications, such as 5' terminal phosphorylation, conjugation, or reverse ligation. In some embodiments, the terminal modification includes a 5'-phosphate, such as a 5' terminal phosphate on the antisense strand of the siRNA agent.

[0168] In some embodiments, the siRNA agent includes a sense strand and / or an antisense strand having reverse abasic nucleotides. In one embodiment, the sense strand contains reverse abasic nucleotides at the 3' end. In another embodiment, the sense strand contains reverse abasic nucleotides at the 5' end. In some embodiments, the sense strand contains reverse abasic nucleotides at both the 5' and 3' ends.

[0169] In some embodiments, the siRNA agent comprises a phosphate or a phosphate mimetic at the 5' end of the antisense strand. In one embodiment, the phosphate mimetic is 5'-vinylphosphonate (VP).

[0170] In some embodiments, the siRNA agent comprises one or more modified nucleotides. In specific embodiments, the modified nucleotides are selected from the group consisting of 2'O-methyl modified nucleotides, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, 3'-O-methyl modified nucleotides, 3'-O-methyl modified nucleotides with 2'-5' linked phosphates, reverse abasic nucleotides, nucleotides comprising S-glycol nucleic acids (GNA), unlocked nucleic acids, 5'-vinylphosphonate-2'-O-methyl-uridine, cis-cyclobutylphosphonate modified nucleotides, 5'-cis-cyclobutylphosphonate-2'-O-methyl modified nucleotides, (L)-α-threofuranosyl modified nucleotides, and combinations thereof.

[0171] In some embodiments, the siRNA agent comprises one or more modified internucleoside bonds (i.e., modified RNA backbones). The modified internucleoside bonds include, for example, phosphorothioates (e.g., monothiophosphates). Various salts, mixed salts, and free acid forms are also included. In some embodiments, the siRNA agent described herein is in free acid form. In other embodiments, the siRNA agent described herein is in salt form. In one embodiment, the siRNA agent described herein is in sodium salt form. In certain embodiments, when the siRNA agent described herein is in salt form, the cation of the salt (e.g., sodium cation) is present in the agent in the form of counterions of substantially all electronegative groups (e.g., phosphodiester and / or phosphorothioate groups) present in the agent. In some embodiments, the counterion is a condensed counterion. In a specific embodiment, the counterion is a condensed sodium cation. In some embodiments, the condensed counterion is hydrated. In a specific embodiment, the condensed counterion is a hydrated sodium cation. Reagents in which substantially all phosphodiester and / or phosphorothioate bonds have counterions include no more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate bonds without counterions. In other words, the electronegativity of the siRNA agent is neutralized or substantially neutralized by the counterion condensation around the siRNA. In some embodiments, when the siRNA agent described herein is in the form of a sodium salt, the sodium ions are present around the agent in the form of counterions for substantially all phosphodiester and / or phosphorothioate groups present in the agent.

[0172] The phosphate group of the phosphodiester bond between nucleosides can be modified by replacing one of the oxygens with different substituents. One result of this modification can increase the resistance of the oligonucleotide to nucleic acid degradation. Another result of this modification can improve the stability of the single-stranded RNA (ssRNA) hybridized in the siRNA reagent. The example of the modified phosphate group includes thiophosphate (e.g., monothiophosphate).

[0173] In some embodiments, the siRNA agent comprises an RNA mimetic in which both the sugar and the internucleoside linkage (ie, the backbone) of the nucleotide unit are replaced by alternative groups. In specific embodiments, the base unit is maintained to hybridize with an appropriate target sequence.

[0174] The siRNA agents described herein may contain one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations, which may be defined by absolute stereochemistry as (R) or (S), such as for sugar anomers, or as (D) or (L), such as for amino acids. The siRNA agents provided herein include all such possible isomers, as well as their racemic and optically pure forms.

[0175] Table 33: Modified sense and antisense strand sequences of lipid-conjugated MAPT siRNA (Modifications: mN = 2′OMe; fN = 2′F; ps = phosphorothioate; VP = vinylphosphonate; InvAb = inverted abasic; ccBP = cis-cyclobutylphosphonate; ccBPmU is 5′-cis-cyclobutylphosphonate-2′-O-methyl-uridine; TNA = (L)-α-threofuranosyl; 3mN2-5 = 3′-O-methyl with phosphate attached 2′-5′; J2-CONC16U = L4; J2-CONC16A = L21; J2-CONC16C = L22; J2-CONC16G = L23)

[0176]

[0177]

[0178]

[0179]

[0180] 6.3 Portions linked to nucleotide sequences

[0181] In some embodiments, the siRNA agents described herein are conjugated with one or more non-nucleotide groups. The non-nucleotide groups can, for example, enhance the targeting, delivery or attachment of the siRNA agents. The non-nucleotide groups can be covalently linked to the 3' end, 5' end and / or the interior of the sense strand or antisense strand of the siRNA agent. The non-nucleotide groups can be covalently linked to the 3' end, 5' end, 3' end and 5' end of the sense strand and / or antisense strand of the siRNA agent, the interior, the 3' end and the interior, the 5' end and the interior, or the 3' end, the 5' end and the interior. In some embodiments, the siRNA agents described herein contain non-nucleotide groups covalently linked to the 3' end, 5' end, 3' end and 5' end of the sense strand, the interior, the 3' end and the interior, the 5' end and the interior, or the 3' end, the 5' end and the interior. In certain embodiments, the siRNA agents described herein contain non-nucleotide groups connected to the 5' end of the sense strand. In certain embodiments, the siRNA agents described herein contain non-nucleotide groups connected to the 3' end of the sense strand. In certain embodiments, the siRNA agents described herein contain non-nucleotide groups attached to the interior of the sense strand. The non-nucleotide groups can be attached to the siRNA agent directly or indirectly via a linker / linking group.

[0182] In some embodiments, the siRNA agent is conjugated to one or more lipid moieties, such as cholesterol moieties (e.g., Figure 3 In a specific embodiment, the lipid portion connected to the siRNA agent comprises Figure 3In one or more of the following compounds, or stereoisomers thereof, or pharmaceutically acceptable salts thereof, as shown: L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23 and / or L24. In specific embodiments, the lipid moiety is selected from one or more of the following: L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23 and / or L24 (see Figure 3In specific embodiments, the lipophilic moiety includes cholesterol-triethylene glycol; 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((Z)-octadec-9-en-1-yl)oxy)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; N,N′-((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2,3-diyl)bis(oxy))bis(propane-3,1-diyl))dipalmitamide; N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)palmitamide; (2R ,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropionamide; 1-((2R,3R,4R,5R)-3-(2-(hexadecyloxy)ethoxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; ((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropionamide (2R,3R,4R,5R)-5-(heptadecyloxy)-2-(hydroxymethyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4-(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran-3-ol; (2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4,5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)- 4S,5R)-5,6-bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol; 1-((2R,3R,4R,5R)-3-((15-((3r,5r,7r)-adamantan-1-yl)pentadecyl)oxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione; (1s,4s)-4-heptadecanamidecyclohexane-1-carboxyl-; 16-oxo-16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl)oxy)hexadecanoyl-; 16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl)oxy)hexadecanoyl-;1] heptane-2-yl)oxy) hexadecanoyl-; 15-((3r,5r,7r)-adamantan-1-yl)pentadecanoyl-; 2-(2-(N-hexadecyl palmitamide)-N-methylacetamide)ethanone-; 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxohexadecanoyl-; 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)hexadecanoyl-; -; (2R,3R,4R,5R)-2-(6-amino-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydro-2H-pyran-3-ol. In specific embodiments, the lipid moiety (such as described in Section 7) is conjugated to the sense strand of the siRNA agent in a manner described in Section 7. In some embodiments, the lipid moiety attached to the siRNA agent comprises. Figure 3 One or more of the following compounds as shown: Figure 3 In some embodiments, the lipid moiety is linked to the 3' end, the 5' end, and / or the interior of the sense strand.

[0183] In one embodiment, the sense strand of the siRNA agent is conjugated directly or indirectly to a lipid moiety at the 5' end. In one embodiment, the first nucleotide at the 5' end of the sense strand is linked to a lipid moiety. In one embodiment, the sense strand of the siRNA agent is conjugated directly or indirectly to an internal lipid moiety.

[0184] In one embodiment, the sense strand is conjugated directly or indirectly to the lipid moiety at the 3' end. In one embodiment, the first nucleotide at the 3' end of the sense strand is connected to the lipid moiety. In one embodiment, the first nucleotide at the 3' end of the sense strand is connected to the lipid moiety through a linker. In one embodiment, the linker is a nucleotide linker of 1, 2, 3, 4 or 5 nucleotides in length. In one embodiment, the nucleotide linker is dTdT. In one embodiment, the linker is InvAb.

[0185] In one embodiment, the sense strand is conjugated directly or indirectly to a lipid moiety at the 5' end, and the sense strand is also conjugated directly or indirectly to a lipid moiety at the 3' end, each as described herein and elsewhere. The lipid moieties at the 5' and 3' ends may be the same or different.

[0186] In one embodiment, the sense strand is conjugated directly or indirectly to a lipid moiety at the 5' end, 3' end, and / or internally. The lipid moieties at the 5' end, 3' end, and / or internally may be the same or different.

[0187] In some embodiments, the linking group is conjugated to the siRNA agent. The linking group facilitates the covalent connection of the agent to the targeting ligand or the delivery polymer or the delivery vehicle. The linking group can be connected to the 3' end, the 5' end and / or the interior of the sense strand of the siRNA agent. In some embodiments, the linking group is connected to the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the 5' end, the 3' end and / or the interior of the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the 3' end of the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the interior of the sense strand of the siRNA agent.

[0188] Typically, a linker or linking group is a connection between two atoms that connects a chemical group (such as an siRNA agent) or a segment of interest to another chemical group (such as a targeting group or a delivery polymer) or a segment of interest through one or more covalent bonds. Unstable connections contain unstable bonds. The connection may optionally include a spacer that increases the distance between the two joined atoms. The spacer may further increase the flexibility and / or length of the connection.

[0189] Any siRNA agent nucleotide sequence listed in Table 1, Table 2, Table 3, Table 4, Table 5, Table 9 or Table 33 (whether modified or unmodified) can contain a 3'-end, 5'-end and / or internal targeting ligand and / or linking group. Any siRNA agent duplex listed in Table 1, Table 2, Table 3, Table 4, Table 5, Table 9 or Table 33 (whether modified or unmodified) can also contain a targeting ligand and / or linking group, and the targeting ligand or linking group can be attached to the 3'-end, 5'-end and / or the interior of the sense strand or antisense strand of the siRNA agent duplex.

