MAPT siRNA and its uses

Abstract

Provided herein are small interfering ribonucleic acid (siRNA) agents that target the microtubule-associated protein tau (MAPT) gene and compositions comprising such siRNA agents.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Patent Application No. 63 / 320,684, filed March 16, 2022, and U.S. Provisional Patent Application No. 63 / 320,687, filed March 16, 2022, each of which is incorporated by reference in its entirety herein.

[0002] (Introduction) Provided herein are small interfering ribonucleic acid (siRNA) agents that target the microtubule-associated protein tau (MAPT) gene and compositions comprising such siRNA agents. [Background technology]

[0003] Tau is a soluble protein that normally associates with microtubules in neurons, and its best-characterized function is microtubule polymerization under physiological conditions. However, under pathological conditions, tau becomes hyperphosphorylated and dissociates from microtubules, forming intracellular soluble oligomeric species and insoluble aggregates rich in β-sheet structures. Certain tau assemblies can be released and transmitted to neurons in anatomically connected regions to induce or "seed" native monomeric tau to oligomerize into aggregates, thus propagating tau aggregates in a prion-like manner. The molecular mechanism by which tau exerts its pathogenic effects in Alzheimer's disease is currently unknown. However, it is clear that the pathogenic effects of tau involve a toxic gain of function exerted by small or large aggregated forms of tau protein species. Summary of the Invention [Problem to be solved by the invention]

[0004] For example, to study Alzheimer's disease, compounds and agents that inhibit the expression of the MAPT gene are needed. [Means for solving the problem]

[0005] In one aspect, provided herein is a non-naturally occurring small interfering ribonucleic acid (siRNA) agent that includes a sense strand and an antisense strand that form a double-stranded region.

[0006] In some embodiments, provided herein is a non-naturally occurring small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein (a) the antisense strand comprises or consists of a nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences in Table 1, (b) the sense strand comprises or consists of a nucleotide sequence corresponding to any one of the sense strand nucleotide sequences in Table 1, or (c) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence of a row in Table 1 and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence of the same row in Table 1.

[0007] In some embodiments, the antisense strand, the sense strand, or both of the siRNA agents described herein comprise at least one modified nucleotide. In some embodiments, the antisense strand and the sense strand of the siRNA agents described herein each comprise 3-23 modified nucleotides. In some embodiments, the antisense strand of the siRNA agents described herein comprises all modified nucleotides. In some embodiments, the sense strand of the siRNA agents described herein comprises all modified nucleotides. In some embodiments, the antisense strand and the sense strand of the siRNA agents described herein each comprise all modified nucleotides. In certain embodiments, the modified nucleotide is selected from the group consisting of 2'O-methyl modified nucleotides, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, inverted abasic nucleotides, nucleotides including S-glycol nucleic acid (GNA), non-locked nucleotides, 5'-vinylphosphonate-2'-O-methyl-uridine, and combinations thereof.

[0008] In some embodiments, the antisense strand, the sense strand, or both of the siRNA agents described herein comprise at least one modified internucleoside linkage. In some embodiments, the antisense strand and the sense strand of the siRNA agents described herein each comprise a modified internucleoside linkage. In some embodiments, the antisense strand and the sense strand of the siRNA agents described herein each comprise 2-5 modified internucleoside linkages. In some embodiments, the modified internucleoside linkage is phosphorothioate.

[0009] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand which form a double-stranded region, wherein (a) the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2; (b) the sense strand comprises a nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2; or (c) the antisense strand comprises a nucleotide sequence of an antisense strand nucleotide sequence in a row in Table 2 and the sense strand comprises a nucleotide sequence of a sense strand nucleotide sequence in the same row.

[0010] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein (a) the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 3; (b) the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 3; or (c) the antisense strand comprises an antisense strand nucleotide sequence of a row in Table 3 and the sense strand comprises a sense strand nucleotide sequence of the same row in Table 3.

[0011] In some embodiments, antisense strand, sense strand, or both antisense strand and sense strand are conjugated to one or more lipophilic moieties.In some embodiments, one or more lipophilic moieties are conjugated to one or more terminal positions of siRNA agent or to the internal position of double-stranded region of siRNA agent.In some embodiments, one or more lipophilic moieties are conjugated via linker or carrier. In some embodiments, the one or more lipophilic moieties are selected from the group consisting of cholesterol, L1, L2, L3, L4 (also referred to herein as "J2-CONC16U"), L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21 (also referred to herein as "J2-CONC16A"), L22 (also referred to herein as "J2-CONC16C"), L23 (also referred to herein as "J2-CONC16G"), and / or L24.

[0012] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein (a) the antisense strand comprises the nucleotide sequence of any one of the antisense nucleotide sequences in Table 4; (b) the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4, and the sense strand is conjugated to a cholesterol or lipid moiety as shown in Table 4 for the sense strand nucleotide sequence; or (c) the antisense strand comprises an antisense strand nucleotide sequence of a row in Table 4, and the sense strand comprises a sense strand of the same row in Table 4, and the sense strand is conjugated to a cholesterol or lipid as shown in Table 4 for the sense strand nucleotide sequence.

[0013] In some embodiments, provided herein is a small interfering ribonucleic acid (siRNA) agent comprising a sense strand and an antisense strand which form a double-stranded region, wherein (a) the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, (b) the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 5, and the sense strand is conjugated to a cholesterol or lipid moiety as indicated in Table 5 for the sense strand nucleotide sequence, or (c) the antisense strand comprises the nucleotide sequence of an antisense strand nucleotide sequence in a row of Table 5, and the sense strand comprises the nucleotide sequence of a sense strand nucleotide sequence in the same row of Table 5, and the sense strand is conjugated to cholesterol or a lipid as indicated in Table 5 for the sense strand.

[0014] In some embodiments, each strand of the siRNA agent is 30 nucleotides or less in length, hi some embodiments, each strand of the siRNA agent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides in length.

[0015] In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least one nucleotide. In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least two nucleotides. In some embodiments, at least one strand of the siRNA agent comprises a 3' overhang of at least three nucleotides. In some embodiments, both strands of the siRNA agent comprise a 3' overhang of at least one or at least two nucleotides.

[0016] In some embodiments, the double-stranded region of the siRNA agent is 15-19 nucleotides in length. In some embodiments, the double-stranded region of the siRNA agent is 20-25 nucleotides in length. In some embodiments, the double-stranded region of the siRNA agent is 15-25 nucleotides in length. In some embodiments, the double-stranded region of the siRNA agent is 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.

[0017] In some embodiments, the siRNA agents described herein comprise a targeting ligand.

[0018] In another aspect, provided herein is a cell containing the siRNA agent described herein. In certain embodiments, the cell is in vitro or ex vivo.

[0019] In another aspect, provided herein is a composition comprising a siRNA agent as described herein and a carrier.

[0020] In one embodiment, a siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, (a) the sense strand comprises 21 nucleotides having the sequence: UGCAAAUAGUCUACAAACCAA, from the 5' end: (i) nucleotides at one or more positions selected from 1 to 6, 8, and 12 to 21 are optionally modified with 2'-O-methyl; (ii) the nucleotide at position 6 or 7 optionally comprises a lipophilic moiety; (iii) one or more nucleotides selected from 7 and 9 to 11 are optionally modified with 2'-deoxy-2'fluoro; the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5' end linked to the nucleotide at position 1, and / or an inverted abasic nucleotide (InvAb) at the 3' end linked to the nucleotide at position 21, the sense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; and (b) the antisense strand comprises 21 nucleotides having the sequence: UUGGNNNGUAGACUAUUUGCA, from the 5' end: (i) the nucleotide N at position 5 is U or T, the nucleotide N at position 6 is U or T, and the nucleotide N at position 7 is U or T; (ii) the nucleotide at position 1 is optionally modified with vinylphosphonate 2'-O-methyl or cis-cyclobutylphosphonate 2'-O-methyl; (iii) nucleotides at one or more positions selected from 2, 6, 8, 9, 14, and 16 are optionally modified with 2'-deoxy-2'fluoro; (iv) nucleotides at one or more positions selected from 1, 3 to 13, 15, and 17 to 21 are optionally modified with 2'-O-methyl; (v) optionally, a nucleotide at one or more positions selected from 4 to 7 is a deoxynucleotide; (vi) optionally, the nucleotide at position 7 is a 3'-O-methyl modified nucleotide having a 2'-5' linked phosphate, an (L)-α-threofuranosyl modified nucleotide, or a glycol nucleic acid (GNA), or an unlocked nucleic acid (UNA); the antisense strand optionally further comprises two nucleotides CA linked to the nucleotide at position 21, such that the antisense strand comprises 23 nucleotides having the sequence UUGGNNNGUAGACUAUUUGCACA, wherein the nucleotide C at position 22 and / or the nucleotide A at position 23 are optionally modified with 2'-O-methyl; the antisense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; Provided herein are siRNAs, wherein the first base pair at the 5' end of the antisense strand of the duplex is an AU base pair.

[0021] In some embodiments, in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at three or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at five or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, each of nucleotides at positions 1-5, 8, and 12-20 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at two or more positions selected from 7 and 9-11 are modified with 2'-deoxy-2'fluoro. In some embodiments, in the sense strand, each of nucleotides at positions 9-11 are modified with 2'-deoxy-2'fluoro. In yet some other embodiments, in the sense strand, the nucleotide at position 6 is modified with 2'-O-methyl and the nucleotide at position 7 comprises a lipophilic moiety. In some embodiments, the lipophilic moiety is L4. In some embodiments, in the sense strand, the nucleotide at position 6 comprises a lipophilic moiety and the nucleotide at position 7 is modified with 2'-deoxy-2'fluoro. In some embodiments, the lipophilic moiety is L21. In some embodiments, the sense strand further comprises an InvAb at the 5' end linked to the nucleotide at position 1. In some other embodiments, the sense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

[0022] In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 1, 3-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at three or more positions selected from 1, 3-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at five or more positions selected from 1, 3-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at each of positions 1, 3, 10-13, 15, and 17-21 are modified with 2'-O-methyl. In some other embodiments, in the antisense strand, nucleotides at two or more positions selected from 2, 6, 8, 9, 14, and 16 are modified with 2'-deoxy-2'fluoro. In some embodiments, in the antisense strand, each of the nucleotides at positions 2, 14, and 16 are modified with a 2'-deoxy-2'fluoro. In some other embodiments, in the antisense strand, the nucleotides at positions 4 and 5 are each modified with a 2'-O-methyl. In some embodiments, in the antisense strand, the nucleotide at position 4 is modified with a 2'-O-methyl and the nucleotide at position 5 is a deoxynucleotide. In some embodiments, in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with a 2'-O-methyl. In some embodiments, in the antisense strand, the nucleotides at positions 4, 5, and 7 are each modified with a 2'-O-methyl and the nucleotide at position 6 is modified with a 2'-deoxy-2'fluoro. In some embodiments, in the antisense strand, the nucleotides at positions 8 and 9 are either both modified with a 2'-O-methyl or both modified with a 2'-deoxy-2'fluoro. In some embodiments, the antisense strand contains two phosphorothioate linkages at both the 5' and 3' ends.

[0023] In some embodiments, the sense strand comprises nucleotides having the sequence of SEQ ID NO: 335, 339, 341, 507, 509, 511, 513, 515, 521, 527, 531, 533, or 567. In some embodiments, the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 336, 340, 342, 508, 510, 512, 514, 516, 522, 528, 532, 534, or 568.

[0024] In another embodiment, there is provided an siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises 21 nucleotides having the sequence: CAAGUCCAAGAUCGGCUCCAA, from the 5' end: (i) nucleotides at one or more positions selected from 1 to 6, 8, and 12 to 21 are optionally modified with 2'-O-methyl; (ii) one or more nucleotides selected from positions 9 to 11 are optionally modified with 2'-deoxy-2'fluoro; (iii) the nucleotide at position 7 optionally comprises a lipophilic moiety; the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5' end linked to the nucleotide at position 1, and / or an inverted abasic nucleotide (InvAb) at the 3' end linked to the nucleotide at position 21, the sense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; and (a) the antisense strand comprises 21 nucleotides having the sequence: UUGGAGCCGAUCUUGGACUUG, from the 5' end: (i) the nucleotide at position 1 is optionally modified with vinylphosphonate 2'-O-methyl or cis-cyclobutylphosphonate 2'-O-methyl; (ii) one or more nucleotides selected from positions 2, 14, and 16 are optionally modified with 2'-deoxy-2'fluoro; (iii) nucleotides at one or more positions selected from 1, 3 to 6, 8 to 13, 15, and 17 to 21 are optionally modified with 2'-O-methyl; (iv) optionally, nucleotides at one or more positions selected from 4, 5, and 7 are deoxynucleotides; (v) optionally, the nucleotide at position 7 is a 3'-O-methyl modified nucleotide having a 2'-5' linked phosphate, an (L)-α-threofuranosyl (3'-2') modified nucleotide, or a glycol nucleic acid (GNA), or a non-locked nucleic acid (UNA); the antisense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; Provided herein are siRNAs, wherein the first base pair at the 5' end of the antisense strand of the duplex is an AU base pair.

[0025] In some embodiments, in the sense strand, nucleotides at two or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, nucleotides at three or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at five or more positions selected from 1-6, 8, and 12-21 are modified with 2'-O-methyl. In some other embodiments, in the sense strand, each of the nucleotides at positions 1-6, 8, and 12-21 is modified with 2'-O-methyl. In some embodiments, in the sense strand, nucleotides at two or more positions selected from 9-11 are modified with 2'-deoxy-2'fluoro. In some other embodiments, in the sense strand, each of the nucleotides at positions 9-11 is modified with 2'-deoxy-2'fluoro. In some embodiments, in the sense strand, the nucleotide at position 7 comprises a lipophilic moiety L22. In some embodiments, the sense strand further comprises an InvAb at both the 5' end linked to nucleotide at position 1 and the 3' end linked to nucleotide at position 21. In some embodiments, the sense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

[0026] In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at three or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at five or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at each of positions 1, 3, 6, 8-13, 15, and 17-21 are modified with 2'-O-methyl. In some embodiments, in the antisense strand, nucleotides at two or more positions selected from 2, 14, and 16 are modified with 2'-deoxy-2'fluoro. In some embodiments, in the antisense strand, each of the nucleotides at positions 2, 14, and 16 in the antisense strand is modified with 2'-deoxy-2'fluoro. In some embodiments, in the antisense strand, the nucleotides at positions 4 and 5 are each modified with 2'-O-methyl. In some embodiments, in the antisense strand, the nucleotide at position 4 is modified with 2'-O-methyl and the nucleotide at position 5 is a deoxynucleotide. In some embodiments, in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with 2'-O-methyl. In some embodiments, the antisense strand comprises two phosphorothioate linkages at both the 5' and 3' ends. In some embodiments, the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 333, 541, 547, 557, or 569. In some embodiments, the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 334, 542, 548, 558, or 570.

[0027] In one embodiment, an siRNA is provided that comprises a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 333, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 334. In one embodiment, an siRNA is provided that comprises a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 335, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 336. In another embodiment, an siRNA is provided that comprises a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 339, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 340. In another embodiment, an siRNA is provided that comprises a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 341, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 342. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 507, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 508. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 509, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 510. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 511, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 512. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 513, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 514.In another embodiment, an siRNA is provided that includes a sense strand and an antisense strand forming a double-stranded duplex, the sense strand comprising a nucleotide having a sequence of SEQ ID NO: 515, and the antisense strand comprising a nucleotide having a sequence of SEQ ID NO: 516. In another embodiment, an siRNA is provided that includes a sense strand and an antisense strand forming a double-stranded duplex, the sense strand comprising a nucleotide having a sequence of SEQ ID NO: 521, and the antisense strand comprising a nucleotide having a sequence of SEQ ID NO: 522. In another embodiment, an siRNA is provided that includes a sense strand and an antisense strand forming a double-stranded duplex, the sense strand comprising a nucleotide having a sequence of SEQ ID NO: 527, and the antisense strand comprising a nucleotide having a sequence of SEQ ID NO: 528. In another embodiment, an siRNA is provided that includes a sense strand and an antisense strand forming a double-stranded duplex, the sense strand comprising a nucleotide having a sequence of SEQ ID NO: 531, and the antisense strand comprising a nucleotide having a sequence of SEQ ID NO: 532. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 533, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 534. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 541, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 542. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 547, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 548. In another embodiment, an siRNA is provided comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having a sequence of SEQ ID NO: 557, and the antisense strand comprises a nucleotide having a sequence of SEQ ID NO: 558.In another embodiment, there is provided an siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having the sequence of SEQ ID NO: 567, and the antisense strand comprises a nucleotide having the sequence of SEQ ID NO: 568. In another embodiment, there is provided an siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, wherein the sense strand comprises a nucleotide having the sequence of SEQ ID NO: 569, and the antisense strand comprises a nucleotide having the sequence of SEQ ID NO: 570.