[0190] 6.4 Synthesis of siRNA Reagents

[0191] siRNA agents can be synthesized by standard methods known in the art, such as those described in "Current protocols innucleic acid chemistry," Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York NY, USA, which is hereby incorporated by reference herein, or described herein (e.g., in Section 7 below). For example, a two-step procedure can be used to prepare siRNA agents. First, each strand of the siRNA agent is prepared separately. Then, the constituent strands are annealed. Each strand of the siRNA agent can be prepared using solution phase or solid phase organic synthesis or both. Organic synthesis provides the advantage that oligonucleotide chains containing non-natural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides can be prepared using solution phase or solid phase organic synthesis or both. Equipment for such synthesis is sold by multiple suppliers, including, for example, Applied (Foster City, Calif.). In some embodiments, the oligonucleotides of the siRNA reagents described herein are synthesized so that they contain reactive groups, such as amine groups, at the 5' end, 3' end, and / or inside. Such reactive groups can be used to subsequently connect ligands (e.g., targeting ligands) using typical methods in the art. In some embodiments, the oligonucleotides of the siRNA reagents are synthesized together with a linking group. The linking group can be used to conjugate a non-nucleotide group (e.g., a lipid moiety, a ligand, or a delivery group) to the siRNA reagent. In some embodiments, the oligonucleotides of the siRNA reagents are synthesized by an automatic synthesizer using phosphoramidites (e.g., standard phosphoramidites and non-standard phosphoramidites, which are commercially available). In a specific embodiment, the siRNA reagent is produced using the method described in Section 7 below. In another specific embodiment, the method described in Section 7 below is used to produce siRNA reagents described herein, including siRNA reagents conjugated to non-nucleotide groups, such as described in Section 6.3 above.

[0192] 6.5. Delivery Vehicles

[0193] In some embodiments, a delivery vehicle can be used to deliver the siRNA agents described herein to cells or tissues.

[0194] 6.6 Composition

[0195] In one aspect, provided herein are compositions comprising an siRNA agent described herein (eg, in Section 6.1 above or Section 7 below). The composition may further comprise a carrier or excipient.

[0196] 6 .7 Uses of siRNA reagents

[0197] The siRNA reagents and compositions of the present invention can be used to suppress the expression of the MAPT gene (e.g., human MAPT gene). As shown in the Examples, the siRNA reagents suppress the expression of the MAPT gene. The siRNA reagents and compositions of the present invention can also be used to suppress the level of Tau. As shown in the Examples, the siRNA reagents suppress the Tau level. Some assays and methods for measuring the MAPT expression level and for measuring tau levels are described herein. Other assays for measuring the MAPT expression level and for measuring tau levels are known in the art.

[0198] Inhibiting MAPT gene expression and / or inhibiting Tau levels can be used to study diseases such as Alzheimer's disease. Tau levels are associated with Alzheimer's disease. The siRNA of the present invention can be used to study how the MAPT gene expression inhibition level affects Tau levels. The siRNA of the present invention can be used in animal models to study how the MAPT gene expression inhibition level affects Tau levels. The siRNA of the present invention can be used to study how the MAPT gene expression level and / or Tau levels affect one or more symptoms of Alzheimer's disease.

[0199] In one aspect, a method for suppressing the expression of a MAPT gene (e.g., human MAPT gene) in a cell is provided herein, comprising contacting a cell with a siRNA reagent as described herein or a composition comprising a siRNA reagent as described herein. In a specific embodiment, a method for suppressing the expression of a MAPT gene (e.g., human MAPT gene) in a cell group is provided herein, comprising contacting a cell group with a siRNA reagent as described herein. The contact between a cell and a siRNA reagent as described herein can be direct or indirect. For example, a cell can be physically contacted with a siRNA reagent, or a cell can be allowed to enter a situation that allows or causes it to contact with a siRNA reagent subsequently.

[0200] The expression of MAPT gene (for example, human MAPT gene) can be measured directly or indirectly. For example, the level of MAPTRNA (for example, pre-mRNA level, mRNA level or both), the level of protein encoded by the MAPT gene, the function of protein encoded by the MAPT gene or their combination can be measured. Alternatively or additionally, the expression of a gene indirectly or directly affected by the expression of the MAPT gene can be measured, the function of protein indirectly or directly affected by the expression of the MAPT gene or their combination. See, for example, Section 6.8 below, about the method that can be used for directly or indirectly measuring the expression of the MAPT gene.

[0201] 6.8 Bioassay

[0202] Bioassays known to those of skill in the art or described herein (e.g., in Section 7 below) can be used to evaluate the ability of the siRNA agents described herein to inhibit MAPT gene expression, the specificity of the siRNA agents described herein, the stability of the siRNA agents described herein, the off-target effects of the siRNA agents described herein, the toxicity of the siRNA agents described herein, the localization of the siRNA agents to specific tissues, the pharmacokinetics of the siRNA agents, and the immunogenicity of the siRNA agents described herein.

[0203] In some embodiments, MAPT gene expression is measured at RNA or protein level. The expression level of MAPT gene can be assessed by any method known in the art for measuring RNA. In certain embodiments, RNA can be isolated from sample by RNA extraction method (e.g., organic extraction, membrane-based spin column and paramagnetic particle technology). In certain embodiments, MAPT RNA level can be measured by UV spectroscopy, in situ hybridization, fluorescence in situ hybridization (FISH), Northern blot, microarray, RT-PCR, qPCR, quantitative and gel electrophoresis based on fluorescent dyes. MAPT protein expression level can be measured by any method known in the art for characterizing protein. In certain embodiments, MAPT protein can be purified by salt precipitation, dialysis and chromatography (e.g., gel filtration, ion exchange, affinity purification). In certain embodiments, the crude sample containing MAPT protein or purified MAPT protein can be characterized by UV absorption and spectroscopy, electrophoresis, capillary electrophoresis, chromatography (e.g., gel filtration, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), high diffusion chromatography), mass spectrometry. In certain embodiments, the crude sample containing MAPT protein or the MAPT protein of purification can be characterized by flow cytometry, immunodiffusion, immunoelectrophoresis, western blot, immunoblot, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay etc. In some embodiments, the function of the protein encoded by the MAPT gene can be assessed to measure the expression of the gene. For example, microtubule polymerization and / or microtubule stabilization of the protein encoded by the MAPT gene can be assessed. The gene expression of the cell contacted with the siRNA reagent in vitro or in vitro can be assessed.

[0204] In some embodiments, the function (eg, microtubule stabilization) of the Tau protein encoded by the MAPT gene is assessed using assays known to those skilled in the art. Normal Tau has multiple functions, the most well-established of which is microtubule stabilization.

[0205] In some embodiments, indirect measurement can be used to assess the MAPT gene expression level, which includes the expression of certain genes, the functional determination of downstream proteins and the reporter gene determination. In some embodiments, the expression of the MAPT gene can be assessed by detecting the expression of the protein regulated by the expression of the MAPT gene. In certain embodiments, the expression of the MAPT gene can be assessed by detecting the function of the protein regulated by the expression of the MAPT gene. In some embodiments, a reporter gene can be introduced to promote the expression of the indicated target. For example, the reporter gene regulated by the protein downstream of the protein encoded by the MAPT gene can indicate the expression level of the MAPT gene. The reporter gene can include a FLAG tag, green fluorescent protein (GFP), a chloramphenicol acetyltransferase gene (cat) from the Tn9 of Escherichia coli, a luciferase gene (luc) and β-glucuronidase (GUC) from the firefly Photinuspyralis. The protein easily detected by the reporter gene encoding indicates the MAPT gene expression level. The reporter gene determination can include a fluorescence-based determination, for example, fluorescence spectroscopy, fluorescence immunoassay, flow cytometry, fluorescence spectroscopy and ELISA.

[0206] In some embodiments, the specificity of the siRNA agent can be analyzed by the effect produced by the inhibitory gene or the off-target gene it targets. The effect includes inhibiting the expression of the MAPT gene, wherein the siRNA agent is at half the maximum inhibitory concentration (i.e., IC 50 ) shows its effectiveness. In terms of effectiveness, using IC 50 In some embodiments, the siRNA agents described herein have an IC value of 10 nM to 200 nM in neurons (e.g., human iPSC neurons). 50In certain embodiments, the specificity of siRNA reagents is tested using negative controls, wherein scrambled or random sequences can be used. siRNA reagents that do not affect negative targets can be characterized as specific. In certain embodiments, the specificity of siRNA reagents is tested using a single target gene. Different siRNA reagents with comparable gene inhibition efficacy for the same gene should induce similar changes in gene expression profiles or phenotypes. Any changes induced by one siRNA reagent rather than other reagents can be attributed to off-target effects or non-specificity. In certain embodiments, the specificity of siRNA reagents is tested using titration. When siRNA reagents are used at lower concentrations, non-specific effects are alleviated. siRNA reagents that exhibit lower effective concentrations can have higher specificity. In certain embodiments, the specificity of siRNA reagents is tested by monitoring RNA and protein levels. For example, the reduction of RNA genes observed without a corresponding decrease in protein levels indicates that protein conversion is slow. The siRNA reagents studied may have off-target effects. In some embodiments, transcriptome assays can be used to assess off-target effects.

[0207] In some embodiments, based on agarose gel electrophoresis The resonance energy transfer (FRET) method is used to assess the stability of siRNA agents in biological samples or fluids (e.g., serum or cerebrospinal fluid samples). See, for example, Tuttolomondo and Ditzel, 2021, Methods Mol Biol 2282: 43-56 for a description of this assay. In some embodiments, this assay is also used to assess the interaction of siRNA agents described herein with serum proteins and enzymes. In certain embodiments, an agarose gel migration assay is used to assess the stability of siRNA agents described herein in biological samples or fluids (e.g., serum or cerebrospinal fluid samples).

[0208] In some embodiments, the stability of siRNA agents can be studied under a variety of conditions, including temperature and RNase degradation in biological fluids. In some embodiments, equimolar concentrations of the two strands are used by monitoring the A 260 To measure the thermal melting temperature of siRNA reagents. m The melting curve (A) of the prehybridized duplex was measured. 260 In terms of thermal stability, a stable unmodified RNA may have a T of 40°C to 60°C. m. The modified RNA can be stabilized or destabilized at about 10°C. In some embodiments, the stability of the siRNA agent to RNAse degradation is determined by incubation with different biological fluids. For example, serum stability can be determined by incubating with fetal bovine serum or human serum at 37°C for different time periods of up to 48 hours. The RNA in the sample can be detected by Northern blotting, in situ hybridization, qPCR, and any RNA detection method known in the art. The activity of the siRNA agent can be tested. Stable siRNA agents may show slight degradation within 24 hours at 37°C. In some embodiments, the siRNA agent exhibits sufficient stability for at least 2 hours. In other embodiments, the stability of siRNA agents exposed to, but not limited to, skin, sage, topical ointments, or nanoparticles can be tested.