[0028] In another aspect, provided herein is a composition comprising any one of the siRNA agents of the aspects or embodiments herein and a carrier.In another aspect, provided herein is a method for inhibiting the expression of MAPT gene in a cell or cell population, comprising contacting the cell or cell population with the siRNA of any one of the aspects or embodiments herein or the composition of any one of the aspects or embodiments herein. [Brief description of the drawings]

[0029] [Figure 1A] Demonstration of the effect of cholesterol-siRNA conjugates on MAPT mRNA expression in human iPSC-neurons. Figure 1A shows a graph showing knockdown of MAPT mRNA in human iPSC-neurons by cholesterol-siRNA conjugates. [Figure 1B] 1 demonstrates the effect of cholesterol-siRNA conjugates on MAPT mRNA expression in human iPSC-neurons. FIG. 1B provides a table showing IC50 (95% CI confidence interval) for the same cholesterol-siRNA conjugates. [Figure 2A] Demonstration of the effect of lipid-siRNA conjugates on MAPT mRNA expression in human iPSC-neurons. Figure 2A shows a graph showing knockdown of MAPT mRNA in human iPSC-neurons by lipid-siRNA conjugates. [Figure 2B] 2B shows the effect of lipid-siRNA conjugates on MAPT mRNA expression in human iPSC-neurons. FIG. 2B provides a table showing the IC50 (95% CI confidence interval) for the same lipid-siRNA conjugates. [Figure 3-1] Figures 3-1 to 3-9 provide the chemical structures of the 3' and / or 5' terminal lipid derivatives, as well as the internal 2'-O-lipid derivatives. The structure of Chol4 is also shown. [Figure 3-2] Same as above. [Figure 3-3] Same as above. [Diagram 3-4] Same as above. [Figure 3-5] Same as above. [Diagram 3-6] Same as above. [Diagram 3-7] Same as above. [Diagram 3-8] Same as above. [Diagram 3-9] Same as above. [Figure 4A] Tau mouse model: Demonstrating the effect of lipid-siRNA conjugates on MAPT mRNA and tau protein expression in the brain of hTAU KI mice. Figures 4A-B show graphs showing the levels of human MAPT mRNA (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after lipid-siRNA conjugate injection. [Figure 4B] Tau mouse model: Demonstrating the effect of lipid-siRNA conjugates on MAPT mRNA and tau protein expression in the brain of hTAU KI mice. Figures 4A-B show graphs showing the levels of human MAPT mRNA (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after lipid-siRNA conjugate injection. [Figure 4C]Tau mouse model: Demonstrating the effect of lipid-siRNA conjugates on MAPT mRNA and tau protein expression in the brain of hTAU KI mice. Figures 4C-4D show graphs showing the levels of human tau protein (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after lipid-siRNA conjugate injection. [Figure 4D] Tau mouse model: Demonstrating the effect of lipid-siRNA conjugates on MAPT mRNA and tau protein expression in the brain of hTAU KI mice. Figures 4C-4D show graphs showing the levels of human tau protein (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after lipid-siRNA conjugate injection. [Figure 5A] 5A-5B show the effect of different lipid-siRNA conjugates on MAPT mRNA expression in the brain of tau mouse model hTAU KI mice. Figures 5A-5B show graphs showing the levels of human MAPT mRNA (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after injection of lipid-siRNA conjugates. [Figure 5B] 5A-5B show the effect of different lipid-siRNA conjugates on MAPT mRNA expression in the brain of tau mouse model hTAU KI mice. Figures 5A-5B show graphs showing the levels of human MAPT mRNA (as % of vehicle control) in the cortex and hippocampus, respectively, of hTAU KI mice at different time points after injection of lipid-siRNA conjugates. [Figure 6] Demonstrating the efficiency of MAPT lipid-siRNA conjugates in knocking down MAPT mRNA in human iPSC-neurons. Figure 6 shows a graph showing MAPT mRNA expression (as % of vehicle control) in human iPSC-neurons after incubation with 1 mM and 250 nM MAPT lipid-siRNA conjugates for 7 days. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] The siRNA agent of the present invention inhibits the expression of MAPT gene.As used herein, the term "MAPT" gene refers to the gene that is also known as MTBT1 gene, PPP1R103 gene, FTDP-17 gene, tau-40 gene, MTBT2 gene, MAPTL gene, PPND gene, MSTD gene, tau gene, and microtubule-associated protein tau gene, and codes for a protein called microtubule-associated protein tau.

[0031] The human MAPT gene, which encodes the tau protein, is located on chromosome 17q23.1, spans approximately 150 kb, and contains 16 exons. Eleven of the 16 exons are expressed in the central nervous system (CNS). In the human brain, six isoforms of tau with 0, 1, or 2 N-terminal repeats (0N, 1N, or 2N) and 3 or 4 microtubule-binding repeats (3R or 4R) are generated by alternative splicing of exons 2, 3, and 10. Larger splicing variants containing exon 4a or exon 6 are mostly found in the peripheral nervous system or in the spinal cord and skeletal muscles, respectively. Tau protein is mainly expressed in CNS neurons and located in axons and dendrites. The half-life of tau has been reported to be approximately 7 days in human iPSC-derived neuronal cultures and 23±6.4 days in the human CNS (Sato,C.,et al.(2018).“Tau Kinetics in Neurons and the Human Central Nervous System.”Neuron 98(4):861-864). A portion of newly synthesized tau protein is C-terminally cleaved and released from neurons into the cerebrospinal fluid (CSF) with a delay of 3 days, suggesting that the estimated CSF tau production rates from amyloid-negative and amyloid-positive cohorts were 22.9±7.2pg / mL / day and 27.8±7.0pg / mL / day, respectively (Sato,C.,et al.(2018).“Tau Kinetics in Neurons and the Human Central Nervous System.”Neuron 98(4):861-864).

[0032] As used herein, the term "small interfering RNA agent" or "siRNA agent" refers to an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that contains both a sense strand and an antisense strand. In some embodiments, the siRNA sense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, or 17 nucleotides in length. In some embodiments, the siRNA antisense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, or 17 nucleotides in length. The sense strand and / or antisense strand of the siRNA agent may include another moiety (e.g., a lipid moiety). For example, a lipid moiety may be incorporated into the sense strand of the siRNA agent. The sense strand and / or antisense strand of the siRNA agent may be directly or indirectly linked or conjugated to another moiety (e.g., a lipid moiety). For example, the sense strand of the siRNA agent may be directly or indirectly linked or conjugated to another moiety (e.g., a lipid moiety). In certain embodiments, the siRNA agent is a double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide comprising a sense strand and an antisense strand forming a double-stranded region. The double-stranded region may be the entire length of the sense strand, the antisense strand, or both. Alternatively, the double-stranded region may be shorter than the entire length of the sense strand, the antisense strand, or both. The double-stranded region may be the result of the antisense strand being fully complementary, partially complementary, or substantially complementary to the sense strand. In certain embodiments, the antisense strand of the siRNA agent is partially complementary to the target RNA transcript. In another particular embodiment, the antisense strand of the siRNA agent is substantially complementary to the target RNA transcript. In another particular embodiment, the antisense strand of the siRNA agent is fully complementary to the target RNA transcript.

[0033] The two strands forming the double-stranded region or duplex structure can be different portions of one larger RNA molecule, or can be separate RNA molecules.

[0034] When the two substantially complementary strands of the siRNA agent are composed of separate RNA molecules, these molecules do not have to be covalently linked, but can be covalently connected. In certain embodiments, where the two strands are covalently connected by means other than a continuous strand of nucleotides between the 3' end of one strand and the 5' end of each other strand forming a duplex structure, the connecting structure is called a "linker". The RNA strands of the siRNA agent can have the same or different number of nucleotides. In some embodiments, one or both strands of the siRNA agent include an overhang. In other embodiments, the siRNA agent is blunt-ended.

[0035] In certain embodiments, the siRNA agent described herein mediates messenger RNA (mRNA) degradation or inhibits mRNA translation in a sequence-specific manner. In certain embodiments, the siRNA agent described herein inhibits MAPT gene expression via the RNA-induced silencing complex (RISC) pathway.

[0036] As used herein, the term "complementary" when used to describe a first nucleotide sequence (e.g., a sense strand or targeting sequence of an siRNA agent) in the context of a second nucleotide sequence (e.g., an antisense strand or single-stranded antisense oligonucleotide of an siRNA agent) means that an oligonucleotide or polynucleotide comprising the first nucleotide sequence can hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions to form a duplex or double helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and also include natural or modified nucleotides or nucleotide mimics, so long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, fA and mA are complementary to U (or T) and are identical to A for purposes of determining identity or complementarity.

[0037] As used herein, the term "fully complementary" means that in the context of two nucleotide sequences, all (100%) of the bases in the contiguous sequence of the first nucleotide sequence hybridize to the same number of bases in the contiguous sequence of the second nucleotide sequence to form a duplex. If two nucleotide sequences are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered as mismatches in terms of determining complementarity. For example, an siRNA agent comprising one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, where the 23 nucleotide oligonucleotide comprises a 21 nucleotide sequence that is fully complementary to the 21 nucleotide oligonucleotide, is considered to be "fully complementary" for the purposes described herein. In certain embodiments, two nucleotide sequences are "fully complementary" when all (100%) of the bases of the first nucleotide sequence hybridize to all (100%) of the bases in the second nucleotide sequence to form a duplex. In one particular embodiment, the two nucleotide sequences hybridize under stringent conditions. In another particular embodiment, the two nucleotide sequences hybridize under highly stringent conditions.

[0038] As used herein, the term "partially complementary" in the context of two nucleotide sequences means that at least 65% but less than 80% of the bases in a contiguous sequence of a first nucleotide sequence hybridize to the same number of bases in a contiguous sequence of a second nucleotide sequence to form a duplex. In one particular embodiment, the two nucleotide sequences hybridize under stringent conditions. In another particular embodiment, the two nucleotide sequences hybridize under very stringent conditions.

[0039] As used herein, the term "substantially complementary" in the context of two nucleotide sequences means that at least 80% but less than 100% of the bases in the contiguous sequence of the first nucleotide sequence hybridize to the same number of bases in the contiguous sequence of the second nucleotide sequence to form a duplex. In some embodiments, two nucleotide sequences are substantially complementary if at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% but less than 100% of the bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide to form a duplex. In one particular embodiment, the two nucleotide sequences hybridize under stringent conditions. In another particular embodiment, the two nucleotide sequences hybridize under very stringent conditions.

[0040] As used herein, the terms "about" and "approximately", when referring to a numerical value, include the recited numerical value and a variation within + / - 20%. For example, about 20% includes 16% to 24% and values ​​therebetween (including 20%). In one embodiment, the terms "about" and "approximately", when referring to a numerical value, include the recited numerical value and a variation within + / - 15%. In another embodiment, the terms "about" and "approximately", when referring to a numerical value, include the recited numerical value and a variation within + / - 10%. In another embodiment, the terms "about" and "approximately", when referring to a numerical value, include the recited numerical value and a variation within + / - 5%.

[0041] As used herein, the term "stringent" when referring to hybridization means that under "stringent conditions" or "stringent hybridization conditions", a first nucleotide sequence hybridizes to a second nucleotide sequence with minimal hybridization to other sequences. In certain embodiments, an antisense sequence hybridizes to its target sequence under stringent conditions with minimal targeting to other sequences. Stringent conditions are sequence dependent (e.g., sequence length, complementarity) and vary under different environmental parameters (e.g., assay conditions, physiological environment). Examples of stringent hybridization conditions may include 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. One of skill in the art will understand that variations in hybridization stringency are essentially as described.

[0042] As used herein, the term "highly stringent" refers to hybridization where a first nucleotide sequence is only observed to hybridize to a second nucleotide under "highly stringent conditions" or "highly stringent hybridization conditions". In certain embodiments, an antisense sequence is only observed to hybridize to its target sequence under highly stringent conditions. Also, highly stringent conditions may not allow hybridization between partially complementary sequences. Highly stringent conditions are sequence-dependent (e.g., sequence length, complementarity) and vary under different environmental parameters (e.g., assay conditions, physiological environment). Highly stringent conditions may include higher temperatures, lower ionic strength, and / or shorter reaction times compared to stringent conditions under the same environment. For example, highly stringent conditions can include hybridization temperatures of about 71° C., about 72° C., about 73° C., about 74° C., about 75° C., about 76° C., about 77° C., about 78° C., about 79° C., about 80° C., or higher. One of skill in the art will understand that variations in stringency of hybridization are essentially as described.

[0043] As used herein, a "target sequence" refers to a continuous portion of the nucleotide sequence of an RNA molecule formed during transcription of the MAPT gene, including an mRNA that is a product of RNA processing of a primary transcript (e.g., MAPT mRNA resulting from alternative splicing). In one embodiment, the continuous portion of the nucleotide sequence is at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the MAPT gene. In a particular embodiment, the target sequence is about 15-30 nucleotides in length. For example, the target sequence may be about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 1 The target sequence may be 9-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In certain embodiments, the target sequence is 19-25 nucleotides in length. In some embodiments, the target sequence is about 21-23 nucleotides in length. Ranges and lengths intermediate to the above listed ranges and lengths are also contemplated as part of the present disclosure.

[0044] As used herein, the phrases "a nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences", "a nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences", "a nucleotide sequence corresponding to any one of the sense strand nucleotide sequences", "a nucleotide sequence corresponding to any one of the nucleotide sequences", or "a nucleotide sequence corresponding to any one of the SEQ ID NOs" refer to an oligonucleotide comprising a chain of nucleotides comprising the recited unmodified nucleotides, or one or more modified nucleotides, or one or more conjugated moieties (e.g., a moiety described herein, such as a lipid, or a modified nucleotide conjugated to a moiety described herein). Those skilled in the art will recognize that the recited unmodified nucleotides can be substituted by other moieties without substantially altering the base pairing properties of the oligonucleotide comprising the nucleotides having such substituted moieties. For example, a nucleotide comprising inosine as a base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine can be substituted, for example, by a nucleotide containing inosine. In another example, adenine and cytosine can be substituted with guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA.

[0045] As used herein, the phrases "non-naturally occurring small interfering ribonucleic acid (siRNA) agent," "non-naturally occurring small interfering ribonucleic acid agent," or "non-naturally occurring siRNA agent" refer to an siRNA agent that is not found in nature. A non-naturally occurring siRNA may contain one or more modified nucleotides.

[0046] As used herein, in the context of a 5' or 3' nucleotide overhang, the term "overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of the siRNA agent. For example, a nucleotide overhang exists when the 3' end of one strand of the siRNA agent extends beyond the 5' end of the other strand, or vice versa. In some embodiments, the overhang exists at the 3' end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3'-overhang exists at the antisense strand. In another embodiment, the 3'-overhang exists at the sense strand. In some embodiments, the overhang exists at the 5' end of the sense strand, the antisense strand, or both strands. In one embodiment, the 5'-overhang exists at the antisense strand. In another embodiment, the 5'-overhang exists at the sense strand. The overhang may be due to one strand being longer than the other, or may be the result of two strands of the same length being staggered. In some embodiments, the overhang forms a mismatch with the target sequence. In other embodiments, the overhang is complementary to the targeted gene sequence. The nucleotides in the overhang region of the siRNA agent can each independently be modified or unmodified nucleotides (e.g., 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, deoxy nucleotides, or combinations thereof).

[0047] In some embodiments, the 5'- or 3'-overhang of the sense strand or antisense strand of the siRNA agent is phosphorylated.In certain embodiments, the 5'- or 3'-overhang of the sense strand and antisense strand of the siRNA agent is phosphorylated.In some embodiments, the overhang region contains two nucleotides with phosphorothioate between the two nucleotides, and these two nucleotides can be the same or different.

[0048] In some embodiments, the siRNA agent contains only a single overhang, which can enhance the interference activity of the siRNA agent without affecting its overall stability.For example, the single-stranded overhang can be located at the 3' end of the sense strand of the siRNA agent, or alternatively, can be located at the 3' end of the antisense strand of the siRNA agent.The siRNA agent can also have a blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa.In some embodiments, the antisense strand of the siRNA agent has a nucleotide overhang at the 3' end, and the 5' end is blunt.