[0209] In specific embodiments, the stability of siRNA agents described herein in human liver lysosomes and rat liver trisomes is assessed as described in Section 7, below.

[0210] In some embodiments, the toxicity of siRNA reagents to in vitro or ex vivo cell-based models is studied. In certain embodiments, toxicity is assessed by the degree of damage to cells caused by siRNA reagents. Damage can be necrosis (uncontrolled cell death), apoptosis (programmed cell death), autophagy, or stop active growth and division to reduce cell proliferation. In certain embodiments, cytotoxicity assays are performed to measure the ability of siRNA reagents to cause cell damage or cell death. For example, the release of lactate dehydrogenase (LDH) and glucose 6-phosphate dehydrogenase (G6PD) can be used as a biomarker for cytoplasmic membrane damage. In another embodiment, cell viability, such as membrane integrity, enzymatic activity, or metabolic activity, can be detected by a variety of mechanisms under the treatment of siRNA reagents.

[0211] In some embodiments, RNA in situ hybridization assays can be used to image siRNA agents and assess inhibition of MAPT gene expression in a tissue sample from a subject. Can be used, for example, in RNA in situ hybridization assays.

[0212] In some embodiments, the siRNA agents described herein are used to study Alzheimer's disease in an animal model (e.g., a mouse model). Animal models are known in the art. In a specific embodiment, the animal model is the animal model described in Section 7 below.

[0213] 7. Examples

[0214] 7.1 Example 1: siRNA Synthesis

[0215] Table 1 provides the unmodified sense and antisense strand nucleotide sequences of siRNA targeting human MAPT (Gene ID: 4137). Table 2 provides the chemical modifications applied to the siRNA sequences in Table 1, including 2'-fluoro, 2'-O-methyl and phosphorothioate.

[0216] Table 1: Unmodified sense and antisense strand nucleotide sequences (5′ to 3′)

[0217]

[0218] Table 2: Modified sense and antisense strand nucleotide sequences (5′ to 3′)

[0219] (Modifications: mN = 2'OMe; fN = 2'F; ps = phosphorothioate)

[0220]

[0221] Synthesis of MAPT siRNA duplexes

[0222] Human MAPT siRNA was synthesized and annealed as follows. Briefly, single-stranded sense and antisense oligonucleotides were synthesized on a Dr. Oligo 192 synthesizer (Biolytic Lab Performance) using standard solid phase phosphoramidite chemistry at a 0.2 μmol scale. ) as the first base to load or UnyLinker TM Solid support. Detritylation was performed using 3% dichloroacetic acid in dichloromethane. 2'-OMe and 2'-F modified nucleotides were coupled using the corresponding phosphoramidites. 5-Ethylthio-IH-tetrazole (ETT) was used as an activator (0.25M in acetonitrile), and the coupling time for all phosphoramidites was 6-8 minutes. A 0.2M solution of hydrogenated xanthane in anhydrous pyridine was used to generate a thiophosphate bond. A 0.02M tetrahydrofuran solution containing 10% water was used, and the oxidation time was 3 minutes.

[0223] After synthesis, the solid support was transferred to a 1.5 mL vial. Cleavage and deprotection were performed using 500 μL AMA (concentrated ammonia / 40% methylamine aqueous solution, v / v=1:1). After cleavage and deprotection were completed, the sample was filtered to remove the solid support and washed once with water. The sample was purified using a 6 mL Source15Q ion exchange column (Cytiva) on an AKTA purification system equipped with an autosampler and a fraction collector. The fractions were analyzed by LC-MS to confirm the quality. The appropriate fractions were combined and desalted with a CentriPure P10 column (emp Biotech). Samples of each sequence were analyzed by LC-MS to confirm identity, quantified by UV (260 nm), and purity determined by IP-RP chromatography. Duplex annealing was performed by mixing equimolar sense single strands and antisense single strands. The final duplex sample solution was dried under vacuum using a GeneVac evaporator (SP Scientific). Final QC specifications were ±0.05% of calculated mass for single-strand identity (by LC / MS), >85% full-length oligonucleotide for single-strand purity (by HPLC), and >90% for duplex purity (by native HPLC).

[0224] siRNA-lipid conjugation

[0225] A subset of siRNA compounds were synthesized at different positions (5' / 3' ends or internal) with different novel lipid conjugates. Lipids were incorporated into the sense strand by on-column and / or post-column synthesis. For on-column synthesis, the lipid moiety was modified at the corresponding phosphoramidite monomer or CPG, followed by solid phase phosphoramidite chemistry as described above to synthesize sense strands with 5' / 3' end and / or internal lipid conjugates. For post-column synthesis, lipids were introduced into the solution phase along with their corresponding N-hydroxysuccinimide esters and additional amine linkers of nucleotides.

[0226] On-column synthesis

[0227] For example, the on-column introduction of compound 2 is performed at the 3′ end of the sense strand using a 3′-amino modifier (such as 2-dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-1-succinyl)-long chain alkylamino-CPG 1) (Scheme 1). After deprotection of the Fmoc group with a 20% piperidine solution in DMF, the CPG is washed thoroughly with DMF, MeCN, ether and dried. A solution of 80 μmol of compound 2 in 2 ml of 1,4-dioxane is added to the above CPG, followed by the addition of 30 μl of DIPEA and shaking for 12 hours to generate compound 3. The CPG is washed with DCM, MeCN and Et2O. 1 ml of a solution of CAP A and CAP B is added and shaken for 30 minutes. Compound 3 is washed with DCM, MeCN, Et2O and used for oligonucleotide synthesis after drying. In order to synthesize oligonucleotides conjugated with cholesterol at the 3′ end, 3′-cholesterol-TEG CPG is used.

[0228] Solution 1

[0229]

[0230] Compound 2 was introduced at the 5' end of the sense strand using a 5'-amino modifier such as 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N'-diisopropyl)-phosphoramidite. After the sense strand was synthesized on CPG according to standard procedures, in the penultimate step, the 5' end of the sense strand was coupled with 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite, followed by deblocking of the 4-monomethoxytrityl group with 3% DCA / DCM for 30 minutes. CPG was then washed with DCM, ACN and coupled with compound 2 for 12 hours (Scheme 2), followed by strand cleavage and deprotection.

[0231] Solution 2

[0232]

[0233] During the synthesis of the sense strand, the adamantane lipid is introduced into the internal position together with the corresponding phosphoramidite monomer. For example, Scheme 3 illustrates this with the uridine-based phosphoramidite monomer 7.

[0234] Solution 3

[0235]

[0236] After synthesis, cleavage and deprotection, lipid-conjugated oligonucleotides were purified by reverse phase or ion exchange chromatography. The buffer for reverse phase was 0.05 M sodium acetate (buffer A) and acetonitrile (buffer B) in 90% / 10% water / acetonitrile, and the buffer for ion exchange was 20 mM sodium phosphate in 90% / 10% water / acetonitrile (buffer A) and 20 mM sodium phosphate, 1.8 M sodium bromide in 90% / 10% water / acetonitrile (buffer B). The fractions containing the full-length oligonucleotides were combined, desalted, and the compounds were analyzed by LC-MS.

[0237] Post-column synthesis

[0238] After purification and desalting of the corresponding oligonucleotides, lipids were conjugated at the 5' / 3' terminal positions and internal positions of the sense strand in solution phase.

[0239] For example, incorporation at an internal position is performed using a phosphoramidite monomer derivatized with an amine linker at the 2' position of the corresponding nucleotide. Scheme 4 illustrates this using a uridine-based phosphoramidite monomer compound 9. After incorporation of compound 9 at an internal position and completion of the synthesis, cleavage and deprotection, purification and desalting processes, the free oligonucleotide with a side chain amine is coupled with the corresponding lipid-NHS ester in solution phase.

[0240] Solution 4

[0241]

[0242] Conjugation at the terminal / internal position was performed with 0.15 mM deprotected and desalted oligonucleotide solution in 0.1 M NaHCO3 solution (pH 8.4) and 1.5 mM corresponding lipid-NHS ester solution in DMF at 60°C. A DMF solution (0.6 mL) of lipid-NHS ester was added to the oligonucleotide solution (0.25 mL), and the resulting mixture was heated at 63°C. Progress was monitored by RP-HPLC (C-18 column, A: 50 mM TEAA, B: MeCN; gradient 5%-100% B, 30°C). The reaction was usually more than 90% complete in less than one hour. The reaction mixture was diluted with water and purified by RP-HPLC (C-8 Xbridge Waters column; A: 50 mM NaOAc, B: MeCN; 5%-100% B gradient, 60°C). The isolated yield of lipid-conjugated oligonucleotides was 60%-70%. After purification, the product was desalted and double annealed as described above.

[0243] 7.2 Example 2: In vitro screening of MAPT siRNA

[0244] The screening of the MAPT siRNA agents listed in Table 2 was performed in transfected human neuroblastoma cells according to the following protocol. Table 6 shows the remaining MAPT mRNA in human neuroblastoma cells after transfection with siRNA at concentrations of 20 nM and 200 pM. A panel of 25 siRNA hits was selected and evaluated for potency in transfected human neuroblastoma cells at 4-fold serial dilutions at concentrations of 2 nM, 500 pM, 125 pM, 31.25 pM, 7.81 pM, 1.95 pM, 0.49 pM, 0.12 pM, 0.03 pM and 0.0076 pM. Table 7 summarizes the IC values ​​of the indicated siRNAs. 50 Values ​​and their 95% confidence intervals.

[0245] Table 6: Screening of MAPT siRNA in transfected human neuroblastoma cells. Data are expressed as MAPT mRNA levels. The percentage of the vehicle control .

[0246]

[0247] Cell culture and transfection :

[0248] Human neuroblastoma Kelly cells (DSMZ) were cultured in RPMI 1640 (Sigma R0883) supplemented with 10% FBS (Biowest S1810-500), 2mM L-glutamine (Sigma G7513) and 50μg / mL gentamicin (Gibco 15750) in a 37°C incubator with 5% CO2. One day before transfection, cells were split using 0.05% trypsin-EDTA (Gibco 25300) and seeded in 96-well plates at a density of 30,000 cells per well. The next day, cells were transfected with siRNA using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific 13778150) according to the manufacturer's protocol. Prior to RNA isolation, cells were cultured in a 37°C incubator in 5% CO2 for 72 hours.