[0049] In some embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of at least one nucleotide, at least two nucleotides, or at least three nucleotides. In certain embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of at least one nucleotide, at least two nucleotides, or at least three nucleotides, but not more than five nucleotides. In some embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of one nucleotide, two nucleotides, or three nucleotides. In certain embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of one to two nucleotides, one to three nucleotides, one to four nucleotides, or one to five nucleotides. In some embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' and 3' ends of 2-3 nucleotides, 2-4 nucleotides, or 2-5 nucleotides. In certain embodiments, one strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' and 3' ends of 3-4 nucleotides or 4-5 nucleotides. The strand may be the antisense strand or the sense strand. The nucleotide overhang may comprise or consist of a nucleotide analog or a nucleoside analog.

[0050] In some embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of at least one nucleotide, at least two nucleotides, or at least three nucleotides. In certain embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of at least one nucleotide, at least two nucleotides, or at least three nucleotides, but not more than five nucleotides. In some embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of one nucleotide, two nucleotides, or three nucleotides. In certain embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' end and the 3' end of one to two nucleotides, one to three nucleotides, one to four nucleotides, or one to five nucleotides. In some embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' and 3' ends of 2-3 nucleotides, 2-4 nucleotides, or 2-5 nucleotides. In certain embodiments, each strand of the siRNA agent comprises an overhang at the 5' end, the 3' end, or both the 5' and 3' ends of 3-4 nucleotides or 4-5 nucleotides. The nucleotide overhangs may comprise or consist of nucleotide or nucleoside analogs.

[0051] As used herein, the term "blunt" or "blunt end" in the context of an siRNA agent means that there is no unpaired nucleotide or nucleotide analog at a given end of the siRNA agent, i.e., there is no nucleotide overhang. In some embodiments, one end of the siRNA agent is blunt. In other words, the 5' end of one strand and the 3' end of the other strand do not contain unpaired nucleotides or nucleotide analogs. In some embodiments, both ends of the siRNA agent are blunt. In other words, there is no nucleotide overhang at either end of the siRNA agent.

[0052] As used herein, the term "antisense strand" or "guide strand" in the context of a siRNA agent refers to the strand that includes the region that is complementary to the target sequence.

[0053] As used herein, the term "sense strand" or "passenger strand" in the context of a siRNA agent refers to the strand of the siRNA agent that includes a region that is complementary to a region of the antisense strand.

[0054] As used herein, the term "modified" in the context of the nucleobase of siRNA agent refers to the nucleobase that is not naturally found in RNA molecule.Naturally occurring RNA sequences include purine bases adenine (A) and guanine (G), and pyrimidine bases cytosine (C) and uracil (U).See section 6.2 below, e.g., modified nucleobases.

[0055] As used herein, the term "modified" in the context of a nucleotide of a siRNA agent refers to a nucleotide that is not naturally found in an RNA molecule. See, Section 6.2, below, e.g., Modified Nucleotides.

[0056] As used herein, unless otherwise specified, the term "isomers" refers to different compounds that have the same molecular formula. "Stereoisomers" are isomers that differ only in the way the atoms are arranged in space. "Atropisomers" are stereoisomers from hindrance of rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion may be known as a "racemic" mixture. "Diastereoisomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0057] "Stereoisomer" may also include E and Z isomers, or mixtures thereof, as well as cis and trans isomers, or mixtures thereof. In certain embodiments, the compounds described herein are isolated as either the E or Z isomer. In other embodiments, the compounds described herein are a mixture of E and Z isomers.

[0058] It should be noted that in the event of a discrepancy between a depicted structure and the name of that structure, the depicted structure takes precedence.

[0059] As used herein, the terms "comprising" and "including" may be used interchangeably. The terms "comprising" and "including" should be interpreted as specifying the presence of the stated features or components as referred to, but do not exclude the presence or addition of one or more features or components, or groups thereof. In addition, the terms "comprising" and "including" are intended to include examples encompassed by the term "consisting of". Thus, the term "consisting of" can be used in place of the terms "comprising" and "including" to provide more specific embodiments.

[0060] As used herein, the term "or" should be interpreted as an inclusive "or" meaning any one or any combination. Thus, "A, B, or C" means any of A, B, C, A and B, A and C, B and C, A, B and C. Exceptions to this definition will occur only if combinations of elements, features, steps, or acts are in some way inherently mutually exclusive.

[0061] As used herein, the phrase "and / or" used in phrases such as "A and / or B" herein is intended to include both A and B, A or B, A (alone), and B (alone). Similarly, the phrase "and / or" used in phrases such as "A, B, and / or C" is intended to include each of the following embodiments: A, B, and C, A, B, or C, A or C, A or B, B or C, A and C, A and B, B and C, A (alone), B (alone), and C (alone).

[0062] 6.1 Nucleotide Sequence Provided herein are siRNA agents that inhibit (e.g., partially or completely) the expression of the MAPT gene (e.g., the human MAPT gene). In certain embodiments, the siRNAs described herein inhibit the expression of the MAPT gene (e.g., the human MAPT gene) by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60% relative to a negative control (e.g., PBS or an siRNA directed to an RNA molecule formed during transcription of a gene other than MAPT) in an assay known to those of skill in the art or described herein (e.g., Section 6.8 below or Section 7 below). In another specific embodiment, the siRNAs described herein inhibit the expression of the MAPT gene (e.g., the human MAPT gene) by at least about 70%, at least 75%, at least 80%, or at least 85% relative to a negative control (e.g., PBS or an siRNA directed to an RNA molecule formed during transcription of a gene other than MAPT) in an assay known to those of skill in the art or described herein (e.g., Section 6.8 below or Section 7 below). In another specific embodiment, the siRNA described herein inhibits expression of the MAPT gene (e.g., human MAPT gene) by at least about 90%, at least 95%, at least 96%, at least 97%, or at least 98% relative to a negative control (e.g., PBS or an siRNA directed to an RNA molecule formed during transcription of a gene other than MAPT) in an assay known to one of skill in the art or described herein (e.g., Section 6.8, below, or Section 7, below). In another specific embodiment, the siRNA described herein inhibits expression of the MAPT gene (e.g., human MAPT gene) by 25%-50%, 50%-75%, 75%-85%, 85%-95%, 90%-95%, or 95%-99% relative to a negative control (e.g., PBS or an siRNA directed to an RNA molecule formed during transcription of a gene other than MAPT) in an assay known to one of skill in the art or described herein (e.g., Section 6.8, below, or Section 7, below).In another particular embodiment, the siRNA described herein inhibits expression of the MAPT gene (e.g., human MAPT gene) by 100% in an assay known to one of skill in the art or described herein (e.g., in Section 6.8 below or in Section 7 below) relative to a negative control (e.g., PBS or an siRNA directed to an RNA molecule formed during transcription of a gene other than MAPT). In a particular embodiment, inhibition of MAPT gene (e.g., human MAPT gene) expression was assessed using an in vitro assay described in Section 7 below. In a particular embodiment, the siRNA agent described herein exhibits in vitro or ex vivo knockdown efficiency, e.g., as described in Section 7 below. In a particular embodiment, the siRNA agent described herein exhibits in vivo knockdown efficiency, e.g., in a mouse model, as described in Section 7 below. In a particular embodiment, the siRNA agent described herein exhibits one, two, three, or more than four of the characteristics of an RNA molecule described in Section 7 below.

[0063] In certain embodiments, the siRNA agents described herein have an IC of between 10 nM and 200 nM in the assays described herein (e.g., Section 7, below). 50 and inhibits expression of the MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons). In certain embodiments, the siRNA agents described herein have an IC of 10 nM to 100 nM in assays described herein (e.g., Section 7, below). 50 and inhibits expression of the MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons). In certain embodiments, the siRNA agents described herein have an IC of 10 nM to 50 nM in assays described herein (e.g., Section 7, below). 50 and inhibiting the expression of a MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons).

[0064] In certain embodiments, the siRNA agent described herein is stable in one, two or all of mouse brain homogenate, human liver lysosome, and rat liver tritosome in vitro or ex vivo.The stability of such siRNA agent can be evaluated using methods known to those skilled in the art or as described herein (e.g., in Section 6.8 or Section 7 below).

[0065] In certain embodiments, the siRNA agent is a double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide comprising a sense strand and an antisense strand that anneal to form a double-stranded region or duplex. The antisense strand comprises a region that is substantially complementary, and generally completely complementary, to the target sequence. The sense strand comprises a region that is complementary to the antisense strand, such that the two strands hybridize to form a duplex structure when combined under appropriate conditions. As described herein and known in the art, the complementary sequences of the siRNA agent can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides. In certain embodiments, the annealing of the sense strand and antisense strand sequences forms a duplex that is stable as assessed by a melting temperature (Tm) of about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, about 45°C, or higher. For example, see Section 6.8 below for melting temperature assays.

[0066] The sense strand and the antisense strand of the siRNA agent described herein may be the same length or different lengths. The sense strand and the antisense strand of the siRNA agent described herein may each be 15-30 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each 30 nucleotides or less in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 15-30 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 16-30 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 17-30 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 18-30 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19-30 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agents described herein are each independently 20-30 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agents described herein are each independently 21-30 nucleotides in length.

[0067] In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 15-25 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 16-25 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 17-25 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 18-25 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19-25 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 20-25 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 21-25 nucleotides in length.

[0068] In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19-23 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19-22 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19-21 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 19 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 20 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 21 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA agent described herein are each independently 22 nucleotides in length.

[0069] The double-stranded region formed by hybridization of the antisense strand and the sense strand of the siRNA agent described herein can be the full length of both strands. For example, the antisense strand of the siRNA agent described herein can be 19 nucleotides long, the sense strand of the siRNA agent can be 19 nucleotides long, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of the siRNA agent described herein can be 21 nucleotides long, the sense strand of the siRNA agent can be 21 nucleotides long, and the double-stranded region formed by hybridization of the strands is 21 nucleotides. The double-stranded region formed by hybridization of the antisense strand and the sense strand of the siRNA agent described herein can be less than the full length of one or both strands. For example, the antisense strand of the siRNA agent described herein can be 19 nucleotides long, the sense strand of the siRNA agent can be 21 nucleotides long, and the double-stranded region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of the siRNA agent described herein may be 21 nucleotides long, the sense strand of the siRNA agent may be 19 nucleotides long, and the double-stranded region formed by hybridization of the strands is 19 nucleotides.In another example, the antisense strand of the siRNA agent described herein may be 21 nucleotides long, the sense strand of the siRNA agent may be 21 nucleotides long, and the double-stranded region formed by hybridization of the strands is 19 nucleotides.In certain embodiments, the double-stranded region of the siRNA agent described herein is long enough to function as a substrate for the dicer enzyme.

[0070] In certain embodiments, the double-stranded region of the siRNA agent described herein is 15-30 base pairs in length. For example, the double-stranded region of the siRNA agent described herein is 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29 , 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In some embodiments, the double-stranded region of the siRNA agents described herein is 15-25 base pairs in length. In certain embodiments, the double-stranded region of the siRNA agents described herein is 16-25 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 17-25 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 18-25 base pairs in length. In certain embodiments, the double-stranded region of the siRNA agent described herein is 19-25 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 20-25 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 21-25 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 19-23 base pairs in length. In certain embodiments, the double-stranded region of the siRNA agent described herein is 19-22 base pairs in length. In some embodiments, the double-stranded region of the siRNA agent described herein is 19-21 base pairs in length. In certain embodiments, the double-stranded region of the siRNA agents described herein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs in length.In certain embodiments, the double-stranded region of the siRNA agents described herein is 19, 20, 21, 22, or 23 base pairs in length. Ranges and lengths intermediate to the above listed ranges and lengths are also contemplated as part of the present disclosure.

[0071] In some embodiments, the siRNA agents described herein are blunt ended. In other embodiments, the sense strand or antisense strand of the siRNA agent described herein comprises an overhang. The overhang may be at the 5' end, the 3' end, or both the 5' and 3' ends of either the sense strand or the antisense strand of the siRNA agent. In some embodiments, the sense strand and the antisense strand of the siRNA agent described herein comprise an overhang. The sense strand overhang may be at the 5' end of the sense strand, and the antisense strand overhang may be at the 3' end of the antisense strand. Alternatively, the sense strand overhang may be at the 3' end of the sense strand, and the antisense strand overhang may be at the 5' end of the antisense strand. In certain embodiments, the strand overhang of the siRNA agent comprises at least one nucleotide. In some embodiments, the strand overhang of the siRNA agent comprises at least two nucleotides. In certain embodiments, the strand overhang of the siRNA agent comprises at least three nucleotides. In some embodiments, the strand overhang of the siRNA agent comprises at least 4 nucleotides. In certain embodiments, the strand overhang of the siRNA agent comprises at least 5 nucleotides. In some embodiments, the strand overhang of the siRNA agent comprises 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 or more. In certain embodiments, the strand overhang of the siRNA agent comprises 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, or 1-2 nucleotides. In some embodiments, the strand overhang of the siRNA agent comprises 2-5 nucleotides, 2-4 nucleotides, 2-3 nucleotides, 3-4 nucleotides, 3-4 nucleotides, or 4-5 nucleotides.

[0072] In certain embodiments, the sense strand of the siRNA agent described herein is 19 nucleotides long, and the antisense strand of the siRNA agent is 21 nucleotides long. In some embodiments, the sense strand of the siRNA agent described herein is 20 nucleotides long, and the antisense strand of the siRNA agent is 21 nucleotides long. In certain embodiments, the sense strand of the siRNA agent described herein is 21 nucleotides long, and the antisense strand of the siRNA agent is 21 nucleotides long. In some embodiments, the sense strand of the siRNA agent described herein is 21 nucleotides long, and the antisense strand of the siRNA agent is 19 nucleotides long. In certain embodiments, the sense strand of the siRNA agent described herein is 21 nucleotides long, and the antisense strand of the siRNA agent is 20 nucleotides long. In some embodiments, the sense strand of the siRNA agent described herein is 19 nucleotides long, and the antisense strand of the siRNA agent is 19 nucleotides long. In some embodiments, the sense strand of the siRNA agent described herein is 20 nucleotides long, and the antisense strand of the siRNA agent is 20 nucleotides long.

[0073] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to any one of the sense strand nucleotide sequences in Table 1.

[0074] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences in Table 1.

[0075] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence in a row of Table 1, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence in the same row of Table 1. In a particular embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of UM25, UM28, UM96, UM165, or UM177 in Table 1, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of UM25, UM28, UM96, UM165, or UM177 in Table 1, respectively.

[0076] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the antisense strand in Table 1, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the antisense strand in Table 1, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the antisense strand in Table 1, and the sense strand comprises a nucleotide sequence completely complementary to the antisense strand.

[0077] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence completely complementary to the sense strand.

[0078] In some embodiments, the siRNA agent does not include chemical modifications or conjugations, e.g., known in the art and described herein. For siRNA agents that include chemical modifications or conjugations, see, e.g., Section 6.2, infra, and Section 7, infra. In certain embodiments, the siRNA agent includes chemical modifications or conjugations, e.g., known in the art and described herein. In certain embodiments, the siRNA agent includes one or more chemical modifications and / or conjugations described herein (e.g., in Section 6.2, infra, and / or in Section 7, infra. In certain embodiments, the nucleobase of the nucleotide is modified. In some embodiments, the sugar of the nucleotide is modified. In certain embodiments, the phosphate backbone of the nucleotide is modified.

[0079] siRNA agent may contain only naturally occurring nucleotides or may contain one or more modified nucleotides.In certain embodiments, the nucleobase of nucleotide is modified.In some embodiments, the sugar of nucleotide is modified.In certain embodiments, the phosphate backbone of nucleotide is modified.

[0080] In certain embodiments, the modified nucleotide comprises one or more modified nucleotides described herein (e.g., in Section 6.2, below, or in Section 7, below). In certain embodiments, the modified nucleotide is selected from the group consisting of 2'O-methyl modified nucleotides, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, 3'-O-methyl modified nucleotides, 3'-O-methyl modified nucleotides with 2'-5' linked phosphates, inverted abasic nucleotides, nucleotides comprising S-glycol nucleic acids (GNAs), non-locked nucleotides, 5'-vinylphosphonate-2'-O-methyl-uridine, cis-cyclobutylphosphonate modified nucleotides, 5'-cis-cyclobutylphosphonate-2'-O-methyl modified nucleotides, (L)-α-threofuranosyl modified nucleotides, and combinations thereof.

[0081] In certain embodiments, the antisense strand of a siRNA agent described herein comprises at least one modified internucleoside linkage.

[0082] In certain embodiments, the sense strand of a siRNA agent described herein contains at least one modified internucleoside linkage.

[0083] In certain embodiments, the antisense and sense strands of the siRNA agents described herein each comprise at least one modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage comprises a phosphorothioate.

[0084] In certain embodiments, the siRNA agents described herein include one or more of phosphorothioate (PS) linkages, 2'-fluororibose (2'-F), 2'-methoxyribose (2'-OMe), deoxyribose, 2'-O-(2-methoxyethyl)ribose (2'-MOE), inverted linkages (inverted abasic sites, InVAb), non-locked nucleic acids (UNAs), and glycol nucleic acids (GNAs).

[0085] In certain embodiments, the siRNA agents described herein exhibit stability as assessed by an assay described herein (e.g., in Section 6.8, below, or in Section 7, below), or an assay known to one of skill in the art. In certain embodiments, the siRNA agents described herein that include one or more modified nucleotides exhibit increased stability relative to the same siRNA agents that do not include those one or more modified nucleotides, as assessed using a method known to one of skill in the art or described herein (e.g., in Section 6.8, below, or in Section 7, below).

[0086] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 2. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 2.

[0087] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand which form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence in a column of Table 2, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence in the same column of Table 2.

[0088] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0089] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0090] In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 3. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 3. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence in a row of Table 3, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence in the same row of Table 3.

[0091] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0092] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0093] In some embodiments, the siRNA agent described herein is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, delivery polymers, or delivery vehicles.For example, for siRNA agents conjugated to one or more non-nucleotide groups, see section 6.3 below for additional information.In certain embodiments, the one or more non-nucleotide groups are one or more of those described herein (e.g., in section 6.3 below or in section 7 below).

[0094] In certain embodiments, the antisense strand of the siRNA agent described herein is directly or indirectly conjugated to one or more lipophilic moieties. For example, regarding lipophilicity, see S. Winiwarter, M. Ridderstrom, A.-L. Ungell, TB Andersson, I. Zamora, Use of Molecular Descriptors for Absorption, Distribution, Metabolism, and Excretion Predictions.Comprehensive Medicinal Chemistry II, Volume 5, 2007, pages 531-554. In certain embodiments, the sense strand of the siRNA agent described herein is directly or indirectly conjugated to one or more lipophilic moieties. In certain embodiments, the antisense strand and the sense strand of the siRNA agent described herein are each directly or indirectly conjugated to one or more lipophilic moieties. One or more lipophilic moieties may be conjugated to one or more terminal positions of the siRNA agent. For example, the lipophilic moiety may be conjugated to the 5'-end and / or 3'-end of one or both strands of the siRNA agent. Alternatively, or in addition, one or more lipophilic moieties may be conjugated to one or more internal positions of the double-stranded region of the siRNA agent. In certain embodiments, the lipophilic moiety is conjugated to one or more terminal positions of the siRNA agent and one or more internal positions of the siRNA agent. In some embodiments, the one or more lipophilic moieties are conjugated via a linker or carrier. In certain embodiments, the linker is as described herein (e.g., in Section 6.3 below). For example, the linker may include one of the following structures:

[0095] [ka]

[0096] In certain embodiments, the lipophilic moiety comprises a lipophilic moiety described herein (e.g., in Section 6.3, infra, Section 6.4, infra, or Section 7, infra). In certain embodiments, the lipophilic moiety is cholesterol. In certain embodiments, the lipophilic moiety is selected from one or more of L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L20, L21, L22, L23, and / or L24 (see Figure 3). In certain embodiments, the lipophilic moiety is cholesterol-triethylene glycol, 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((Z)-octadec-9-en-1-yl)oxy)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, N,N'-((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidine-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)palmitamide, (2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidine-1( 2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropanamide, 1-((2R,3R,4R,5R)-3- (2-(hexadecyloxy)ethoxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, hexadecyl((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)carbamate, (2R,3R,4R,5R)-5-(heptadecyloxy)-2-(hydroxymethyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol, (2R,3R,4R,5R)-4-(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran-3-ol, (2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol, (2R,3R,4R,5R)-4,5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran Ran-3-ol, (2R,3R,4S,5R)-5,6-bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol, 1-((2R,3R,4R,5R)-3-((15-((3r,5r,7r)-adamantan-1-yl)pentadecyl)oxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, (1s,4s)-4-heptadecanamidocyclohexane-1-carboxyl-, 16-oxo-16-((( 1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-, 16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-, 15-((3r,5r,7r)-adamantan-1-yl)pentadecanonyl-, 2-(2-(N-hexadecylpalmitamido)-N-methylacetamido)ethanoyl-, 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxoheptanonyl 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)hexadecanonyl-, (2R,3R,4R,5R)-2-(6-amino-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, (2R,3R,4R,5R)-2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydro-2H-pyran-3-ol. In certain embodiments, a lipophilic moiety as described in Section 7 is conjugated to the sense strand of the siRNA agent in a manner described in Section 7.

[0097] In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence in a row of Table 9, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence in the same row of Table 9. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence in a row of Table 9, and the sense strand is conjugated to a cholesterol shown in Table 9 conjugated to the sense strand of the siRNA agent. In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand which form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence of a column in Table 9, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence of the same column in Table 9, and the sense strand is conjugated to a cholesterol shown in Table 9 which is conjugated to the sense strand of the siRNA agent.

[0098] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is completely complementary to the antisense strand.

[0099] In certain embodiments, provided herein are siRNA agents comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and the sense strand of the siRNA agent is conjugated to cholesterol as shown in Table 9 or another lipid moiety, for example, as described in Figure 3. In some embodiments, provided herein are siRNA agents comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand, and the sense strand of the siRNA agent is conjugated to cholesterol as shown in Table 9 or another lipid moiety, for example, as described in Figure 3. In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 9, and the sense strand comprises a nucleotide sequence that is fully complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to cholesterol as set forth in Table 9, or to another lipid moiety, e.g., as described in FIG.

[0100] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, and the antisense strand comprises a nucleotide sequence that is completely complementary to the sense strand.

[0101] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, the sense strand is conjugated to cholesterol shown in Table 9 conjugated to the sense strand of the siRNA agent, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, the sense strand is conjugated to cholesterol shown in Table 9, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 9, the sense strand is conjugated to cholesterol shown in Table 9, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0102] In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 4, and wherein the sense strand is conjugated to cholesterol or another lipid shown in the same row of Table 4. In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 4, and wherein the sense strand is conjugated to cholesterol or another lipid (e.g., lipid in FIG. 3). In one embodiment, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence in a row of Table 4, wherein the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence in the same row of Table 4, and wherein the sense strand is conjugated to cholesterol or another lipid shown in the same row of Table 4.

[0103] In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 4, the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and the sense strand is conjugated to cholesterol or another lipid (e.g., a lipid in Figure 3). In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 4, the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand, and the sense strand is conjugated to cholesterol or another lipid (e.g., a lipid in Figure 3). In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence that is fully complementary to the antisense strand, and wherein the sense strand is conjugated to cholesterol or another lipid (e.g., a lipid in Figure 3).

[0104] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety shown in the same row of Table 5.

[0105] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, and wherein the sense strand is conjugated to a lipid moiety described herein.

[0106] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence of a column in Table 5, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence of the same column in Table 5. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence of a column in Table 5, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence of the same column in Table 5, and the sense strand is conjugated to a lipid moiety shown in the same column in Table 5.

[0107] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and the sense strand is conjugated to a lipophilic moiety as described herein. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and the sense strand is conjugated to a lipophilic moiety as described herein. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence completely complementary to the antisense strand.In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 5, and the sense strand comprises a nucleotide sequence that is fully complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic moiety as described herein.

[0108] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, wherein the sense strand is conjugated to a lipid moiety shown in the same row of Table 5, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, the sense strand is conjugated to a lipid moiety shown in the same row in Table 5, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, and the antisense strand comprises a nucleotide sequence completely complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 5, the sense strand is conjugated to a lipid moiety shown in the same row in Table 5, and the antisense strand comprises a nucleotide sequence completely complementary to the sense strand.

[0109] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid moiety shown in the same row of Table 33.

[0110] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, and wherein the sense strand is conjugated to a lipid moiety described herein.

[0111] In one embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence of a column in Table 33, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence of the same column in Table 33. In another embodiment, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of the antisense strand nucleotide sequence of a column in Table 33, and the sense strand comprises a nucleotide sequence of the sense strand nucleotide sequence of the same column in Table 33, and the sense strand is conjugated to a lipid moiety shown in the same column in Table 33.

[0112] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is partially complementary to the antisense strand, and the sense strand is conjugated to a lipophilic moiety as described herein. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is substantially complementary to the antisense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and the sense strand is conjugated to a lipophilic moiety as described herein. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises any one of the nucleotide sequences of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence completely complementary to the antisense strand.In certain embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 33, and the sense strand comprises a nucleotide sequence that is fully complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic moiety as described herein.

[0113] In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, wherein the sense strand is conjugated to a lipid moiety shown in the same row of Table 33, and the antisense strand comprises a nucleotide sequence that is partially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence that is substantially complementary to the sense strand. In some embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, the sense strand is conjugated to a lipid moiety shown in the same row in Table 33, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, and the antisense strand comprises a nucleotide sequence completely complementary to the sense strand. In certain embodiments, provided herein is an siRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises any one of the nucleotide sequences of the sense strand nucleotide sequences in Table 33, the sense strand is conjugated to a lipid moiety shown in the same row in Table 33, and the antisense strand comprises a nucleotide sequence completely complementary to the sense strand.

[0114] In certain embodiments, the siRNA agent described herein comprises an antisense strand and a sense strand of those named in Tables 1, 2, 3, 4, 5, 9, or 33. In certain embodiments, the siRNA agent described herein comprises an antisense strand and a sense strand corresponding to the antisense strand and the sense strand of any one of UM25, UM28, UM96, UM165, or UM177 in Table 1. In certain embodiments, the siRNA agent described herein comprises an antisense strand and a sense strand of any one of UM25, UM28, UM96, UM165, or UM177 in Table 2. In certain embodiments, the siRNA agent described herein comprises an antisense strand and a sense strand of those named in Tables 3, 4, 5, 9, or 33. In some embodiments, the sense strand of the siRNA agent is conjugated to a lipid moiety described herein (e.g., FIG. 3). In certain embodiments, the siRNA agent is one described in Section 7 below.

[0115] In some embodiments, the siRNA agent described herein further comprises a non-nucleotide group such as a ligand (e.g., a targeting ligand). The non-nucleotide group such as a ligand (e.g., a targeting ligand) may be directly or directly conjugated to the antisense or sense strand of the siRNA agent. The non-nucleotide group such as a ligand (e.g., a targeting ligand) replaces one or more nucleotides at an internal position of the double-stranded region of the siRNA agent described herein. In certain embodiments, the non-nucleotide group such as a ligand (e.g., a targeting ligand) is conjugated to the strand of the siRNA agent via a linker or a carrier (e.g., a delivery vehicle). In certain embodiments, the non-nucleotide group such as a ligand (e.g., a targeting ligand) is as described in Section 6.3 below.

[0116] [Table 1-1]

[0117] [Table 1-2]

[0118] [Table 1-3]

[0119] [Table 1-4]

[0120] [Table 1-5]

[0121] 6.2 Chemical Modifications of Nucleotides In certain embodiments, the siRNA agent described herein comprises one or more nucleotide modifications. Nucleotide modifications include, for example, terminal modifications, such as 5'-end modifications (e.g., phosphorylation, conjugation, inverted linkage) or 3'-end modifications (e.g., conjugation, DNA nucleotide, inverted linkage, etc.); base modifications, such as stabilizing bases, destabilizing bases, or bases that base-pair with an expanded repertoire of partners, removing bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at 2' or 4' positions) or sugar replacements; or backbone modifications, including modifications or replacements of phosphodiester linkages. In some embodiments, the siRNA agent comprises at least one modification selected from the group consisting of modified internucleoside linkages, modified nucleobases, modified sugars, and any combination thereof. Without limitation, such modifications may be present anywhere in the siRNA agent (e.g., in the sense strand, the antisense strand, or both strands).

[0122] In some embodiments, the siRNA agents comprise one or more modified sugar modifications, such as one or more substituted sugar moieties. In some embodiments, the siRNA agents described herein comprise one of the following at the 2' position: H, F, or OCH3(OMe).

[0123] In some embodiments, the siRNA agents described herein comprise one or more glycol nucleic acids (GNAs). Typically, GNAs are acyclic nucleic acid analogs whose repeating glycol units are linked by phosphodiester bonds, which differs from the ribose sugar-phosphodiester backbone composition of RNA.

[0124] In certain embodiments, the siRNA agents described herein comprise one or more terminal modifications, such as 5'-terminal phosphorylation, conjugation, or inverted linkage. In some embodiments, the terminal modification comprises a 5'-phosphate, such as a 5'-terminal phosphate on the antisense strand of the siRNA agent.

[0125] In some embodiments, the siRNA agent comprises a sense strand and / or an antisense strand having an inverted abasic nucleotide. In one embodiment, the sense strand contains an inverted abasic nucleotide at the 3' end. In another embodiment, the sense strand contains an inverted abasic nucleotide at the 5' end. In some embodiments, the sense strand contains an inverted abasic nucleotide at both the 5' and 3' ends.

[0126] In some embodiments, the siRNA agent comprises a phosphate or a phosphate mimic at the 5'-end of the antisense strand. In one embodiment, the phosphate mimic is a 5'-vinylphosphonate (VP).

[0127] In some embodiments, the siRNA agent comprises one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from the group consisting of 2'O-methyl modified nucleotides, deoxynucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl-uridine, 3'-O-methyl modified nucleotides, 3'-O-methyl modified nucleotides with 2'-5' linked phosphates, inverted abasic nucleotides, nucleotides containing S-glycol nucleic acid (GNA), non-locked nucleotides, 5'-vinylphosphonate-2'-O-methyl-uridine, cis-cyclobutylphosphonate modified nucleotides, 5'-cis-cyclobutylphosphonate-2'-O-methyl modified nucleotides, (L)-α-threofuranosyl modified nucleotides, and combinations thereof.

[0128] In some embodiments, the siRNA agent comprises one or more modified internucleoside linkages (i.e., modified RNA backbones). Modified internucleoside linkages include, for example, phosphorothioates (e.g., phosphoromonothioates). Various salts, mixed salts, and free acid forms are also included. In some embodiments, the siRNA agent described herein is in free acid form. In other embodiments, the siRNA agent described herein is in salt form. In one embodiment, the siRNA agent described herein is in sodium salt form. In certain embodiments, when the siRNA agent described herein is in salt form, the salt cation (e.g., sodium cation) is present in the agent as a counterion for substantially all of the electronegative groups (e.g., phosphodiester and / or phosphorothioate groups) present in the agent. In some embodiments, the counterion is a condensed counterion. In certain embodiments, the counterion is a condensed sodium cation. In some embodiments, the condensed counterion is hydrated. In certain embodiments, the condensed counterion is a hydrated sodium cation. The agent in which substantially all of the phosphodiester and / or phosphorothioate linkages have counterions comprises 5, 4, 3, 2, or 1 or less phosphodiester and / or phosphorothioate linkages that do not include counterions.In other words, the electronegative potential of the siRNA agent is neutralized or substantially neutralized by counterion condensation around the siRNA.In some embodiments, when the siRNA agent described herein is in sodium salt form, sodium ions are present around the agent as counterions for substantially all of the phosphodiester and / or phosphorothioate groups present in the agent.

[0129] The phosphate group of the internucleoside phosphodiester linkage can be modified by replacing one of the oxygens with a different substituent.One result of this modification can be the increased resistance of the oligonucleotide to nucleolytic degradation.Another result of this modification can be the increased stability of the hybridized single-stranded RNA (ssRNA) in the siRNA agent.Examples of modified phosphate groups include phosphorothioates (e.g., phosphoromonothioates).

[0130] In some embodiments, the siRNA agent comprises an RNA mimic in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with alternative groups. In certain embodiments, the base units are maintained for hybridization with the appropriate target sequence.

[0131] The siRNA agents described herein can contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined with respect to absolute stereochemistry as (R) or (S), such as for sugar anomers, or (D) or (L), such as for amino acids. All such possible isomers, as well as their racemic and optically pure forms, are included in the siRNA agents provided herein.