[0249] Total RNA isolation :

[0250] RNA extraction was performed using the RNeasy 96 kit (Qiagen) according to the manufacturer's protocol. In short, 125 μL RLT buffer was added to each well of a 96-well plate, and the cells were lysed with an orbital shaker at 200 rpm for 1 minute, and the cell plates were then transferred to a -80 °C refrigerator for storage until analysis. On the day of RNA extraction, the frozen cell plates were quickly thawed in a 37 °C oven, and an equal volume of 125 μL of 70% (V / V) ethanol was added to each well immediately after thawing to mix with the RLT lysate. The mixture was then transferred to the wells of the RNeasy 96 plate placed on top of a QIAvac 96 vacuum block, and RNA was bound to the RNeasy 96 plate membrane by applying vacuum until the liquid transfer was complete. The RNeasy 96 plate was subjected to a continuous washing step, including 1 time of 800 μL RW1 buffer, 2 times of 800 μL RPE buffer, and vacuum was used to remove the liquid. After the last wash, the RNeasy 96 plate was centrifuged at 5600 × g for 3 minutes to remove residual lipids. RNA was eluted using 60 μL RNase-free water by centrifugation at 5600×g for 3 minutes at room temperature. RNA concentration was measured by Nanodrop 8000 (ThermoFisher). Eluted RNA was stored at −80° C. until analysis.

[0251] Reverse transcription and real-time PCR:

[0252] RNA was used as a template for reverse transcription, and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's protocol. Briefly, the final reaction of 20 μL of the mixture was incubated at 25°C for 10 minutes, followed by reverse transcription at 37°C for 2 hours and enzyme inactivation at 85°C for 5 minutes. For qPCR reactions, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp TM SYBR TM Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers were mixed to a final reaction volume of 10 μL. TM 12K instrument (Applied Biosystems TM ) qPCR was run using a standard thermal cycling protocol. MAPT mRNA was detected using a variety of validated primers, and gene expression was normalized using reference primers targeting housekeeping genes ENOX2 and GAPDH. Primer sequences are listed in Table 8. qPCR data were analyzed using qBase+ software (Biogazelle). IC was calculated by fitting the normalized response curve with log([drug]) using GraphPad Prism version 7.00 software.50 Value and IC 50 95% CI of .

[0253] 7.3 Example 3: Evaluation of in vitro knockdown efficiency of siRNA conjugates in human iPSC-derived neurons

[0254] The in vitro knockdown efficiency of lipid-siRNA conjugates was evaluated in human iPSC-derived cortical neurons following the procedure described below.

[0255] Tables 18 to 19 show that the cholesterol-siRNA conjugates listed in Table 9 knocked down MAPT mRNA and Tau protein in human iPSC neurons in a dose-dependent manner after 7 or 14 days of incubation. Data are expressed as the remaining MAPT mRNA (relative to the control) or the remaining Tau protein (relative to the control). Mean ± SD, n = 3. IC was calculated by fitting the normalized response curve by log ([drug]) using GraphPad Prism version 7.00 software 50 (95% CI) values.

[0256] Table 9: Sequences and modifications of cholesterol-siRNA conjugates

[0257] Modifications: mN = 2′OMe; fN = 2′F; ps = phosphorothioate; VP = vinylphosphonate; invAb = inverted abasic

[0258]

[0259] Table 18: Knockdown of MAPT mRNA in human iPSC neurons

[0260] <![CDATA[IC 50 (95%CI)]]> M25-Chol 3.557e-008 to 4.567e-008 MsiR266-Chol 2.281e-008 to 3.319e-008

[0261] Table 19: Knockdown of MAPT mRNA in human iPSC neurons

[0262] <![CDATA[IC 50 (95%CI)]]> M28-Chol 4.981e-009 to 6.568e-009

[0263] Table 20: Knockdown of Tau protein in human iPSC neurons

[0264] <![CDATA[IC 50 (95%CI)]]> M25-Chol 4.156e-008 to 6.211e-008 M28-Chol 9.552e-009 to 1.618e-008 MsiR266-Chol 1.892e-008 to 3.958e-008

[0265] Tables 10 and 11 summarize the efficiency of cholesterol-siRNA conjugates with various chemical modifications (listed in Table 4) in knocking down MAPT mRNA in human iPSC neurons after 7 days of incubation. Data are expressed as the remaining MAPT mRNA relative to the control. Mean ± SD, n = 3.

[0266] Figure 1 A to Figure 1 B and Figure 2 A to Figure 2B shows that cholesterol-siRNA conjugates or lipid-siRNA conjugates with various chemical modifications (listed in Table 4 and Table 23) knock down MAPT mRNA and Tau protein in human iPSC neurons in a dose-dependent manner after 7 days of incubation. Data are expressed as remaining MAPT mRNA (relative to control) or remaining Tau protein (relative to control). Mean ± SD, n = 3. IC was calculated by fitting the normalized response curve by log ([drug]) using GraphPadPrism version 7.00 software 50 (95% CI) values.

[0267] Tables 12 to 14 summarize the efficiency of MAPT siRNA conjugated to different lipids (listed in Table 5) in knocking down MAPT mRNA in human iPSC neurons after 7 days of incubation. Three concentrations of siRNA conjugates of 1 μM, 200 nM and 40 nM were tested. Data are expressed as the remaining MAPT mRNA relative to the control. Mean ± SD, n = 3.

[0268] Differentiation of human iPSCs into cortical neurons

[0269] The human iPSC line (Sigma # iPSC0028) was derived by OSKM retroviral reprogramming of epithelial cells from a 24-year-old Caucasian female donor. iPSCs were first differentiated into cortical neural stem cells (NSCs) according to a dual SMAD inhibitor protocol with some modifications (Shi et al., 2012, 2012, Nat. Proc. 7(10): 1836-46). Briefly, iPSCs were plated at 500,000 cells / cm 2The cells were plated on wells coated with Matrigel (Corning 354230) in mTeSR medium (StemCell Technologies 5850) supplemented with 10 μM ROCK inhibitor (Sigma-Aldrich Y0503) and cultured at 37° C. and 5% O 2 . The medium was replaced with mTeSR the next day (Day -1). From day 0 to day 12, the cell culture medium was replaced daily with cortical neural induction medium consisting of 10 μM SB43142 (Tocris 1614) and 1 μM Dorsomorphin (Tocris 3093) supplemented with neural maintenance medium (1:1 DMEM:F12 Glutamax (ThermoFisher Scientific 10565108), Neurobasal (ThermoFisher Scientific 21103049), 2.5 μg / mL insulin (Sigma-Aldrich I9278-5ML), 50 μM 2-mercaptoethanol (ThermoFisher Scientific, 31350010), 0.5% non-essential amino acids (ThermoFisher Scientific 11140035), 0.5% GlutaMAX supplement (ThermoFisher Scientific, 10565018), 0.5 mM sodium pyruvate (ThermoFisher Scientific 11360070), 1% penicillin-streptomycin (Sigma P4333), 0.5% N2 supplement (ThermoFisher Scientific 17502048), 1% B27 supplement (ThermoFisher Scientific 17504044). On day 12, the neuroepithelial sheets were gently dissociated into large clumps of 300 to 500 cells using a needle and lifter, and the clumps were collected in a 15 mL falcon by centrifugation at 160 g for 2 minutes. The cell pellet was gently resuspended in neural induction medium and passaged 1 / 2 or 1 / 3 into wells coated with 10 μg / mL laminin (Sigma-Aldrich L2020) in a total volume of 2 mL neural induction medium per well in a 6-well plate. On days 13 and 15, the medium was changed to medium supplemented with 20 ng / mL FGF2 (Stemcell Technologies On day 17, neural rosettes were dissociated using dispase (ThermoFisher Scientific 17105041), passaged 1 / 3, and seeded into laminin-coated wells.1 or 2 additional dispersion steps were performed for one week. At approximately day 25-30, neural stem cells were dissociated into single cell suspensions using Accutase (ThermoFisher Scientific A1110501) and cryopreserved in freshly prepared neural freezing medium containing neural maintenance medium supplemented with 10% (V / V) DMSO and 20 ng / mL FGF2. Cryovials of neural stem cells were stored in liquid nitrogen until use.

[0270] To generate iPSC neurons, cryopreserved vials of neural stem cells (NSCs) were thawed and plated at 70,000 cells / cm 2 Seed in laminin coated wells, the wells are filled with neural maintenance medium supplemented with 10 μM ROCK inhibitor and 20 ng / mL FGF2. In the next two days, the medium is replaced with neural maintenance medium every day. About the 4th day after thawing, the cells are dissociated with Accutase and placed in a 96-well plate pre-coated with poly-L-ornithine and laminin at 28,000 cells / well in neural maintenance medium supplemented with 10 μM ROCK inhibitor. The next day after re-plating, the medium is replaced with neural differentiation medium, which is composed of neural maintenance medium supplemented with 20 ng / mL BDNF (R&D Systems 212-BD-050 / CF), 20 ng / mL GDNF (R&D Systems 212-GD-050 / CF), 500 μM DB-cAMP (Sigma D0627) and 20 mM ascorbic acid (Sigma A4403). Cultures were differentiated in neural differentiation medium with 50% medium changes twice a week. After two to three weeks of differentiation from neural stem cells (NSCs), neurons were treated with siRNA for 7 or 14 days and analyzed for RNA by reverse transcription and real-time PCR and for protein by MSD immunoassay.

[0271] MSD immunoassay

[0272] Differentiated human iPSC neurons were plated in 96-well plates supplemented with cOmplete TM Protease inhibitor cocktail (Roche) and PhosSTOP TM(Roche) in 100 μL of ice-cold RIPA buffer (Sigma) at 4°C with slow orbital shaking for 30 minutes. The plate was centrifuged at 1,000 × g for 5 minutes, and the cell lysate was collected and diluted different times (20, 50 or 100) and then protein measurement was performed using MSD immunoassay according to standard procedures. Briefly, MSD plates were coated with 30 μL of coating antibody diluted in PBS at 1 μg / mL per well and placed at 4°C overnight. The next day, the plate was inverted on absorbent paper to dry, and then incubated with 150 μL of 0.1% casein blocking buffer per well for 2 hours at room temperature while orbital shaking at 300 rpm. After blocking, the plate was incubated with 4% paraformaldehyde in PBS supplemented with cOmplete TM Cell lysates diluted in RIPA buffer with protease inhibitor cocktail (Roche) were incubated overnight at 4°C with slow orbital shaking. The plates were washed 5x using a Titertek Aquamax 4000 and inverted on absorbent paper to dry. Then, 25 μL / well of secondary or detection antibody diluted in 0.1% casein was added to the MSD plate and incubated for 2 hours at room temperature. After antibody incubation, the plates were washed 5x and developed with 150 μL / well 2x MSD reading buffer (Meso Scale Discovery) diluted in milliQ H2O. The plate was read immediately using an MSD instrument. For measurement of Tau protein, hTau43 antibody (Janssen) was used to coat 96-well MSD plates and SULFO-TAG TM Labeled hTau60 antibody (Janssen) was used for detection. For the measurement of histone H3 protein, recombinant rabbit monoclonal antibody 17H2L9 (ThermoFisher) was used for plate coating, mouse mAb 14221BF (Cell Signaling Technology) was used as primary detection, and SULFP TAG-labeled anti-mouse antibody (Meso Scale Discovery) was used as secondary detection antibody.

[0273] 7.4 Example 4: In vitro stability assessment of siRNA conjugates in various matrices

[0274] The in vitro stability of siRNA conjugates in various matrices including mouse brain homogenate, human liver lysosomes, and rat liver trisomes was assessed using the following method. The results of the analysis are provided in Tables 15 to 17.

[0275] Tables 15 to 17 and 24 to 26 summarize the LC-MS measurements of antisense and sense strand stability of siRNA conjugates (listed in Table 4, Table 5, and Table 23) in mouse brain homogenates (Tables 15 and 24), human liver lysosomes (Tables 16 and 25), and rat liver trisomy (Tables 17 and 26) after incubation at 37° C. with shaking at 450 rpm for 24 hours. Reference compound MSC-2-V was added to the assay to benchmark the stringency of the assay conditions.

[0276] Table 4: Modified nucleotide sense and antisense strand sequences (5' to 3')

[0277] Modifications: mN = 2′OMe; fN = 2′F; ps = phosphorothioate; VP = vinylphosphonate; invAb = inverted abasic

[0278]

[0279]

[0280]

[0281]

[0282]

[0283] Table 5: Modified sense and antisense strand nucleotide sequences (5′ to 3′)

[0284] Modifications: mN = 2'OMe; fN = 2'F; ps = phosphorothioate; VP = vinylphosphonate; InvAb = inverted abasic

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291] Stability of siRNA conjugates in mouse brain homogenates

[0292] Frozen brain tissue collected from C57BL / 6J wild-type mice was homogenized at 200 mg / mL tissue concentration in ice-cold homogenization buffer containing 100 mM Tris-HCl, pH 6.0 buffer, supplemented with 1 mM MgCl2. 1 mL of ice-cold homogenization buffer was added to a 2 mL tube containing lysed matrix D and one mouse brain hemisphere (MP Biomedicals). TM ), and then in The tube was processed in the instrument at a speed of 5 m / s for 30 seconds to homogenize the tissue. The sample was placed on ice for 2 minutes and passed through The instrument was repeated for 2 rounds. 100 μL of homogenate was added to each well of a 96-well PCR plate, and 5 μL of 20 μM siRNA conjugate was added to each well (the final concentration in the reaction was 1 μM), leaving an equal number of blank wells containing brain homogenate without adding siRNA conjugate. The PCR plate containing the sample was placed in a Thermomixer and incubated at 37 ° C for 24 hours with shaking at 450 rpm. After the reaction, the PCR plate was placed on ice until the sample cooled, and 5 μL of 20 μM siRNA conjugate was added to the blank well containing brain homogenate (0 hour sample). The sample was diluted in 300 μL 10mM EDTA (4-fold dilution) containing 1 μg / mL internal standard oligonucleotide, and the diluted sample was transferred to a deep well 96-well plate. After thorough mixing, 50 μL of the sample was transferred to another deep well 96-well plate, and then the solid phase extraction procedure was started.

[0293] Stability of siRNA conjugates in human liver lysosomes and rat liver trisomes

[0294] Human liver lysosomes (Xenotech H0610.L) or rat liver trisomy are thawed and diluted to 0.05 units / mL or 0.5 units / mL acid phosphatase levels in 20mM sodium citrate pH 5.0 buffer. 50 μL aliquots of diluted human liver lysosomes or rat liver trisomy are added to each well of 96-format PCR plates, and 5 μL 10 μM siRNA conjugates (final concentration in the reaction is 1 μM) are subsequently added to each well. Leave an equal number of blank wells containing lysosomes or trisomy without adding siRNA conjugates. The PCR plate equipped with samples is placed in a Thermomixer and incubated at 37°C for 24 hours with 450rpm shaking. After the reaction, the PCR plate is placed on ice until the sample cools, and 5 μL 10 μM siRNA conjugates (0 hour samples) are added to the blank wells containing lysosomes or trisomy. The sample was diluted in 300 μL 10 mM EDTA (4-fold dilution) containing 1 μg / mL internal standard oligonucleotide and the diluted sample was transferred to a deep-well 96-well plate. After thorough mixing, 50 μL of the sample was transferred to another deep-well 96-well plate and the solid phase extraction procedure was started.

[0295] Sample preparation before solid phase extraction

[0296] After the stability assay, 50 μL of sample was digested by adding 10 μL of proteinase K solution (A4392,0010; PanReac Applichem) and 100 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA) pH 8.0 (VWR; E112-500ml), and incubated at 60° C. with vortexing at 1100 rpm for 30 minutes. After incubation, the sample was diluted by adding 100 μL of lysis buffer (Phenomenex, CatAL0-8579) and 200 μL of equilibration buffer (3.45 g Na2HPO4 in 500 mL of water, adjusted to pH 5.5 with 1 N NaOH).

[0297] Solid Phase Extraction

[0298] Then use Clarity OTX solid phase extraction plate (Phenomenex, Cat.8E-S103-EGA) for solid phase extraction. The plate is adjusted with 1mL methanol, followed by 1mL equilibrium buffer (3.45gNa2HPO4 in 500mL aqueous solution, adjusted to pH 5.5 with 1N NaOH), and then the sample is loaded on the column. The column is then washed 3 times with 1mL washing buffer (equilibrium buffer pH5.5, 50% v / v acetonitrile), then washed once with 0.5mL water, and then washed once in 100mM ammonium bicarbonate pH 10 supplemented with 0.56g / LTCEP (tris (2-carboxyethyl) phosphine). The sample is eluted 3 times with 0.5mL elution buffer (200mM ammonium bicarbonate pH 10, supplemented with TCEP (tris (2-carboxyethyl) phosphine), 50% v / v acetonitrile) and dried using a nitrogen stream (TurboVap, 65psi N2, 70°C).

[0299] Analytical methods

[0300] After SPE, samples were reconstituted in lysis buffer (300 μL 100 mM ammonium bicarbonate pH 10, 10% v / v acetonitrile) and analyzed using liquid chromatography coupled to mass spectrometry detection on an AB Sciex TripleTOF 6600. Samples (20 μL) were injected and lysed using a DNAPac® maintained at 75°C. TM RP column 50 mm × 2.1 mm, 4 μm was used for separation. Mobile phase A was 0.2% dimethylbutylamine, 0.5% hexafluoroisopropanol and 0.5% methanol, and mobile phase B was acetonitrile / isopropanol (95 / 5; v / v). Solvent gradient: time = 0 min, 98% A + 2% B; time = 1.5 min, 98% A + 2% B; time = 4.5 min, 5% A + 95% B; time = 7.5% A + 95% B; time = 7.01 min, 98% A + 2% B; time = 10 min, 98% A + 2% B. The ESI source was operated in negative ion mode, full scan, using spray voltage = 4500 V, source temperature = 350 ° C. Flow rate = 0.25 mL / min. AnalystTF 1.8.1 software was used for data acquisition and Sciex OS 1.7.0 software was used for data processing.

[0301] 7.5 Example 5: Evaluation of in vivo knockdown efficiency of siRNA conjugates in a mouse model

[0302] The in vivo knockdown efficiency of lipid-siRNA conjugates was evaluated by intracerebroventricular (ICV) injection in a mouse model according to the following procedure.

[0303] After 7 days of single ICV injection of M28_Var1, M28_Var39, M28_Var40, M28_Var41, M28_Var42, M28_Var50 at 15 nmol, MAPT mRNA in seven brain regions (cortex, hippocampus, brainstem, cerebellum, striatum, midbrain and cervical spinal cord) from hTAU KI mice was evaluated. Compounds are listed in Table 21, and results are listed in Table 22. Data are expressed as residual MAPT mRNA (%). Mean ± SD, n = 6 mice / treatment group.

[0304] Mice and intracerebroventricular injection

[0305] Male and female PS19 mice (C57BL6; Prnp-MAPT*P301S) or hTau KI (C57BL6; hMAPT: knock-in) mice aged 2 to 3 months were randomly assigned to different treatment groups. Mice were anesthetized with isoflurane (induction: 4%-5%; maintenance: 1.8%-2.5%). They were then stereotaxically injected into the bilateral ventricles using an electric drill and a microinjection robot (Neurostar, Germany, SterodriveSofeware v 2019) with coordinates: AP: -0.62mm, ML: + / -1.05mm, and DV: 2.2mm. The volume of each injection was 5 μL for 5 minutes, and the needle was removed in three steps after injection (1. 1mm was removed within 60 seconds and maintained for 5 minutes; 2. 0.5mm was removed within 30 seconds and waited for 5 minutes; 3. It was removed from the brain at a very slow speed) to avoid the compound from flowing back along the needle track. After each step, the amount of reflux was checked. On selected days after injection, animals were sacrificed and different regions of the brain, including the cortex, hippocampus, brainstem, cerebellum, striatum, midbrain and cervical spinal cord, were dissected and then snap-frozen and stored at -80°C until further analysis.