[0132] [Table 2-1]

[0133] [Table 2-2]

[0134] [Table 2-3]

[0135] 6.3 Parts linked to nucleotide sequences In some embodiments, the siRNA agent described herein is conjugated to one or more non-nucleotide groups. The non-nucleotide groups can, for example, enhance the targeting, delivery, or conjugation of the siRNA agent. The non-nucleotide groups can be covalently linked at the 3'-end, 5'-end, and / or internally of either the sense strand or the antisense strand of the siRNA agent. The non-nucleotide groups can be covalently linked at the 3'-end, 5'-end, both the 3'-end and 5'-end, internally, both the 3'-end and internally, both the 5'-end and internally, or at the 3'-end, 5'-end, and internally of the sense strand and / or the antisense strand of the siRNA agent. In some embodiments, the siRNA agent described herein contains a non-nucleotide group linked at the 3'-end, 5'-end, both the 3'-end and 5'-end, internally, both the 3'-end and internally, both the 5'-end and internally, or at the 3'-end, 5'-end, and internally of the sense strand. In certain embodiments, the siRNA agent described herein contains a non-nucleotide group linked to the 5'-end of the sense strand. In certain embodiments, the siRNA agent described herein contains a non-nucleotide group linked to the 3' end of the sense strand.In certain embodiments, the siRNA agent described herein contains a non-nucleotide group linked internally to the sense strand.The non-nucleotide group can be linked to the siRNA agent directly or indirectly via a linker / linking group.

[0136] In some embodiments, the siRNA agent is linked to one or more lipid moieties, such as, for example, a cholesterol moiety (e.g., CHOL4, as shown in Figure 3). In certain embodiments, the lipid moiety linked to the siRNA agent comprises one or more of the following compounds shown in Figure 3, or a stereoisomer thereof, or a pharma- ceutically acceptable salt thereof: L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23, and / or L24. In certain embodiments, the lipid moiety is selected from one or more of L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23, and / or L24 (see Figure 3). In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol-triethylene glycol, 1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((Z)-octadec-9-en-1-yl)oxy)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, N,N'-((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2,3-diyl)bis(oxy))bis(propane-3,1-diyl))dipalmitamide, N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran 2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N-hexadecylpropanamide, 1-((2R,3R,4R,5R)-3-(2-(hexadecyloxy)ethoxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, hexadecyl ((2R,3R,4S,5R)-2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)carbamate, (2R,3R,4R,5R)-5-(heptadecyloxy)-2-(hydroxymethyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol, (2R,3R,4R,5R)-4-(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran 2R,3R,4R,5R)-5-(heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol, (2R,3R,4R,5R)-4,5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol, (2R,3R,4S,5R)-5,6-bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol, 1-((2R,3R,4R,5R)-3-((1 5-((3r,5r,7r)-adamantan-1-yl)pentadecyl)oxy)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione, (1s,4s)-4-heptadecanamidocyclohexane-1-carboxyl-, 16-oxo-16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-, 16-(((1S,2R,4S)-1,7,7-trimethylbicyclo[ 2.2.1]heptan-2-yl)oxy)hexadecanonyl-, 15-((3r,5r,7r)-adamantan-1-yl)pentadecanonyl-, 2-(2-(N-hexadecylpalmitamido)-N-methylacetamido)ethanoyl-, 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxohexadecanonyl-, 16-(((1R,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)hexadecanonyl-, -, (2R,3R,4R,5R)-2-(6-amino-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, (2R,3R,4R,5R)-2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate, or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydro-2H-pyran-3-ol. In certain embodiments, a lipid moiety as described in Section 7 is conjugated to the sense strand of the siRNA agent in the manner described in Section 7. In some embodiments, the lipid moiety linked to the siRNA agent comprises one or more of the following compounds shown in Figure 3: L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23, and / or L24 of Figure 3. In some embodiments, the lipid moiety is linked at the 3' end, the 5' end, and / or internally to the sense strand.

[0137] In one embodiment, the sense strand of the siRNA agent is directly or indirectly conjugated to a lipid moiety at the 5' end. In one embodiment, the first nucleotide at the 5' end of the sense strand is connected to a lipid moiety. In one embodiment, the sense strand of the siRNA agent is directly or indirectly conjugated to a lipid moiety internally.

[0138] In one embodiment, the sense strand is directly or indirectly conjugated to a lipid moiety at the 3' end. In one embodiment, the first nucleotide at the 3' end of the sense strand is connected to a lipid moiety. In one embodiment, the first nucleotide at the 3' end of the sense strand is connected to a lipid moiety via a linker. In one embodiment, the linker is a nucleotide linker of 1, 2, 3, 4, or 5 nucleotides in length. In one embodiment, the nucleotide linker is dTdT. In one embodiment, the linker is an InvAb.

[0139] In one embodiment, the sense strand is directly or indirectly conjugated to a lipid moiety at the 5' end, and the sense strand is also directly or indirectly conjugated to a lipid moiety at the 3' end, each of which is as described herein and elsewhere. The lipid moieties at the 5' end and the 3' end can be the same or different.

[0140] In one embodiment, the sense strand is directly or indirectly conjugated to a lipid moiety at the 5'-terminus, the 3'-terminus, and / or internally. The 5'-terminus, the 3'-terminus, and / or internal lipid moieties may be the same or different.

[0141] In some embodiments, a linking group is conjugated to the siRNA agent. The linking group facilitates covalent linkage of the agent to a targeting ligand or a delivery polymer or a delivery vehicle. The linking group may be linked at the 3' end, the 5' end, and / or internally to the siRNA agent sense strand. In some embodiments, the linking group is linked to the siRNA agent sense strand. In some embodiments, the linking group is conjugated at the 5' end, the 3' end, and / or internally to the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated to the 3' end of the sense strand of the siRNA agent. In some embodiments, the linking group is conjugated internally to the sense strand of the siRNA agent.

[0142] A linker or linking group is a connection between two atoms that connects one chemical group (such as a siRNA agent) or segment of interest to another chemical group (such as a targeting group or a delivery polymer) or segment of interest by one or more covalent bonds. A labile linkage includes a labile bond. A linkage can optionally include a spacer that increases the distance between two bonded atoms. A spacer can further add flexibility and / or length to this linkage.

[0143] Any of the siRNA agent nucleotide sequences listed in Tables 1, 2, 3, 4, 5, 9, or 33, whether modified or unmodified, may contain a 3'-terminus, a 5'-terminus, and / or an internal targeting ligand and / or linking group. Any of the siRNA agent duplexes listed in Tables 1, 2, 3, 4, 5, 9, or 33, whether modified or unmodified, may further comprise a targeting ligand and / or linking group, which may be attached at the 3'-terminus, the 5'-terminus, and / or internally to either the sense or antisense strand of the siRNA agent duplex.

[0144] 6.4 Synthesis of siRNA Agents siRNA agents can be synthesized by standard methods known in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SLet al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference, or those described herein (e.g., in section 7 below). For example, siRNA agents can be prepared using a two-step procedure. First, the individual strands of the siRNA agent are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA agent can be prepared using solution-phase or solid-phase organic synthesis, or both. Organic synthesis offers the advantage that oligonucleotide strands containing non-natural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides can be prepared using solution-phase or solid-phase organic synthesis, or both. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems® (Foster City, Calif.). In some embodiments, the oligonucleotides of the siRNA agent described herein are synthesized to contain reactive groups, such as amine groups, at the 5' end, 3' end, and / or internally. Such reactive groups can then be used to attach ligands (e.g., targeting ligands) using methods typical in the art. In some embodiments, the oligonucleotides of the siRNA agent are synthesized with a linking group. This linking group can be used to conjugate non-nucleotide groups (e.g., lipid moieties, ligands, or delivery groups) to the siRNA agent. In some embodiments, the oligonucleotides of the siRNA agent are synthesized by an automated synthesizer using phosphoramidites (e.g., commercially available standard and non-standard phosphoramidites). In certain embodiments, the siRNA agent is produced using the methods described in Section 7 below.In another specific embodiment, the methods described in Section 7, below, are used to produce siRNA agents described herein, including those conjugated to non-nucleotidic groups, as described in Section 6.3, below.

[0145] 6.5. Delivery Vehicles In some embodiments, a delivery vehicle can be used to deliver the siRNA agents described herein to cells or tissues.

[0146] 6.6 Composition In one aspect, provided herein is a composition comprising a siRNA agent as described herein (e.g., in Section 6.1, below, or in Section 7, below). The composition may further comprise a carrier or excipient.

[0147] 6.7 Use of siRNA Agents The siRNA agent and composition of the present invention can be used to inhibit the expression of MAPT gene, for example, human MAPT gene. As shown in the example, the siRNA agent inhibits the expression of MAPT gene. The siRNA agent and composition of the present invention can also be used to inhibit tau level. As shown in the example, the siRNA agent inhibits tau level. Certain assays and methods for measuring MAPT expression level and measuring tau level are described herein. Other assays for measuring MAPT expression level and measuring tau level are known in the art.

[0148] Inhibition of MAPT gene expression and / or inhibition of tau level are useful for studying diseases such as Alzheimer's disease. Tau level is associated with Alzheimer's disease. The siRNA of the present invention can be used to study how the level of MAPT gene expression inhibition affects tau level. The siRNA of the present invention can be used in animal models to study how the level of MAPT gene expression inhibition affects tau level. The siRNA of the present invention can be used to study how the level of MAPT gene expression and / or tau level affects one or more symptoms of Alzheimer's disease.

[0149] In one aspect, provided herein is a method for inhibiting the expression of a MAPT gene (e.g., human MAPT gene) in a cell, comprising contacting the cell with an siRNA agent described herein, or a composition comprising an siRNA agent described herein. In certain embodiments, provided herein is a method for inhibiting the expression of a MAPT gene (e.g., human MAPT gene) in a cell population, comprising contacting the cell population with an siRNA agent described herein. The contact between the cell and the siRNA agent described herein can be direct or indirect. For example, the cell can be physically contacted with the siRNA agent, or the cell can be placed in a situation that allows or causes the cell to be subsequently contacted with the siRNA agent.

[0150] The expression of the MAPT gene (e.g., human MAPT gene) can be measured directly or indirectly. For example, the level of MAPT RNA (e.g., pre-mRNA level, mRNA level, or both), the level of the protein encoded by the MAPT gene, the function of the protein encoded by the MAPT gene, or a combination thereof can be measured. Alternatively or in addition, the expression of a gene whose expression is indirectly or directly affected by the expression of the MAPT gene, the function of a protein indirectly or directly affected by the expression of the MAPT gene, or a combination thereof can be measured. For example, see Section 6.8 below for methods that can be used to directly or indirectly measure the expression of the MAPT gene.

[0151] 6.8 Biological Assays Biological assays known to those of skill in the art or described herein (e.g., in Section 7 below) can be used to assess the ability of the siRNA agents described herein to inhibit MAPT gene expression, the specificity of the siRNA agents described herein, the stability of the siRNA agents described herein, the off-target effects of the siRNA agents described herein, the toxicity of the siRNA agents described herein, the localization of the siRNA agents to specific tissues, the pharmacokinetics of the siRNA agents, and the immunogenicity of the siRNA agents described herein.

[0152] In some embodiments, MAPT gene expression is measured at the RNA or protein level. The expression level of the MAPT gene can be evaluated by any method known in the art for measuring RNA. In certain embodiments, RNA can be isolated from the sample by RNA extraction methods, such as organic extraction, membrane-based spin column, and paramagnetic particle technology. In certain embodiments, MAPT RNA levels can be measured by UV spectroscopy, in situ hybridization, fluorescent in situ hybridization (FISH), Northern blot, microarray, RT-PCR, qPCR, fluorescent dye-based quantification, and gel electrophoresis. MAPT protein expression levels can be measured by any method known in the art for characterizing proteins. In certain embodiments, MAPT protein can be purified by salt precipitation, dialysis, and chromatography (e.g., gel filtration, ion exchange, affinity purification). In certain embodiments, the crude sample containing MAPT protein or purified MAPT protein can be characterized by UV absorbance and spectroscopy, electrophoresis, capillary electrophoresis, chromatography (e.g., gel filtration, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), ultradiffusion chromatography), mass spectrometry. In certain embodiments, the crude sample containing MAPT protein or purified MAPT protein can be characterized by flow cytometry, immunodiffusion, immunoelectrophoresis, Western blot, immunoblot, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay, etc. In some embodiments, the function of the protein encoded by the MAPT gene can be evaluated to measure the expression of the gene.For example, microtubule polymerization and / or microtubule stabilization by the protein encoded by the MAPT gene can be assessed. Cells contacted in vitro or ex vivo with the siRNA agent can be assessed for expression of the gene.

[0153] In some embodiments, the function of the tau protein encoded by MAPT gene (e.g., microtubule stabilization) is evaluated using assays known to those skilled in the art. Several functions have been proposed for normal tau, the most established being microtubule stabilization.

[0154] In some embodiments, the MAPT gene expression level can be evaluated using indirect measurements including expression of certain genes, functional assays of downstream proteins, and reporter assays. In some embodiments, the expression of the MAPT gene can be evaluated by detecting the expression of a protein regulated by the expression of the MAPT gene. In certain embodiments, the expression of the MAPT gene can be evaluated by detecting the function of a protein regulated by the expression of the MAPT gene. In some embodiments, a reporter gene can be introduced to facilitate indication of target expression. For example, a reporter gene regulated by a protein downstream of the protein encoded by the MAPT gene can indicate the expression level of the MAPT gene. The reporter gene can include a FLAG-tag, green fluorescence protein (GFP), chloramphenicol acetyltransferase gene (cat) from Tn9 of E. coli, luciferase gene (luc) from the firefly Photinus pyralis, and β-glucuronidase (GUC). The reporter gene encodes a readily detectable protein that indicates the MAPT gene expression level. Reporter assays can include fluorescence-based assays, such as fluorescence spectroscopy, fluorescence immunoassay, flow cytometry, fluorescence spectroscopy, and ELISA.

[0155] In some embodiments, the specificity of the siRNA agent can be analyzed by the effect caused by the inhibited gene it targets or by the off-target genes it affects. The effect includes inhibition of MAPT gene expression, and the siRNA agent is capable of inhibiting the half-maximal inhibitory concentration, i.e., IC 50 Candidate siRNA agents are evaluated for efficacy by IC 50 In some embodiments, the siRNA agents described herein are selected using IC values ​​between 10 nM and 200 nM in neurons (e.g., human iPSC-neurons). 50 In certain embodiments, the specificity of the siRNA agent is tested using a negative control, and a scrambled or random sequence may be used. An siRNA agent that does not affect the negative target may be considered specific. In certain embodiments, the specificity of the siRNA agent is tested using a single target gene. Different siRNA agents for the same gene with comparable gene inhibition potency should induce similar changes in gene expression profile or phenotype. Any changes induced by one siRNA agent and not the other may be due to off-target effects or non-specificity. In certain embodiments, the specificity of the siRNA agent is tested using titration. Non-specific effects are mitigated when the siRNA agent is used at a lower concentration. siRNA agents that show a lower effective concentration may have higher specificity. In certain embodiments, the specificity of the siRNA agent is tested by monitoring both RNA and protein levels. For example, a reduction in RNA genes seen without a corresponding reduction in protein levels indicates slow protein turnover. The siRNA agent being investigated may have off-target effects. In some embodiments, a transcriptome assay can be used to evaluate off-target effects.

[0156] In some embodiments, agarose gel electrophoresis-based Förster resonance energy transfer (FRET) methods are used to assess the stability of the described siRNA agents in biological samples or fluids, such as, for example, serum or cerebrospinal fluid samples. For example, see Tuttolomondo and Ditzel, 2021, Methods Mol Biol 2282:43-56 for a description of such an assay. In some embodiments, such assays are also used to assess the interaction of the siRNA agents described herein with serum proteins and enzymes. In certain embodiments, an agarose gel shift assay is used to assess the stability of the siRNA agents described herein in biological samples or fluids, such as, for example, serum or cerebrospinal fluid samples.

[0157] In some embodiments, the stability of the siRNA agent can be investigated under various conditions, including temperature and RNase degradation in biological fluids. In some embodiments, the thermal melting temperature of the siRNA agent can be measured by increasing the temperature (e.g., 1° C. / min) at 100° C. / min. 260 The T m is the melting curve (A 260 The thermal stability is measured as the maximum of the first derivative of the T (vs. T). Stable unmodified RNA has a T in the range of 40°C to 60°C. mThe modified RNA may have a temperature of about 10° C. The stability of the siRNA agent against RNase degradation may be determined by incubating with different biological fluids. For example, serum stability may be determined by incubating with fetal bovine serum or human serum at 37° C. for various times up to 48 hours. The RNA in the sample may be examined by Northern blot, in situ hybridization, qPCR, and any RNA detection method known in the art. The activity of the siRNA agent may be tested. A stable siRNA agent may show little degradation at 37° C. for 24 hours. In some embodiments, the siRNA agent shows sufficient stability for at least 2 hours. In other embodiments, the stability of the siRNA agent exposed to, but not limited to, skin, salvia, topical cream, or nanoparticles may be tested.

[0158] In certain embodiments, the stability of the siRNA agents described herein in human liver lysosomes and rat liver tritosomes is assessed as described in Section 7 below.