[0306] RNA extraction from tissues

[0307] Tissues were collected in 2 mL tubes containing 1.4 mm ceramic beads in Lysing Matrix D (MP Biomedicals 6913-500) and stored in a -80°C freezer until analysis. Tissues were placed on ice under laminar flow and 750 μL Trizol (ThermoFisher 15596026 / 15596018) was immediately added to each tube. FastPrep-24 TM5G grinder, 3 cycles of 30 seconds at a speed of 5m / s, the tissue is broken and homogenized. Between cycles, the sample is cooled on ice for 2 minutes. After homogenization, the test tube is immediately rotated and 20% volume of chloroform is added (when using 750μL Trizol, 150μL fluoroform is added). Vortex 15 seconds and centrifuge at 14.000×g for 15 minutes at 4°C. The upper aqueous phase is transferred to a deep 96-well plate, and 1 volume of 70% ethanol is added and mixed thoroughly. The next step is performed using the RNeasy96 test kit (Qiagen) according to the manufacturer's protocol. The RNeasy96 plate is placed on the top of the Square-Well Block support, and the sample (Trizol / chloroform extraction) is placed in the hole of the RNeasy 96 plate and the plate is sealed with an AirPore cover to prevent contamination. Centrifuge at room temperature for 3 minutes at 5600×g, and then the solution is discarded. The successive washing steps included applying 1 x 800 μL RW1 buffer, 2 x 800 μL RPE buffer to the RNeasy 96 plate, and removing the wash buffer by centrifugation at 5600 × g for 3 minutes for each step. After the last wash, the RNeasy 96 plate was centrifuged at 5600 × g for 3 minutes to remove residual lipids. RNA was eluted using 60 μL RNase-free water at 5600 × g for 3 minutes at room temperature. RNA concentration was measured by Nanodrop 8000 (ThermoFisher). The eluted RNA was stored at -80 °C until analysis.

[0308] RT-qPCR

[0309] RNA was used as a template for reverse transcription, and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's protocol. Briefly, the final reaction of 20 μL of the mixture was incubated at 25°C for 10 minutes, followed by reverse transcription at 37°C for 2 hours and enzyme inactivation at 85°C for 5 minutes. For qPCR reactions, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp TM SYBR TM Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers were mixed to a final reaction volume of 10 μL. TM 12K instrument (Applied Biosystems TM) qPCR was run using a standard thermal cycling protocol. Multiple primers were used to detect MAPT mRNA, and reference primers targeting mouse housekeeping genes AP3D1 and PAK1IP1 were included to normalize gene expression. Primer sequences are listed in Table 8. qPCR data were analyzed using qBase+ software (Biogazelle).

[0310] Table 7: In vitro potency (IC50 values) of MAPT siRNA hits in transfected human neuroblastoma cells

[0311]

[0312] Table 8: Sequences of qPCR primers

[0313]

[0314] Table 10: Knockdown efficiency of MAPT siRNA M25 chemical variants (cholesterol conjugate) in human iPSC neurons

[0315]

[0316]

[0317] Table 11: Knockdown efficiency of MAPT siRNA M28 chemical variants (cholesterol conjugate) in human iPSC neurons

[0318]

[0319] Table 12: MAPT mRNA knockdown efficiency of MAPT siRNA M28 lipid conjugates in human iPSC neurons

[0320]

[0321] Table 13: MAPT mRNA knockdown efficiency of MAPT siRNA M25 lipid conjugate in human iPSC neurons

[0322]

[0323]

[0324] Table 14: MAPT mRNA knockdown by MAPT siRNA M25 lipid conjugate (lipid walking) in human iPSC neurons efficiency

[0325]

[0326] Table 15: LC-MS measurement of MAPT siRNA stability in mouse brain homogenate

[0327]

[0328] Table 16: LC-MS measurement of MAPT siRNA stability in human liver trisomy

[0329]

[0330] Table 17: LC-MS measurement of MAPT siRNA stability in rat liver trisomy

[0331]

[0332] Table 21: Modified sense and antisense strand sequences of lipid-conjugated MAPT siRNA

[0333] (Modifications: mN = 2'OMe; fN = 2'F; ps = phosphorothioate; VP = vinylphosphonate; InvAb = inverted abasic)

[0334]

[0335] Table 22: Lipid-M28Var conjugates in hTAU KI mice 7 days after ICV injection (15 nmol siRNA conjugate) In vivo knockdown efficiency. Data are presented as residual MAPT mRNA (%) levels; n = 6 mice per treatment group .

[0336]

[0337] Table 23: Modified sense and antisense strand sequences of lipid-conjugated MAPT siRNA

[0338] (Modifications: mN = 2'OMe; fN = 2'F; ps = phosphorothioate; VP = vinylphosphonate; InvAb = inverted abasic)

[0339]

[0340]

[0341] Table 24: LC-MS measurements of MAPT siRNA stability in mouse brain homogenates.

[0342]

[0343] Table 25: LC-MS measurements of MAPT siRNA stability in human liver trisomy.

[0344]

[0345] Table 26: LC-MS measurements of MAPT siRNA stability in rat liver trisomy.

[0346]

[0347] 7.6 Example 6: In vivo duration of action of siRNA conjugates in the human TAU mouse model

[0348] The in vivo duration of action of lipid-siRNA conjugates was evaluated in the human Tau mouse model by intracerebroventricular (ICV) injection according to the following procedure.

[0349] Figure 4 A to Figure 4D and Table 27 to Table 30 summarize the levels of human MAPT mRNA and Tau protein in the cortex and hippocampus of hTAU KI mice at 7 days, 28 days, 56 days, 84 days, 112 days and 147 days after a single ICV injection of M637 (i.e., M177_Var1 described in Table 5) at 30nmol, 5nmol and 1nmol. The data in Table 27 to Table 30 are expressed as the remaining MAPT mRNA (% vehicle control) or the remaining Tau protein (% vehicle control). Mean ± SD, n = 5 mice / treatment group. The sustained effect of M637 on target knockdown was observed from 7 days to 147 days in hTAU KI mice.

[0350] Figure 5 A and Figure 5 B and Table 31 and Table 32 summarize the level of human MAPT mRNA in the cortex and hippocampus of hTAU KI mice 28 days, 84 days after a single ICV injection of M635, M639 and M641 (respectively M165_Var5, M177_Var3 and M177_Var5 described in Table 5) at 30nmol. The data in Table 31 and Table 32 are expressed as the remaining MAPT mRNA (% vehicle control). Mean ± SD, n = 4-5 mice / treatment group. The sustained effect of M635, M639 and M641 on target knockdown was observed from 28 days to 84 days in hTAU KI mice.

[0351] Mice and intracerebroventricular injection

[0352] Male and female hTau KI (C57BL6; hMAPT: knock-in) mice aged 2 to 3 months were randomly assigned to different treatment groups. Mice were anesthetized with isoflurane (induction: 4%-5%; maintenance: 1.8%-2.5%). They were then stereotaxically injected into the bilateral ventricles using an electric drill and a microinjection robot (Neurostar, Germany, Sterodrive Sofeware v 2019) with coordinates: AP: -0.62mm, ML: + / -1.05mm, and DV: 2.2mm. The volume of each injection was 5 μL for 5 minutes, and the needle was removed in three steps after injection - (1) 1mm was removed within 60 seconds and held for 5 minutes; (2) 0.5mm was removed within 30 seconds and waited for 5 minutes; (3) removed from the brain at a very slow speed) - to avoid reflux of the compound along the needle track. After each step, the amount of reflux was checked. On selected days after injection, animals were sacrificed and different regions of the brain, including the cortex, hippocampus, brainstem, cerebellum, striatum, midbrain, and cervical spinal cord, were dissected and then snap-frozen and stored at −80°C until further analysis.

[0353] RNA extraction from tissues

[0354] Tissues were collected in 2 mL tubes containing 1.4 mm ceramic beads in Lysing Matrix D (MP Biomedicals 6913-500) and stored in a -80°C freezer until analysis. Tissues were placed on ice under laminar flow and 750 μL of Trizol (ThermoFisher 15596026 / 15596018) was immediately added to each tube. FastPrep-24 TM 5G grinder, 3 cycles of 30 seconds at a speed of 5m / s, the tissue is broken and homogenized. Between cycles, the samples are cooled on ice for 2 minutes. After homogenization, the test tubes are briefly rotated and 20% volume of chloroform is added (150 μL chloroform is added when 750 μL Trizol is used). The tubes are vortexed for 15 seconds and centrifuged at 14.000×g for 15 minutes at 4°C. The upper aqueous phase is transferred to a deep 96-well plate, and 1 volume of 70% ethanol is added and mixed thoroughly.

[0355] The next steps were performed using the RNeasy 96 kit (Qiagen) according to the manufacturer's protocol. The RNeasy96 plate was placed on top of the Square-Well Block stand, the sample (Trizol / fluoroform extraction) was applied to the wells of the RNeasy 96 plate, and the plate was sealed with an AirPore cover to prevent contamination. The sample was centrifuged at 5600 × g for 3 minutes at room temperature and the solution was discarded. The sample was washed continuously in steps including 1 time 800 μL RW1 buffer, 2 times 800 μL RPE buffer, and applied to the RNeasy 96 plate; each step was removed by centrifugation at 5600 × g for 3 minutes. After the last wash, the RNeasy96 plate was centrifuged at 5600 × g for 3 minutes to remove residual lipids. RNA was eluted using 60 μL RNase-free water at 5600 × g for 3 minutes at room temperature. RNA concentration was measured by Nanodrop 8000 (ThermoFisher). The eluted RNA was stored at -80 ° C until analysis.

[0356] RT-qPCR

[0357] RNA was used as a template for reverse transcription and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's protocol. Briefly, the final reaction of 20 μL of the mixture was incubated at 25°C for 10 minutes, followed by reverse transcription at 37°C for 2 hours and enzyme inactivation at 85°C for 5 minutes. For qPCR reactions, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp TM SYBRTM Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers were mixed to a final reaction volume of 10 μL. TM 12K instrument (Applied Biosystems TM ) qPCR was run using a standard thermal cycling protocol. Multiple primers were used to detect MAPT mRNA, and reference primers targeting mouse housekeeping genes AP3D1 and PAK1IP1 were included to normalize gene expression. Primer sequences are listed in Table 8. qPCR data were analyzed using qBase+ software (Biogazelle).

[0358] Protein extraction from tissue and MSD immunoassay

[0359] Tissues were collected in 2 mL tubes containing 1.4 mm ceramic beads in Lysing Matrix D (MP Biomedicals 6913-500) and stored in a -80 °C freezer until analysis. Samples were transferred to ice and kept on ice. TM Protease inhibitor cocktail (Roche) and PhosSTOP TM Ice-cold RIPA buffer (Sigma) of 6 to 20 volumes (μl) / weight (mg) of (Roche) was added to the cortex and hippocampus tissues, and the samples were thawed on ice for 15 minutes. The samples were homogenized at 6.0 m / s for 20 s (1 cycle) in a FastPrep-24 instrument (MP Biomedicals). The total homogenate was centrifuged at 18000 g for 40 minutes at 4°C in an Eppendorf centrifuge.