[0159] In some embodiments, the toxicity of siRNA agents on in vitro or ex vivo cell-based models is investigated. In certain embodiments, toxicity is evaluated by the extent to which the siRNA agent can cause damage to cells. Damage can be necrosis (uncontrolled cell death), apoptosis (programmed cell death), autophagy, or cessation of active growth and division to reduce cell proliferation. In certain embodiments, cytotoxicity assays are performed to measure the ability of the siRNA agent to cause cell damage or cell death. For example, the release of lactate dehydrogenase (LDH) and glucose 6-phosphate dehydrogenase (G6PD) can be used as biomarkers of cell plasma membrane damage. In another embodiment, cell viability under the treatment of the siRNA agent can be detected by various mechanisms, such as membrane integrity, enzyme activity, or metabolic activity.

[0160] In some embodiments, RNA in situ hybridization assay can be used to image siRNA agent and evaluate the inhibition of MAPT gene expression in tissue samples from subjects.RNAscope® can be used for RNA in situ hybridization assay, for example.

[0161] In some embodiments, the siRNA agent described herein is used to study an animal model of Alzheimer's disease (e.g., a mouse model). Animal models are known in the art. In certain embodiments, the animal model is one described in Section 7 below. EXAMPLES

[0162] 7.1 Example 1: siRNA synthesis Table 1 provides the unmodified sense and antisense strand nucleotide sequences of siRNAs targeting human MAPT, gene ID: 4137. Table 2 provides the chemical modifications, including 2'-fluoro, 2'-O-methyl, and phosphorothioate, that are applied to the siRNA sequences in Table 1.

[0163] [Table 3]

[0164] [Table 4]

[0165] Synthesis of MAPT siRNA duplexes Human MAPT siRNA was synthesized and annealed as follows. Briefly, single-stranded sense and antisense oligonucleotides were synthesized on a 0.2 μmol scale on a Dr.Oligo 192 synthesizer (Biolytic Lab Performance) using standard solid-phase phosphoramidite chemistry. Controlled pore glass (CPG, 500 Å) was used as the solid support loaded with the first base or UnyLinker™. 3% dichloroacetic acid in dichloromethane was used for detritylation. 2'-OMe and 2'-F modified nucleotides were coupled by using the corresponding phosphoramidites. Coupling times for all phosphoramidites were 6-8 min using 5-ethylthio-IH-tetrazole (ETT) (0.25 M in acetonitrile) as the activating agent. Phosphorothioate linkages were generated using a 0.2 M solution of xanthan hydride in anhydrous pyridine. The oxidation time was 3 min using 0.02 M I2 in tetrahydrofuran containing 10% water.

[0166] After synthesis, the solid support was transferred to a 1.5 mL vial. Cleavage and deprotection were performed using 500 μL of AMA (concentrated ammonia / 40% methylamine in water, v / v=1:1). After completion of cleavage and deprotection, the sample was filtered to remove the solid support and washed once with water. The sample was purified using a 6 mL Source 15Q ion exchange column (Cytiva) on an AKTA Purifier System equipped with an autosampler and fraction collector. Fractions were analyzed by LC-MS to confirm quality. Appropriate fractions were pooled and desalted using a CentriPure P10 column (emp Biotech). Samples from each sequence were analyzed by LC-MS to confirm identity, by UV (260 nm) for quantification, and by IP-RP chromatography to determine purity. Duplex annealing was performed by mixing equimolar sense and antisense single strands. The final duplex sample solution was dried under vacuum using a GeneVac evaporator (SP Scientific). Final QC specifications were ±0.05% of calculated mass for single-stranded identity (by LC / MS), >85% full length oligonucleotide for single-stranded purity (by HPLC), and >90% duplex purity by non-denaturing HPLC.

[0167] siRNA-lipid conjugation A subset of siRNA compounds was synthesized at different positions (5' / 3' termini, or internal) using different novel lipid conjugates. Lipids were incorporated into the sense strand via on-column and / or post-column synthesis. To perform on-column synthesis, lipid moieties were modified in the corresponding phosphoramidite monomers or CPGs, followed by solid-phase phosphoramidite chemistry as described above to synthesize the sense strand with 5' / 3' termini and / or internal lipid conjugates. For post-column synthesis, lipids were introduced into the solution phase with their corresponding N-hydroxysuccinimide esters and the added amine linkers of nucleotides.

[0168] On-column synthesis For example, on-column introduction of compound 2 at the 3'-end of the sense strand was carried out using a 3'-amino modifier such as 2-dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-1-succinoyl)-long chain alkylamino-CPG1 (Scheme 1). After deprotection of the Fmoc group with 20% piperidine in DMF, the CPG was washed thoroughly with DMF, MeCN, diethyl ether, and dried. A solution of 80 μmol of compound 2 in 2 ml of 1,4-dioxane was added to the above CPG, followed by 30 μl of DIPEA and shaking for 12 hours to give compound 3. The CPG was washed with DCM, MeCN, and Et2O. A solution of 1 ml of CAP A and CAP B was added and shaken for 30 minutes. Compound 3 was washed with DCM, MeCN, Et2O, dried, and used for oligonucleotide synthesis. 3'-cholesteryl-TEG CPG was used to synthesize oligonucleotides conjugated with cholesterol at the 3' end.

[0169] [ka]

[0170] The introduction of compound 2 at the 5'-end of the sense strand was carried out using a 5'-amino modifier such as 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N'-diisopropyl)-phosphoramidite. After the synthesis of the sense strand with CPG according to standard procedures, in the penultimate step, the 5'-end of the sense strand was coupled to 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite, followed by unblocking of the 4-monomethoxytrityl group with 3% DCA / DCM for 30 min. The CPG was then washed with DCM, ACN and coupled with compound 2 for 12 h (Scheme 2), followed by strand cleavage and deprotection.

[0171] [ka]

[0172] Adamantyl lipids at internal positions were introduced during the sense strand synthesis using the corresponding phosphoramidite monomers. For example, Scheme 3 illustrates this using the uridine-based phosphoramidite monomer 7.

[0173] [ka]

[0174] The lipid-conjugated oligonucleotides synthesized, cleaved, and deprotected were purified by reverse phase or ion exchange chromatography. The buffer for reverse phase was 0.05M sodium acetate in 90 / 10% water / acetonitrile (buffer A) and acetonitrile (buffer B), and the buffer for ion exchange was 20mM sodium phosphate in 90 / 10% water / acetonitrile (buffer A) and 20mM sodium phosphate, 1.8M sodium bromide in 90 / 10% water / acetonitrile (buffer B). The fractions containing full-length oligonucleotides were pooled, desalted, and the compounds were analyzed by LC-MS.

[0175] Post-column synthesis Lipids were conjugated at the 5' / 3' terminal positions and at internal positions of the sense strand in solution phase after purification and desalting of the corresponding oligonucleotides.

[0176] For example, incorporation at internal positions was achieved using phosphoramidite monomers derivatized with an amine linker at the 2' position of each nucleotide. Scheme 4 illustrates this using the uridine-based phosphoramidite monomer compound 9. After incorporation of compound 9 at internal positions and completion of the synthesis, cleavage, and deprotection, purification, and desalting processes, the free oligonucleotide bearing a pendant amine was coupled with the corresponding lipid-NHS ester in solution phase.

[0177] [ka]

[0178] Conjugation at terminal / internal positions was performed using a 0.15 mM solution of the deprotected and desalted oligonucleotide in a 0.1 M solution of NaHCO3 (pH 8.4) with a 1.5 mM solution of the corresponding lipid-NHS ester in DMF at 60 °C. To a solution of oligonucleotide (0.25 mL), a DMF solution of lipid-NHS ester (0.6 mL) was added and the resulting mixture was heated at 63 °C. Progress was monitored by RP-HPLC (C-18 column; A: 50 mM TEAA, B: MeCN; gradient 5-100% B at 30 °C). Reactions were typically >90% complete in less than 1 h. The reaction mixture was diluted with water and purified by RP-HPLC (C-8 Xbridge Waters column; A: 50 mM NaOAc, B: MeCN; gradient 5-100% B, 60 °C). The isolated yield of lipid-conjugated oligonucleotide was 60-70%. After purification, the products were desalted and duplex annealed as described above.

[0179] 7.2 Example 2: In vitro screening of MAPT siRNA Screening of MAPT siRNA agents listed in Table 2 was performed in human neuroblastoma cells using transfection according to the protocol described below. Table 6 shows the residual MAPT mRNA in human neuroblastoma cells after transfection of siRNA at concentrations of 20 nM and 200 pM. A set of 25 siRNA hits was selected for potency evaluation in human neuroblastoma cells by transfection at 4-fold serial dilutions at concentrations of 2 nM, 500 pM, 125 pM, 31.25 pM, 7.81 pM, 1.95 pM, 0.49 pM, 0.12 pM, 0.03 pM, and 0.0076 pM. Table 7 shows the IC of the indicated siRNAs. 50 Values ​​and their 95% confidence intervals are summarized.

[0180] [Table 5]

[0181] Cell culture and transfection: Human neuroblastoma Kelly cells (DSMZ) were cultured in RPMI1640 (Sigma R0883) supplemented with 10% FBS (Biowest S1810-500), 2 mM L-glutamine (Sigma G7513), and 50 μg / mL gentamicin (Gibco 15750) in a 37 °C incubator with 5% CO2. One day before transfection, cells were split using 0.05% trypsin-EDTA (Gibco 25300) and seeded at a density of 30,000 cells per well in 96-well plates. The next day, cells were transfected with siRNA using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific 13778150) according to the manufacturer's protocol. Cells were cultured for 72 h in a 37 °C incubator with 5% CO2 before RNA isolation.

[0182] Total RNA isolation: RNA extraction was performed using the RNeasy 96 kit (Qiagen) according to the manufacturer's protocol. Briefly, 125 μL of RLT buffer was added to each well of a 96-well plate to lyse the cells with orbital shaking at 200 rpm for 1 min, and the cell plate was then transferred to a -80°C freezer for storage until analysis. On the day of RNA extraction, the frozen cell plate was quickly thawed in a 37°C oven, and immediately after thawing, an equal volume of 125 μL of 70% (V / V) ethanol was added to each well to mix with the RLT lysate. The mixture was then transferred to the wells of an RNeasy 96 plate placed on top of a QIAvac 96 vacuum block, and the RNA was bound to the RNeasy 96 plate membrane by applying vacuum until liquid transfer was complete. Successive washing steps, including one with 800 μL of RW1 buffer, two with 800 μL of RPE buffer, were applied to the RNeasy 96 plate using vacuum to remove the liquid. After the final wash, the RNeasy 96 plate was centrifuged at 5600xg for 3 min to remove residual lipids. RNA was eluted using 60 μL of RNase-free water by centrifugation at 5600xg for 3 min at room temperature. RNA concentration was measured by Nanodrop 8000 (ThermoFisher). Eluted RNA was stored at -80°C until analysis.

[0183] Reverse transcription and real-time PCR: RNA was used as template for reverse transcription using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) following the manufacturer's protocol. Briefly, 20 μL of the final reaction mixture was incubated at 25°C for 10 min, followed by reverse transcription at 37°C for 2 h and enzyme inactivation at 85°C for 5 min. For the qPCR reaction, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp™ SYBR™ Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers to bring the reaction to a final volume of 10 μL. qPCR runs were performed using a QuantStudio™ 12K instrument (Applied Biosystems™) using standard thermal cycling protocols. MAPT mRNA was detected using multiple validated primers, and reference primers targeting the housekeeping genes ENOX2 and GAPDH were used for gene expression normalization. Primer sequences are listed in Table 8. qPCR data were analyzed using qBase+ software (Biogazelle). IC 50 Value and IC 50 The 95% CIs for were calculated from log([drug]) versus normalized response curve fits using GraphPad Prism version 7.00 software.

[0184] 7.3 Example 3: In vitro knockdown efficacy evaluation of siRNA conjugates in human iPSC-derived neurons The in vitro knockdown efficiency of the lipid-siRNA conjugates was evaluated in human iPSC-derived cortical neurons according to the procedure described below.

[0185] Tables 18-19 show that the cholesterol-siRNA conjugates listed in Table 9 knock down MAPT mRNA and tau protein in human iPSC neurons after 7 or 14 days of incubation in a dose-dependent manner. Data are presented as remaining MAPT mRNA (vs. control) or remaining tau protein (vs. control). Mean ± SD, n=3. IC 50 (95% CI) values ​​are calculated from log([drug]) versus normalized response curve fits using GraphPad Prism version 7.00 software.

[0186] [Table 6]

[0187] [Table 7]

[0188] [Table 8]

[0189] [Table 9]

[0190] Tables 10 and 11 summarize the efficiency of cholesterol-siRNA conjugates with various chemical modifications (listed in Table 4) in knocking down MAPT mRNA in human iPSC neurons after 7 days of incubation. Data are presented as residual MAPT mRNA relative to control. Mean ± SD, n=3.

[0191] Figures 1A-1B and 2A-2B show that cholesterol-siRNA or lipid-siRNA conjugates with various chemical modifications (listed in Tables 4 and 23) knock down MAPT mRNA and tau protein in human iPSC neurons in a dose-dependent manner after 7 days of incubation. Data are presented as remaining MAPT mRNA (vs. control) or remaining tau protein (vs. control). Mean ± SD, n=3. IC 50 (95% CI) values ​​are calculated from log([drug]) versus normalized response curve fits using GraphPad Prism version 7.00 software.

[0192] Tables 12-14 summarize the efficiency of MAPT siRNA conjugated with different lipids (listed in Table 5) in knocking down MAPT mRNA in human iPSC-neurons after 7 days of incubation. Three concentrations of siRNA conjugates were tested: 1 μM, 200 nM, and 40 nM. Data are presented as residual MAPT mRNA relative to control. Mean ± SD, n=3.

[0193] Differentiation of human iPSCs into cortical neurons A human iPSC line (Sigma no. iPSC0028) was derived by OSKM retroviral reprogramming of epithelial cells from a 24-year-old Caucasian female donor. iPSCs were first differentiated into cortical neural stem cells (NSCs) following a dual SMAD inhibitor protocol with minor modifications (Shi et al., 2012, Nat. Proc. 7(10):1836(46). Briefly, iPSCs were plated at 500,000 cells / cm on Matrigel (Corning 354230)-coated wells in mTeSR medium (StemCell Technologies 5850) supplemented with 10 μM ROCK inhibitor (Sigma-Aldrich Y0503). 2and cultured at 37°C and 5% O. The following day (day -1), the medium was replaced with mTeSR. From day 0 to day 12, cell culture medium was changed to Neural Maintenance Medium (1:1 DMEM:F12 Glutamax (ThermoFisher Scientific 10565108), Neurobasal (ThermoFisher Scientific 21103049) supplemented with 10 μM SB43142 (Tocris 1614) and 1 μM Dorsomorphin (Tocris 3093), 2.5 μg / mL insulin (Sigma-Aldrich I9278-5ML), 50 uM 2-mercaptoethanol (ThermoFisher Scientific, 31350010), 0.5% non-essential amino acids (ThermoFisher Scientific 11140035), 0.5% GlutaMAX supplement (ThermoFisher Scientific, 10565018), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565019), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565020), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565030), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565021), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565030 ... The medium was replaced daily with Cortical Neural Induction Medium (Neural Induction Medium) consisting of 0.5% PBS (Sigma P4333), 1% Penicillin-Streptomycin (Sigma P4333), 0.5% N2 supplement (ThermoFisher Scientific 17502048), 1% B27 supplement (ThermoFisher Scientific 17504044). On day 12, the neuroepithelial sheets were gently dissociated into large aggregates of 300-500 cells using a needle and lifter, and the aggregates were collected in a 15 mL Falcon by centrifugation at 160 g for 2 min. The medium was supplemented with 10 μg / mL Laminin (Sigma-Aldrich The cell pellet was gently resuspended in neural induction medium in a total volume of 2 mL of neural induction medium per well of a 6-well plate for 1 / 2 or 1 / 3 passage into wells coated with 100 μg / mL FGF2 (L2020). Medium was replaced with neural maintenance medium supplemented with 20 ng / mL FGF2 (Stemcell Technologies 2634) on days 13 and 15.On day 17, neural rosettes were detached with dispase (ThermoFisher Scientific 17105041) for passage 1 / 3 and seeded onto laminin-coated wells. One or two additional dispase steps were performed for an additional week. Approximately on day 25-30, neural stem cells were dissociated into single-cell suspensions with Accutase (ThermoFisher Scientific A1110501) and cryopreserved in freshly prepared neural freezing medium containing neural maintenance medium supplemented with 10% (V / V) DMSO and 20 ng / mL FGF2. Frozen vials of neural stem cells were stored in liquid nitrogen until use.

[0194] To generate iPSC-neurons, thaw a frozen vial of neural stem cells (NSCs) and plate them at 70,000 cells / cm on laminin-coated wells in neural maintenance medium supplemented with 10 μM ROCK inhibitor and 20 ng / mL FGF2. 2 The cells were seeded at 1000 x 1000 cells / well in neural maintenance medium supplemented with 10 μM ROCK inhibitor. The medium was replaced daily with neural maintenance medium for the next 2 days. Approximately 4 days after thawing, cells were dissociated with Accutase and plated at 28.000 cells per well in neural maintenance medium supplemented with 10 μM ROCK inhibitor in 96-well plates pre-coated with poly-L-ornithine and laminin. The day after reseeding, the culture medium was replaced with neural differentiation medium consisting of neural maintenance medium supplemented with 20 ng / mL BDNF (R&D Systems 212-BD-050 / CF), 20 ng / mL GDNF (R&D Systems 212-GD-050 / CF), 500 μM DB-cAMP (Sigma D0627), and 20 mM ascorbic acid (Sigma A4403). Cultures were differentiated in neural differentiation medium with 50% medium changes twice a week. After 2-3 weeks of differentiation from neural stem cells (NSCs), neurons were treated with siRNA for 7 or 14 days for RNA analysis by reverse transcription and real-time PCR and protein analysis by MSD immunoassay.

[0195] MSD Immunoassay Human iPSC-neurons differentiated on 96-well plates were lysed in 100 μL of ice-cold RIPA buffer (Sigma) supplemented with cOmplete™ protease inhibitor cocktail (Roche) and PhosSTOP™ (Roche) for 30 min at 4° C. with slow orbital shaking. Plates were centrifuged at 1,000×g for 5 min, and cell lysates were collected and diluted for different (20, 50, or 100) fold for protein measurement using MSD immunoassays according to standardized procedures. Briefly, MSD plates were coated overnight at 4° C. with 30 μL / well of coating antibody diluted in PBS at 1 μg / mL. The next day, plates were inverted on absorbent tissue to dry, and then incubated with 150 μL per well of blocking buffer 0.1% casein with orbital shaking at 300 rpm for 2 h at room temperature. After blocking, the plates were incubated overnight with cell lysates diluted in RIPA buffer supplemented with cOmplete™ protease inhibitor cocktail (Roche) at 4°C with slow orbital shaking. Plates were washed 5 times using Titertek Aquamax 4000 and inverted dry on absorbent tissue. Then, 25 μL per secondary or detection antibody diluted in 0.1% casein was added to the MSD plate and incubated for 2 hours at room temperature. After antibody incubation, plates were washed 5 times and developed with 150 μL / well 2× MSD reading buffer (Meso Scale Discovery) diluted in milliQ H2O. Plates were read immediately using the MSD instrument. For measurement of tau protein, hTau43 antibody (Janssen) was used for 96-well MSD plate coating and SULFO-TAG™ labeled hTau60 antibody (Janssen) was used for detection.For the measurement of histone H3 protein, recombinant rabbit monoclonal antibody 17H2L9 (ThermoFisher) was used for plate coating, mouse mAb 14221BF (Cell Signaling Technology) was used as primary detection, and SULFP-TAG-labeled anti-mouse antibody (Meso Scale Discovery) was used as secondary detection antibody.

[0196] 7.4 Example 4: In vitro stability evaluation of siRNA conjugates in various matrices The in vitro stability of the siRNA conjugates was evaluated in various matrices, including mouse brain homogenates, human liver lysosomes, and rat liver tritosomes, using the methods described below. The results of the analyses are provided in Tables 15-17.

[0197] Tables 15-17 and 24-26 summarize the LC-MS measurements of antisense and sense strand stability of siRNA conjugates (listed in Tables 4, 5, and 23) in mouse brain homogenates (Tables 15 and 24), human liver lysosomes (Tables 16 and 25), and rat liver tritosomes (Tables 17 and 26) at 37° C. after 24 hours of incubation with shaking at 450 rpm. To assess the stringency of the assay conditions, the reference compound MSC-2-V was added to the assay.

[0198] [Table 10-1]

[0199] [Table 10-2]

[0200] [Table 10-3]

[0201] [Table 10-4]

[0202] [Table 10-5]

[0203] [Table 11-1]

[0204] [Table 11-2]

[0205] [Table 11-3]

[0206] [Table 11-4]

[0207] [Table 11-5]

[0208] [Table 11-6]

[0209] Stability of siRNA conjugates in mouse brain homogenates Frozen brain tissue collected from C57BL / 6J wild type mice was homogenized at a tissue concentration of 200 mg / mL in ice-cold homogenization buffer containing 100 mM Tris-HCl, pH 6.0 buffer supplemented with 1 mM MgCl2. Tissue homogenization was performed by adding 1 mL of ice-cold homogenization buffer to a 2 mL tube (MP Biomedicals™) containing Lysis Matrix D and one mouse brain hemisphere, followed by processing the tube in the FastPrep®-24 Instrument at a speed of 5 m / s for 30 seconds. The sample was placed on ice for 2 minutes and two rounds of processing with the FastPrep®-24 Instrument were repeated. 100 μL of homogenate is added to each well of a 96-well PCR plate, 5 μL of 20 μM siRNA conjugate (final concentration of 1 μM in the reaction) is added to each well, and an equal number of blank wells containing brain homogenate are left without the addition of siRNA conjugate. The PCR plate containing the samples is placed in a Thermomixer and incubated at 37 °C for 24 hours with shaking at 450 rpm. After the reaction, the PCR plate is placed on ice until the samples have cooled, and 5 μL of 20 uM siRNA conjugate is added to the blank wells containing brain homogenate (0-hour samples). The samples are diluted with 300 μL of 10 mM EDTA (4-fold dilution) containing 1 μg / mL of the internal standard oligo, and the diluted samples are transferred to a deep-well 96-well plate. After well mixing, 50 μL of the samples are transferred to another deep-well 96-well plate before starting the solid-phase extraction procedure.

[0210] Stability of siRNA conjugates in human liver lysosomes and rat liver tritosomes Human liver lysosomes (Xenotech H0610.L) or rat liver tritosomes were thawed and diluted to 0.05 units / mL or 0.5 units / mL acid phosphatase levels, respectively, in 20 mM sodium citrate pH 5.0 buffer. Dispense 50 μL of diluted human liver lysosomes or rat liver tritosomes into each well of a 96-format PCR plate, followed by the addition of 5 μL of 10 μM siRNA conjugate (final concentration of 1 μM in the reaction) to each well. Leave an equal number of blank wells containing lysosomes or tritosomes without adding siRNA conjugate. Place the PCR plate containing the samples in a Thermomixer and incubate at 37°C for 24 hours with shaking at 450 rpm. After the reaction, place the PCR plate on ice until the samples have cooled, and add 5 μL of 10 uM siRNA conjugate to the blank wells containing lysosomes or tritosomes (0-hour samples). Dilute the samples with 300 µL of 10 mM EDTA (4-fold dilution) containing 1 µg / mL of the internal standard oligo and transfer the diluted samples to a deep-well 96-well plate. After well mixing, transfer 50 µL of the samples to another deep-well 96-well plate before starting the solid-phase extraction procedure.

[0211] Sample preparation prior to solid phase extraction After the stability assay, 50 μL of sample was digested by adding 10 μL of proteinase K solution (A4392,0010; PanReac Applichem) and 100 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA) pH 8.0 (VWR; E112-500ml) and incubated at 60° C. with vortexing at 1100 rpm for 30 min. After incubation, it was diluted by adding 100 μL of lysis buffer (Phenomenex, catalog AL0-8579) and 200 μL of equilibration buffer (3.45 g Na2HPO4 in 500 mL water, adjusted to pH 5.5 with 1 N NaOH).

[0212] solid phase extraction Solid phase extraction was then performed using Clarity OTX solid phase extraction plates (Phenomenex, Cat. 8E-S103-EGA). The plates were conditioned with 1 mL of methanol followed by 1 mL of equilibration buffer (3.45 g Na2HPO4 in 500 mL of water, adjusted to pH 5.5 with 1 N NaOH) and then the sample was loaded onto the column. The column was then washed three times with 1 mL of wash buffer (equilibration buffer pH 5.5, 50% v / v acetonitrile), then once with 0.5 mL of water, then once in 100 mM ammonium bicarbonate pH 10 supplemented with 0.56 g / L TCE (tris(2-carboxyethyl)phosphine). Samples were eluted three times each with 0.5 mL of elution buffer (TCEP (tris(2-carboxyethyl)phosphine), 200 mM ammonium bicarbonate pH 10 supplemented with 50% v / v acetonitrile) and dried using a nitrogen stream (TurboVap, 65 psi N2 at 70 °C).

[0213] Analysis method After SPE, samples were reconstituted in lysis buffer (300 μL of 100 mM ammonium bicarbonate adjusted to pH 10, 10% v / v acetonitrile) and analyzed using liquid chromatography coupled with mass spectrometric detection AB Sciex TripleTOF 6600. Samples were injected (20 μL) and separated using a DNAPac™ RP column 50 mm×2.1 mm, 4 μm maintained at 75° C. Mobile phase A was 0.2% dimethylbutylamine, 0.5% hexafluoroisopropanol, and 0.5% methanol, and mobile phase B was acetonitrile / iso-propanol (95 / 5; v / v). Solvent gradient: time = 0 min, 98% A + 2% B; time = 1.5 min, 98% A + 2% B; time = 4.5 min, 5% A + 95% B; time = 7.5% A + 95% B; time = 7.01 min, 98% A + 2% B; time = 10 min, 98% A + 2% B. The ESI source was operated in negative ion mode with full scan using spray voltage = 4500 V, source temperature = 350 °C. Flow rate = 0.25 mL / min. Analyst TF 1.8.1 software was used for data acquisition and Sciex OS 1.7.0 software was used for data processing.

[0214] 7.5 Example 5: Evaluation of in vivo knockdown efficiency of siRNA conjugates in a mouse model The in vivo knockdown efficiency of lipid-siRNA conjugates was evaluated in a mouse model by intracerebroventricular (ICV) injection according to the procedure described below.

[0215] MAPT mRNA is evaluated in seven brain regions (cortex, hippocampus, brainstem, cerebellum, striatum, midbrain, and cervical spinal cord) from hTAU KI mice 7 days after a single ICV injection of M28_Var1, M28_Var39, M28_Var40, M28_Var41, M28_Var42, M28_Var50 at 15 nmol. Compounds are listed in Table 21 and the results are shown in Table 22. Data are presented as % remaining MAPT mRNA. Mean ± SD, n=6 mice per treatment group.

[0216] Mice and intraventricular injection Randomly assign 2-3 month old male and female PS19 mice (C57BL6; Prnp-MAPT*P301S) or hTau KI (C57BL6; hMAPT: knock-in) mice to different treatment groups. Mice are anesthetized with isoflurane (induction: 4-5%; maintenance: 1.8-2.5%). They are then stereotactically injected into both ventricles at the coordinates: AP: -0.62 mm, ML: + / - 1.05 mm, and DV: 2.2 mm using an electric drill and a microinjection robot (Neurostar, Germany, Sterodrive Sofeware v 2019). Each injection is performed in a 5 μL volume over a period of 5 min, and after injection, the needle is withdrawn in three steps (1. 1 mm in 60 s, hold there for 5 min; 2. 0.5 mm more in 30 s, wait for 5 min; 3. withdraw from the brain at a very slow speed) to avoid backflow of the compound along the needle tract. After each step, the amount of backflow is checked. On the selected day after injection, the animals are sacrificed and the different brain regions, including the cortex, hippocampus, brainstem, cerebellum, striatum, midbrain, and cervical spinal cord, are dissected, flash frozen, and stored at −80° C. until further analysis.

[0217] RNA extraction from tissues The tissue is collected in 2 mL tubes of Lysing Matrix D (MP Biomedicals 6913-500) containing 1.4 mm ceramic spheres and stored in a -80°C freezer until analysis. Place the tissue on ice under laminar flow and immediately add 750 μL of Trizol (ThermoFisher 15596026 / 15596018) per tube. Disrupt and homogenize the tissue using a FastPrep-24™ 5G Grinder at a speed of 5 m / s for 3 cycles of 30 seconds. Chill the samples on ice for 2 minutes between cycles. After homogenization, spin the tubes briefly and add 20% volume of chloroform (150 μL of chloroform if 750 μL of Trizol was used). Vortex for 15 seconds and centrifuge at 14.000xg for 15 minutes at 4°C. The upper aqueous phase is transferred to a deep 96-well plate, one volume of 70% ethanol is added and mixed well. The next steps are performed using the RNeasy 96 kit (Qiagen) according to the manufacturer's protocol. The RNeasy 96 plate is placed on a Square-Well Block holder, the samples (Trizol / chloroform extraction) are applied to the wells of the RNeasy 96 plate and the plate is sealed with an AirPore cover to prevent contamination. Centrifuge at 5600xg for 3 min at room temperature and discard the solution. Successive washing steps including one 800 μL RW1 buffer, two 800 μL RPE buffer are applied to the RNeasy 96 plate and the washing buffer is removed by centrifugation at 5600xg for 3 min for each step. After the last wash, the RNeasy 96 plate is centrifuged at 5600xg for 3 min to remove residual lipids. The RNA is eluted using 60 μL RNase-free water by centrifugation at 5600xg for 3 min at room temperature. RNA concentration is measured by Nanodrop 8000 (ThermoFisher). Eluted RNA is stored at -80°C until analysis.

[0218] RT-qPCR RNA is used as template for reverse transcription using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) following the manufacturer's protocol. Briefly, 20 μL of the final reaction mixture was incubated at 25° C. for 10 min, followed by reverse transcription at 37° C. for 2 h and enzyme inactivation at 85° C. for 5 min. For the qPCR reaction, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp™ SYBR™ Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers to bring the reaction to a final volume of 10 μL. qPCR runs are performed using a QuantStudio™ 12K instrument (Applied Biosystems™) using standard thermal cycling protocols. Multiple primers are used to detect MAPT mRNA, and reference primers targeting mouse housekeeping genes AP3D1 and PAK1IP1 are included for gene expression normalization. Primer sequences are listed in Table 8. qPCR data are analyzed using qBase+ software (Biogazelle).

[0219] [Table 12]

[0220] [Table 13]

[0221] [Table 14]

[0222] [Table 15]

[0223] [Table 16]

[0224]

Table 17

[0225]

Table 18

[0226]

Table 19

[0227]

Table 20

[0228]

Table 21

[0229]

Table 22

[0230]

Table 23

[0231]

Table 24

[0232]

Table 25

[0233]

Table 26

[0234] [Table 27]

[0235] 7.6 Example 6: In vivo duration of effect of siRNA conjugates in human tau mouse model The in vivo duration of lipid-siRNA conjugates was evaluated in a human tau mouse model by intracerebroventricular (ICV) injection according to the procedure described below.

[0236] Figures 4A-4D and Tables 27-30 summarize the levels of human MAPT mRNA and tau protein in the cortex and hippocampus from hTAU KI mice 7, 28, 56, 84, 112, and 147 days after a single ICV injection of M637 (i.e., M177_Var1, as described in Table 5) at 30 nmol, 5 nmol, and 1 nmol. Data in Tables 27-30 are presented as remaining MAPT mRNA (% vehicle control) or remaining tau protein (% vehicle control). Mean ± SD, n=5 mice per treatment group. A sustained effect of M637 on target knockdown is observed from 7 to 147 days in hTAU KI mice.

[0237] Figures 5A and 5B and Tables 31 and 32 summarize the levels of human MAPT mRNA in the cortex and hippocampus from hTAU KI mice 28, 84 days after a single ICV injection of M635, M639, and M641 (M165_Var5, M177_Var3, and M177_Var5, respectively, listed in Table 5) at 30 nmol. Data in Tables 31 and 32 are presented as remaining MAPT mRNA (% of vehicle control). Mean ± SD, n = 4-5 mice per treatment group. Sustained effects of M635, M639, M641 on target knockdown are observed at 28-84 days in hTAU KI mice.

[0238] Mice and intraventricular injection Male and female hTau KI (C57BL6; hMAPT: knock-in) mice, 2-3 months old, were randomly assigned to the different treatment groups. Mice were anesthetized with isoflurane (induction: 4-5%; maintenance: 1.8-2.5%). They were then stereotactically injected into both ventricles at the coordinates: AP: -0.62 mm, ML: + / - 1.05 mm, and DV: 2.2 mm, using an electric drill and a microinjection robot (Neurostar, Germany, Sterodrive Sofeware v 2019). Each injection was performed with a volume of 5 μL over a period of 5 min, and after injection, the needle was withdrawn in three steps (i.e., (1) 60 s, 1 mm, hold there for 5 min; (2) 30 s, another 0.5 mm, wait for 5 min; (3) withdrawal from the brain at a very slow speed) to avoid reflux of the compound along the needle tract. After each step, the amount of reflux was checked. On selected days after injection, animals were sacrificed and different brain regions, including cortex, hippocampus, brainstem, cerebellum, striatum, midbrain, and cervical spinal cord, were dissected, snap frozen, and stored at -80°C until further analysis.