[0360] Tissue lysates were collected and diluted 2500-fold for protein measurement using MSD immunoassays following standardized procedures. Briefly, MSD plates were coated with 30 μL per well of coating antibody diluted in PBS at 1 μg / mL overnight at 4°C. The next day, the plates were inverted on absorbent paper to dry and then incubated with 150 μL per well of 0.1% casein blocking buffer for 2 hours at room temperature with orbital shaking at 300 rpm. After blocking, the plates were incubated with PBS supplemented with cOmplete TMCell lysates diluted in RIPA buffer with a protease inhibitor cocktail (Roche) were incubated overnight at 4°C with slow orbital shaking. The plates were washed 5x using a Titertek Aquamax 4000 and inverted on absorbent paper to dry. Then, 25 μL / well of secondary or detection antibody diluted in 0.1% casein was added to the MSD plate and incubated for 2 hours at room temperature. After antibody incubation, the plates were washed 5x and developed with 150 μL / well 2x MSD reading buffer (MesoScale Discovery) diluted in milliQ H2O. The plate was read immediately using an MSD instrument. For measurement of Tau protein, hTau43 antibody (Janssen) was used to coat 96-well MSD plates and SULFO-TAG TM Labeled hTau60 antibody (Janssen) was used for detection.

[0361] 7.7 Example 7: Evaluation of in vitro knockdown efficiency of siRNA conjugates in human iPSC-derived neurons

[0362] The in vitro knockdown efficiency of MAPT lipid-siRNA conjugates was evaluated in human iPSC-derived cortical neurons following the procedure described below.

[0363] Figure 6 Table 34 summarizes the efficiency of MAPT lipid-siRNA conjugates in knocking down MAPT mRNA in human iPSC neurons after 7 days of incubation. MAPT lipid-siRNA conjugates M757-MM788 are described in Table 33, and M635 (also known as M165_Var5) and M637 (also known as M177_Varl) are described in Table 5. Data are expressed in Table 34 as the remaining MAPT mRNA relative to the control. Mean ± SD, n = 3.

[0364] Differentiation of human iPSCs into cortical neurons

[0365] The human iPSC line (Sigma # iPSC0028) was obtained by reprogramming epithelial cells from a 24-year-old white female donor via OSKM retroviral reprogramming. iPSCs were first differentiated into cortical neural stem cells (NSCs) according to a dual SMAD inhibitor protocol with some modifications (Shi et al., 2012, Nat. Proc. 7(10): 1836-46). In brief, iPSCs were plated at 500,000 cells / cm 2The cells were plated on wells coated with Matrigel (Corning 354230) in mTeSR medium (StemCell Technologies 5850) supplemented with 10 μM ROCK inhibitor (Sigma-Aldrich Y0503) and cultured at 37° C. and 5% O 2 . The medium was replaced with mTeSR the next day (Day -1).

[0366] From day 0 to day 12, the cell culture medium was replaced daily with cortical neural induction medium consisting of 10 μM SB43142 (Tocris 1614) and 1 μM Dorsomorphin (Tocris 3093) supplemented with neural maintenance medium (1:1 DMEM:F12 Glutamax (ThermoFisher Scientific 10565108), Neurobasal (ThermoFisher Scientific 21103049), 2.5 μg / mL insulin (Sigma-Aldrich I9278-5ML), 50 μM 2-mercaptoethanol (ThermoFisher Scientific, 31350010), 0.5% non-essential amino acids (ThermoFisher Scientific 11140035), 0.5% GlutaMAX supplement (ThermoFisherScientific, 10565018), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 11140035). Scientific 11360070), 1% penicillin-streptomycin (Sigma P4333), 0.5% N2 supplement (ThermoFisher Scientific 17502048), 1% B27 supplement (ThermoFisher Scientific 17504044). On day 12, the neuroepithelial sheets were gently dissociated into large clumps of 300 to 500 cells using a needle and lifter, and the clumps were collected in a 15 mL falcon by centrifugation at 160 g for 2 minutes. The cell pellets were gently resuspended in neural induction medium and passaged 1 / 2 or 1 / 3 into wells coated with 10 μg / mL laminin (Sigma-Aldrich L2020) in a total volume of 2 mL neural induction medium per well in a 6-well plate.

[0367] The medium was changed to neural maintenance medium supplemented with 20 ng / mL FGF2 (Stemcell Technologies 2634) on days 13 and 15. On day 17, neural rosettes were dissociated with dispase (ThermoFisher Scientific 17105041), 1 / 3 passaged, and seeded into laminin-coated wells. In the following week, 1 or 2 additional dispersal steps were performed.

[0368] At approximately day 25-30, neural stem cells were dissociated into single cell suspensions using Accutase (ThermoFisher Scientific A1110501) and cryopreserved in freshly prepared neural freezing medium containing neural maintenance medium supplemented with 10% (V / V) DMSO and 20 ng / mL FGF2. Cryovials of neural stem cells were stored in liquid nitrogen until use.

[0369] To generate iPSC neurons, cryopreserved vials of neural stem cells (NSCs) were thawed and plated at 70,000 cells / cm 2 Seed in laminin coated wells, the wells are filled with neural maintenance medium supplemented with 10 μM ROCK inhibitor and 20 ng / mL FGF2. In the next two days, the medium is replaced with neural maintenance medium every day. About the 4th day after thawing, the cells are dissociated with Accutase and placed in a 96-well plate pre-coated with poly-L-ornithine and laminin at 28,000 cells / well in neural maintenance medium supplemented with 10 μM ROCK inhibitor. The next day after re-plating, the medium is replaced with neural differentiation medium, which is composed of neural maintenance medium supplemented with 20 ng / mL BDNF (R&D Systems 212-BD-050 / CF), 20 ng / mL GDNF (R&D Systems 212-GD-050 / CF), 500 μM DB-cAMP (Sigma D0627) and 20 mM ascorbic acid (Sigma A4403). Cultures were differentiated in neural differentiation medium with 50% medium changes twice a week. After two to three weeks of differentiation from neural stem cells (NSCs), neurons were treated with siRNA for 7 or 14 days and RNA analysis was performed by reverse transcription and real-time PCR.

[0370] Table 27: Remaining human MAPT mRNA in the cortex of hTAU KI mice after injection of M637 (% vehicle control)

[0371]

[0372] Table 28: Remaining human MAPT mRNA in the hippocampus of hTAU KI mice after injection of M637 (% vehicle control)

[0373]

[0374] Table 29: Remaining human Tau protein in the cortex of hTAU KI mice after injection of M637 (% vehicle control)

[0375]

[0376] Table 30: Remaining human Tau protein in the hippocampus of hTAU KI mice after injection of M637 (% vehicle control)

[0377]

[0378] Table 31: Remaining human MAPT mRNA in the cortex of hTAU KI mice after injection of M635, M639 or M641 (% vehicle (Comparison)

[0379]

[0380]

[0381] Table 32: Remaining human MAPT mRNA (% vehicle) in the hippocampus of hTAU KI mice after injection of M635, M639 or M641 (control)

[0382]

[0383] Table 34: Remaining mitochondria in human iPSC-derived cortical neurons after incubation with MAPT lipid-siRNA conjugates MAPT mRNA (% vehicle control)

[0384]

[0385]

[0386] The present invention is not limited to the scope of the specific embodiments described herein. In fact, in addition to those described, various modifications of the present invention will become apparent to those skilled in the art based on the foregoing description and the accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

[0387] All references cited herein are incorporated by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety and for all purposes.

Claims

1. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein (c) the sense strand comprises 21 nucleotides having the following sequence: UGCAAAUAGUCUACAAACCAA, wherein from the 5′ end (i) the nucleotides at one or more positions selected from 1-6, 8 and 12-21 are optionally modified with a 2′-O-methyl group; (ii) the nucleotide at position 6 or 7 optionally comprises a lipophilic moiety; (iii) the nucleotides at one or more positions selected from 7 and 9-11 are optionally 2′-deoxy-2′-fluoro-modified; wherein the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5′ end linked to the nucleotide at position 1 and / or an inverted abasic nucleotide (InvAb) at the 3′ end linked to the nucleotide at position 21, and wherein the sense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and (d) the antisense strand comprises 21 nucleotides having the following sequence: UUGGNNNGUAGACUAUUUGCA, wherein from the 5′ end (i) the nucleotide N at position 5 is U or T; the nucleotide N at position 6 is U or T; and the nucleotide N at position 7 is U or T; (ii) the nucleotide at position 1 is optionally modified with vinylphosphonate 2′-O-methyl or cis-cyclobutylphosphonate 2′-O-methyl; (iii) the nucleotides at one or more positions selected from 2, 6, 8, 9, 14 and 16 are optionally 2′-deoxy-2′-fluorine modified; (iv) the nucleotides at one or more positions selected from 1, 3-13, 15 and 17-21 are optionally modified with a 2′-O-methyl group; (v) optionally, the nucleotide at one or more positions selected from 4 to 7 is a deoxynucleotide; (vi) optionally, the nucleotide at position 7 is a 3′-O-methyl modified nucleotide, a (L)-α-threofuranosyl modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA) having a 2′-5′ linked phosphate; wherein the antisense strand optionally further comprises two nucleotides CA linked to the nucleotide at position 21, such that the antisense strand comprises 23 nucleotides having the sequence UUGGNNNGUAGACUAUUUGCACA, wherein the nucleotide C at position 22 and / or the nucleotide A at position 23 are optionally modified with a 2′-O-methyl group, and wherein the antisense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and Wherein the base pair at position 1 at the 5' end of the antisense strand of the duplex is an AU base pair. 2 . The siRNA according to claim 1 , wherein in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with a 2′-O-methyl group. 3 . The siRNA according to claim 1 , wherein in the sense strand, nucleotides at three or more positions selected from 1 to 6, 8, and 12 to 21 are modified with 2′-O-methyl groups. 4 . The siRNA according to any one of claims 1 to 3 , wherein in the sense strand, nucleotides at five or more positions selected from 1 to 6, 8, and 12 to 21 are modified with a 2′-O-methyl group. 5 . The siRNA according to any one of claims 1 to 4 , wherein in the sense strand, the nucleotide at each of positions 1 to 5, 8, and 12 to 20 is modified with a 2′-O-methyl group. 6 . The siRNA according to any one of claims 1 to 5 , wherein in the sense strand, nucleotides at two or more positions selected from 7 and 9 to 11 are modified with 2′-deoxy-2′ fluorine. 7 . The siRNA according to any one of claims 1 to 6 , wherein in the sense strand, the nucleotide at each of positions 9 to 11 is modified with 2′-deoxy-2′ fluorine.

8. The siRNA according to any one of claims 1 to 7, wherein in the sense strand, the nucleotide at position 6 is modified with a 2'-O-methyl group and the nucleotide at position 7 comprises a lipophilic moiety.

9. The siRNA of claim 8, wherein the lipophilic moiety is L4.

10. The siRNA according to any one of claims 1 to 7, wherein in the sense strand, the nucleotide at position 6 comprises a lipophilic moiety and the nucleotide at position 7 is modified with 2'-deoxy-2' fluorine.

11. The siRNA of claim 10, wherein the lipophilic moiety is L21. 12 . The siRNA according to claim 1 , wherein the sense strand further comprises an InvAb at the 5′ end linked to the nucleotide at position 1 .

13. The siRNA of any one of claims 1-12, wherein the sense strand comprises two phosphorothioate bonds at both the 5' end and the 3' end. 14 . The siRNA according to any one of claims 1 to 13 , wherein in the antisense strand, nucleotides at two or more positions selected from 1, 3 to 13, 15, and 17 to 21 are modified with a 2′-O-methyl group. 15 . The siRNA according to any one of claims 1 to 14 , wherein in the antisense strand, nucleotides at three or more positions selected from 1, 3 to 13, 15, and 17 to 21 are modified with a 2′-O-methyl group. 16 . The siRNA according to any one of claims 1 to 15 , wherein in the antisense strand, nucleotides at five or more positions selected from 1, 3 to 13, 15, and 17 to 21 are modified with a 2′-O-methyl group. 17 . The siRNA according to any one of claims 1 to 16 , wherein in the antisense strand, the nucleotide at each of positions 1, 3, 10-13, 15, and 17-21 is modified with a 2′-O-methyl group.

18. The siRNA according to any one of claims 1 to 17, wherein in the antisense strand, nucleotides at two or more positions selected from 2, 6, 8, 9, 14 and 16 are modified with 2'-deoxy-2' fluorine.

19. The siRNA according to any one of claims 1 to 18, wherein in the antisense strand, the nucleotide at each of positions 2, 14, and 16 is modified with 2'-deoxy-2' fluorine.

20. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotides at position 4 and position 5 are each modified with a 2'-O-methyl group.

21. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotide at position 4 is modified with a 2'-O-methyl group and the nucleotide at position 5 is a deoxynucleotide.

22. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with a 2'-O-methyl group.

23. The siRNA according to any one of claims 1 to 20, wherein in the antisense strand, the nucleotides at positions 4, 5 and 7 are each modified with 2'-O-methyl, and the nucleotide at position 6 is modified with 2'-deoxy-2' fluorine.

24. The siRNA according to any one of claims 1 to 23, wherein in the antisense strand, the nucleotides at positions 8 and 9 are both modified with 2'-O-methyl, or are both modified with 2'-deoxy-2' fluorine.

25. The siRNA of any one of claims 1-24, wherein the antisense strand comprises two phosphorothioate bonds at both the 5' end and the 3' end.

26. The siRNA of claim 1, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 335, 339, 341, 507, 509, 511, 513, 515, 521, 527, 531, 533, or 567.

27. The siRNA of claim 1 or 26, wherein the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 336, 340, 342, 508, 510, 512, 514, 516, 522, 528, 532, 534, or 568.

28. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein (b) the sense strand comprises 21 nucleotides having the following sequence: CAAGUCCAAGAUCGGCUCCAA, wherein from the 5′ end (iv) the nucleotides at one or more positions selected from 1-6, 8 and 12-21 are optionally modified with a 2′-O-methyl group; (v) the nucleotides at one or more positions selected from 9 to 11 are optionally 2′-deoxy-2′ fluorine-modified; (vi) the nucleotide at position 7 optionally comprises a lipophilic moiety; wherein the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5′ end linked to the nucleotide at position 1 and / or an inverted abasic nucleotide (InvAb) at the 3′ end linked to the nucleotide at position 21, and wherein the sense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and (c) the antisense strand comprises 21 nucleotides having the following sequence: UUGGAGCCGAUCUUGGACUUG, wherein from the 5′ end (vi) the nucleotide at position 1 is optionally modified with vinylphosphonate 2′-O-methyl or cis-cyclobutylphosphonate 2′-O-methyl; (vii) the nucleotides at one or more positions selected from 2, 14 and 16 are optionally 2′-deoxy-2′ fluorine-modified; (viii) the nucleotides at one or more positions selected from 1, 3-6, 8-13, 15 and 17-21 are optionally modified with a 2′-O-methyl group; (ix) optionally, the nucleotide at one or more positions selected from 4, 5 and 7 is a deoxynucleotide; (x) optionally, the nucleotide at position 7 is a 3′-O-methyl modified nucleotide having a 2′-5′ linked phosphate, a (L)-α-threofuranosyl (3′-2′) modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA); wherein the antisense strand optionally comprises at least two phosphorothioate bonds at the 5′ end and / or at least two phosphorothioate bonds at the 3′ end; and Wherein the base pair at position 1 at the 5' end of the antisense strand of the duplex is an AU base pair.

29. The siRNA according to claim 28, wherein in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl groups.

30. The siRNA according to claim 28 or 29, wherein in the sense strand, nucleotides at three or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl groups.

31. The siRNA according to any one of claims 28 to 30, wherein in the sense strand, nucleotides at five or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl groups.

32. The siRNA according to any one of claims 28 to 31, wherein in the sense strand, the nucleotide at each of positions 1 to 6, 8, and 12 to 21 is modified with a 2'-O-methyl group.

33. The siRNA according to any one of claims 28 to 32, wherein in the sense strand, nucleotides at two or more positions selected from 9 to 11 are modified with 2'-deoxy-2' fluorine.

34. The siRNA according to any one of claims 28 to 33, wherein in the sense strand, the nucleotide at each of positions 9 to 11 is modified with 2'-deoxy-2' fluorine.

35. The siRNA of any one of claims 28-34, wherein in the sense strand, the nucleotide at position 7 comprises a lipophilic moiety L22.

36. The siRNA of any one of claims 28-35, wherein the sense strand further comprises an InvAb at the 5' end linked to the nucleotide at position 1 and at the 3' end linked to the nucleotide at position 21.

37. The siRNA of any one of claims 28-36, wherein the sense strand comprises two phosphorothioate bonds at both the 5' end and the 3' end.

38. The siRNA according to any one of claims 28 to 37, wherein in the antisense strand, nucleotides at two or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with a 2'-O-methyl group.

39. The siRNA according to any one of claims 28 to 38, wherein in the antisense strand, nucleotides at three or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with 2'-O-methyl groups.

40. The siRNA according to any one of claims 28 to 39, wherein in the antisense strand, nucleotides at five or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with 2'-O-methyl groups.

41. The siRNA according to any one of claims 28 to 40, wherein in the antisense strand, the nucleotide at each of positions 1, 3, 6, 8-13, 15, and 17-21 is modified with a 2'-O-methyl group.

42. The siRNA according to any one of claims 28 to 41, wherein in the antisense strand, nucleotides at two or more positions selected from 2, 14 and 16 are modified by 2'-deoxy-2' fluorine.

43. The siRNA according to any one of claims 28 to 42, wherein in the antisense strand, the nucleotides at each of positions 2, 14 and 16 are replaced by 2 ′ -Deoxy-2' fluorine modification.

44. The siRNA according to any one of claims 28 to 43, wherein in the antisense strand, the nucleotides at position 4 and position 5 are each modified with a 2'-O-methyl group.

45. The siRNA according to any one of claims 28-43, wherein in the antisense strand, the nucleotide at position 4 is modified with a 2'-O-methyl group and the nucleotide at position 5 is a deoxynucleotide.

46. ​​The siRNA according to any one of claims 28-43, wherein in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with a 2'-O-methyl group.

47. The siRNA of any one of claims 28-46, wherein the antisense strand comprises two phosphorothioate bonds at both the 5' end and the 3' end.

48. The siRNA of claim 28, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 333, 541, 547, 557, or 569.

49. The siRNA of claim 28 or 48, wherein the antisense strand comprises nucleotides having a sequence of SEQ ID NO: 334, 542, 548, 558 or 570.

50. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 333 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

334.

51. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 335, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

336.

52. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 339, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

340.

53. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 341, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

342.

54. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 507 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

508.

55. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 509, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

510.

56. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 511 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

512.

57. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 513, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

514.

58. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 515 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

516.

59. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 521, and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

522.

60. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 527 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

528.

61. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 531 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

532.

62. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 533 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

534.

63. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 541 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

542.

64. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 547 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

548.

65. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 557 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

558.

66. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 567 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

568.

67. An siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises nucleotides having a sequence of SEQ ID NO: 569 and the antisense strand comprises nucleotides having a sequence of SEQ ID NO:

570.

68. A composition comprising the siRNA agent according to any one of claims 1-67, and a carrier.

69. A method for inhibiting MAPT gene expression in a cell or a cell population, the method comprising contacting the cell or cell population with the siRNA according to any one of claims 1-67 or with the composition according to claim 68.

70. A small interfering ribonucleic acid (siRNA), the siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein: (a) the antisense strand comprises or consists of a nucleotide sequence corresponding to any one of the antisense nucleotide sequences in Table 1, Table 2, Table 3, Table 4, Table 5, Table 9 or Table 33; (b) the sense strand comprises or consists of a nucleotide sequence corresponding to any one of the sense nucleotide sequences in Table 1, Table 2, Table 3, Table 4, Table 5, Table 9 or Table 33; or (c) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 1, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 1; (d) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 2, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 2; (e) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 3, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 3; (f) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 4, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 4; (g) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 5; (h) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 9; or (i) the antisense strand comprises or consists of a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to a sense nucleotide sequence in the same row of Table 33.

71. The siRNA agent of claim 70(a), 70(b) or 70(c), wherein the antisense strand, the sense strand, the antisense strand or both comprise at least one modified nucleotide.

72. The siRNA agent of claim 70(a), 70(b), 70(c) or 71, wherein the antisense strand, the sense strand, the antisense strand or both comprise at least one modified internucleoside bond.

73. The siRNA agent of any one of claims 70-72, wherein the antisense strand, the sense strand, or both the antisense strand and the sense strand are conjugated to one or more lipophilic moieties.

74. The siRNA agent of claim 73, wherein the one or more lipophilic moieties are selected from L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21, L22, L23, and L24.

75. A composition comprising the siRNA agent according to any one of claims 70-74, and a carrier.

Images