[0239] RNA extraction from tissues Tissues were collected in 2 mL tubes of Lysing Matrix D (MP Biomedicals 6913-500) containing 1.4 mm ceramic spheres and stored in a -80°C freezer until analysis. Tissues were placed on ice under laminar flow and 750 μL of Trizol (ThermoFisher 15596026 / 15596018) was added immediately to each tube. Tissues were disrupted and homogenized using a FastPrep-24™ 5G Grinder at a speed of 5 m / s for 3 cycles of 30 seconds. Samples were cooled on ice for 2 minutes between cycles. After homogenization, tubes were spun briefly and a 20% volume of chloroform was added (150 μL of chloroform if 750 μL of Trizol was used). Tubes were vortexed for 15 seconds and centrifuged at 14.000xg for 15 minutes at 4°C. The upper aqueous phase was transferred to a deep 96-well plate and one volume of 70% ethanol was added and mixed well.

[0240] The next steps were performed using the RNeasy 96 kit (Qiagen) according to the manufacturer's protocol. The RNeasy 96 plate was placed on a Square-Well Block holder, the samples (Trizol / chloroform extraction) were applied to the wells of the RNeasy 96 plate, and the plate was sealed with an AirPore cover to prevent contamination. The samples were centrifuged at 5600xg for 3 min at room temperature, and the solution was discarded. The samples were washed successively with steps including one 800 μL RW1 buffer, two 800 μL RPE buffer applied to the RNeasy 96 plate, and the wash buffer was removed by centrifugation at 5600xg for 3 min for each step. After the last wash, the RNeasy 96 plate was centrifuged at 5600xg for 3 min to remove residual lipids. The RNA was eluted using 60 μL RNase-free water by centrifugation at 5600xg for 3 min at room temperature. The RNA concentration was measured by Nanodrop 8000 (ThermoFisher). The eluted RNA was stored at -80°C until analysis.

[0241] RT-qPCR RNA was used as a template for reverse transcription using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) according to the manufacturer's protocol. Briefly, 20 μL of the final reaction mixture was incubated at 25° C. for 10 min, followed by reverse transcription at 37° C. for 2 h and enzyme inactivation at 85° C. for 5 min. For the qPCR reaction, the reverse transcribed cDNA was diluted 10-fold and mixed with 2X PowerUp™ SYBR™ Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers to bring the reaction to a final volume of 10 μL. qPCR runs were performed using a QuantStudio™ 12K instrument (Applied Biosystems™) using standard thermal cycling protocols. Multiple primers were used to detect MAPT mRNA, and reference primers targeting mouse housekeeping genes AP3D1 and PAK1IP1 were included for gene expression normalization. Primer sequences are listed in Table 8. qPCR data was analyzed using qBase+ software (Biogazelle).

[0242] Protein extraction from tissues and MSD immunoassays Tissues were collected in Lysing Matrix D (MP Biomedicals 6913-500) 2 mL tubes containing 1.4 mm ceramic spheres and stored in a -80 °C freezer until analysis. Samples were transferred to ice and kept on ice, and 6-20 volumes (μl) / weight (mg) of ice-cold RIPA buffer (Sigma) supplemented with cOmplete™ protease inhibitor cocktail (Roche) and PhosSTOP™ (Roche) were added to the cortical and hippocampal tissues, and samples were allowed to thaw on ice for 15 min. Samples were homogenized at 6.0 m / s for 20 s (1 cycle) in a FastPrep-24 instrument (MP Biomedicals). All homogenates were centrifuged at 18000 g for 40 min at 4 °C in an Eppendorf centrifuge.

[0243] Tissue lysates were collected and diluted 2500-fold for protein measurement using MSD immunoassays following standardized procedures. Briefly, MSD plates were coated overnight at 4°C with 30 μL / well of coating antibody diluted in PBS at 1 μg / mL. The next day, plates were inverted on absorbent tissue to dry and then incubated with 150 μL per well of blocking buffer 0.1% casein at 300 rpm for 2 hours at room temperature with orbital shaking. After blocking, plates were incubated overnight at 4°C with cell lysates diluted in RIPA buffer supplemented with cOmplete™ protease inhibitor cocktail (Roche) with slow orbital shaking. Plates were washed 5 times using Titertek Aquamax 4000 and inverted on absorbent tissue to dry. Then, 25 μL per secondary or detection antibody diluted in 0.1% casein was added to the MSD plate and incubated at room temperature for 2 hours. After antibody incubation, plates were washed 5 times and developed with 150 μL / well of 2× MSD reading buffer (Meso Scale Discovery) diluted in milliQ H2O. Plates were read immediately using the MSD instrument. For measurement of tau protein, hTau43 antibody (Janssen) was used for 96-well MSD plate coating and SULFO-TAG™ labeled hTau60 antibody (Janssen) was used for detection.

[0244] 7.7 Example 7: In vitro knockdown efficiency evaluation of siRNA conjugates in human iPSC-derived neurons The in vitro knockdown efficiency of MAPT lipid-siRNA conjugates was evaluated in human iPSC-derived cortical neurons according to the procedure described below.

[0245] Figure 6 and Table 34 summarize the efficiency of MAPT lipid-siRNA conjugates in knocking down MAPT mRNA in human iPSC-neurons after 7 days of incubation. MAPT lipid-siRNA conjugates M757-MM788 are listed in Table 33, and M635 (also known as M165_Var5) and M637 (also known as M177_Var1) are listed in Table 5. Data are presented in Table 34 as residual MAPT mRNA relative to control. Mean ± SD, n=3.

[0246] Differentiation of human iPSCs into cortical neurons A human iPSC line (Sigma no. iPSC0028) was derived by OSKM retroviral reprogramming of epithelial cells from a 24-year-old Caucasian female donor. iPSCs were first differentiated into cortical neural stem cells (NSCs) following the dual SMAD inhibitor protocol with minor modifications (Shi et al., 2012, Nat. Proc. 7(10):1836-46). Briefly, iPSCs were plated at 500,000 cells / cm on Matrigel (Corning 354230)-coated wells in mTeSR medium (StemCell Technologies 5850) supplemented with 10 μM ROCK inhibitor (Sigma-Aldrich Y0503). 2 and cultured at 37°C and 5% O. The following day (day -1), the medium was replaced with mTeSR.

[0247] From day 0 to day 12, cell media was changed to Neural Maintenance Medium (1:1 DMEM:F12 Glutamax (ThermoFisher Scientific 10565108), Neurobasal (ThermoFisher Scientific 21103049) supplemented with 10 μM SB43142 (Tocris 1614) and 1 μM Dorsomorphin (Tocris 3093), 2.5 μg / mL insulin (Sigma-Aldrich I9278-5ML), 50 uM 2-mercaptoethanol (ThermoFisher Scientific, 31350010), 0.5% non-essential amino acids (ThermoFisher Scientific 11140035), 0.5% GlutaMAX supplement (ThermoFisher Scientific, 10565018), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565019), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565020), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565030), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565040), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 10565021), 0.5 mM sodium pyruvate (ThermoFisher Scientific, 1056503 ... The cells were cultured in a 100% culture medium (Sigma P4333), which was replaced daily with cortical neural induction medium (Neural Induction Medium) composed of 0.5% 0.1% sucrose (Sigma P4333), 0.5% N2 supplement (ThermoFisher Scientific 17502048), 1% B27 supplement (ThermoFisher Scientific 17504044). On day 12, the neuroepithelial sheets were gently separated into large aggregates of 300-500 cells using a needle and lifter, and the aggregates were collected in a 15 mL Falcon by centrifugation at 160 g for 2 min. The cell pellet was gently resuspended in neural induction medium in a total volume of 2 mL neural induction medium per well of a 6-well plate for 1 / 2 or 1 / 3 passage into wells coated with 10 μg / mL laminin (Sigma-Aldrich L2020).

[0248] Media was changed to neural maintenance media supplemented with 20 ng / mL FGF2 (Stemcell Technologies 2634) on days 13 and 15. On day 17, neural rosettes were detached using dispase (ThermoFisher Scientific 17105041) for passage 1 / 3 and plated onto laminin-coated wells. One or two additional dispase steps were performed for an additional week.

[0249] At approximately days 25-30, neural stem cells were dissociated into single cell suspensions with Accutase (ThermoFisher Scientific A1110501) and cryopreserved in freshly prepared neural freezing medium containing neural maintenance medium supplemented with 10% (V / V) DMSO and 20 ng / mL FGF2. Frozen vials of neural stem cells were stored in liquid nitrogen until use.

[0250] To generate iPSC-neurons, thaw a frozen vial of neural stem cells (NSCs) and plate them at 70,000 cells / cm on laminin-coated wells in neural maintenance medium supplemented with 10 μM ROCK inhibitor and 20 ng / mL FGF2. 2 The cells were seeded at 1000 x 1000 cells / well in neural maintenance medium supplemented with 10 μM ROCK inhibitor. The medium was replaced daily with neural maintenance medium for the next 2 days. Approximately 4 days after thawing, cells were dissociated with Accutase and plated at 28.000 cells per well in neural maintenance medium supplemented with 10 μM ROCK inhibitor in 96-well plates pre-coated with poly-L-ornithine and laminin. The day after reseeding, the culture medium was replaced with neural differentiation medium consisting of neural maintenance medium supplemented with 20 ng / mL BDNF (R&D Systems 212-BD-050 / CF), 20 ng / mL GDNF (R&D Systems 212-GD-050 / CF), 500 μM DB-cAMP (Sigma D0627), and 20 mM ascorbic acid (Sigma A4403). Cultures were differentiated in neural differentiation medium with 50% medium changes twice a week. After 2–3 weeks of differentiation from neural stem cells (NSCs), neurons were treated with siRNA for 7 or 14 days for RNA analysis by reverse transcription and real-time PCR.

[0251] [Table 28]

[0252] [Table 29]

[0253] [Table 30]

[0254] [Table 31]

[0255] [Table 32]

[0256] [Table 33]

[0257] [Table 34]

[0258] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the present invention in addition to the embodiments described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to be within the scope of the appended claims.

[0259] All references cited in this specification are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Claims

1. siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, (c) the sense strand comprises 21 nucleotides having the sequence: UGCAAAUAGUCUACAAACCAA, from the 5' end: (i) nucleotides at one or more positions selected from 1 to 6, 8, and 12 to 21 are optionally modified with 2'-O-methyl; (ii) the nucleotide at position 6 or 7 optionally comprises a lipophilic moiety; (iii) one or more nucleotides selected from 7 and 9 to 11 are optionally modified with 2'-deoxy-2'fluoro; the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5' end linked to the nucleotide at position 1, and / or an inverted abasic nucleotide (InvAb) at the 3' end linked to the nucleotide at position 21; the sense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; and (d) the antisense strand comprises 21 nucleotides having the sequence: UUGGNNNGUAGACUAUUUGCA, from the 5' end: (i) the nucleotide N at position 5 is U or T, the nucleotide N at position 6 is U or T, and the nucleotide N at position 7 is U or T; (ii) the nucleotide at position 1 is optionally modified with vinylphosphonate 2'-O-methyl or cis-cyclobutylphosphonate 2'-O-methyl; (iii) nucleotides at one or more positions selected from 2, 6, 8, 9, 14, and 16 are optionally modified with 2'-deoxy-2'fluoro; (iv) nucleotides at one or more positions selected from 1, 3-13, 15, and 17-21 are optionally modified with 2'-O-methyl; (v) optionally, a nucleotide at one or more positions selected from 4 to 7 is a deoxynucleotide; (vi) optionally, the nucleotide at position 7 is a 3'-O-methyl modified nucleotide having a 2'-5' linked phosphate, an (L)-α-threofuranosyl modified nucleotide, or a glycol nucleic acid (GNA), or a non-locked nucleic acid (UNA); the antisense strand optionally further comprises two nucleotides CA linked to the nucleotide at position 21 such that it comprises 23 nucleotides having the sequence UUGGNNNGUAGACUAUUUGCACA, the nucleotide C at position 22 and / or the nucleotide A at position 23 being optionally modified with 2'-O-methyl; the antisense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; An siRNA wherein the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

2. The siRNA of claim 1, wherein in the sense strand, nucleotides at two or more positions selected from 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

3. The siRNA according to claim 1 or 2, wherein in the sense strand, nucleotides at three or more positions selected from 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

4. The siRNA according to any one of claims 1 to 3, wherein in the sense strand, 5 or more nucleotides selected from positions 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

5. The siRNA of any one of claims 1 to 4, wherein in the sense strand, each of nucleotides 1 to 5, 8, and 12 to 20 is modified with 2'-O-methyl.

6. The siRNA according to any one of claims 1 to 5, wherein in the sense strand, nucleotides at two or more positions selected from 7 and 9 to 11 are modified with 2'-deoxy-2'fluoro.

7. The siRNA of any one of claims 1 to 6, wherein in the sense strand, each of nucleotides 9 to 11 is modified with 2'-deoxy-2'fluoro.

8. The siRNA of any one of claims 1 to 7, wherein in the sense strand, the nucleotide at position 6 is modified with 2'-O-methyl and the nucleotide at position 7 comprises a lipophilic moiety.

9. The siRNA of claim 8 , wherein the lipophilic moiety is L4.

10. The siRNA of any one of claims 1 to 7, wherein in the sense strand, the nucleotide at position 6 contains a lipophilic moiety and the nucleotide at position 7 is modified with 2'-deoxy-2'fluoro.

11. The siRNA of claim 10, wherein the lipophilic moiety is L21.

12. The siRNA of any one of claims 1 to 11, wherein the sense strand further comprises an InvAb at the 5' end linked to the 1 nucleotide.

13. The siRNA of any one of claims 1 to 12, wherein the sense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

14. The siRNA according to any one of claims 1 to 13, wherein in the antisense strand, nucleotides at two or more positions selected from 1, 3 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

15. The siRNA according to any one of claims 1 to 14, wherein in the antisense strand, nucleotides at three or more positions selected from 1, 3 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

16. The siRNA according to any one of claims 1 to 15, wherein in the antisense strand, 5 or more nucleotides selected from positions 1, 3 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

17. The siRNA of any one of claims 1 to 16, wherein in the antisense strand, each of nucleotides at positions 1, 3, 10-13, 15, and 17-21 is modified with 2'-O-methyl.

18. The siRNA according to any one of claims 1 to 17, wherein in the antisense strand, nucleotides at two or more positions selected from 2, 6, 8, 9, 14, and 16 are modified with 2'-deoxy-2'fluoro.

19. The siRNA of any one of claims 1 to 18, wherein in the antisense strand, each of nucleotides at positions 2, 14, and 16 is modified with 2'-deoxy-2'fluoro.

20. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotides at positions 4 and 5 are each modified with 2'-O-methyl.

21. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotide at position 4 is modified with 2'-O-methyl and the nucleotide at position 5 is a deoxynucleotide.

22. The siRNA according to any one of claims 1 to 19, wherein in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with 2'-O-methyl.

23. The siRNA of any one of claims 1 to 20, wherein in the antisense strand, the nucleotides at positions 4, 5, and 7 are each modified with 2'-O-methyl, and the nucleotide at position 6 is modified with 2'-deoxy-2'fluoro.

24. The siRNA of any one of claims 1 to 23, wherein in the antisense strand, the nucleotides at positions 8 and 9 are either both modified with 2'-O-methyl or both modified with 2'-deoxy-2'fluoro.

25. The siRNA of any one of claims 1 to 24, wherein the antisense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

26. The siRNA of claim 1, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 335, 339, 341, 507, 509, 511, 513, 515, 521, 527, 531, 533, or 567.

27. The siRNA of claim 1 or 26, wherein the antisense strand comprises a nucleotide having the sequence of SEQ ID NO: 336, 340, 342, 508, 510, 512, 514, 516, 522, 528, 532, 534, or 568.

28. siRNA comprising a sense strand and an antisense strand forming a double-stranded duplex, (b) the sense strand comprises 21 nucleotides having the sequence: CAAGUCCAAGAUCGGCUCCAA, from the 5' end: (iv) nucleotides at one or more positions selected from 1 to 6, 8, and 12 to 21 are optionally modified with 2'-O-methyl; (v) nucleotides at one or more positions selected from 9 to 11 are optionally modified with 2'-deoxy-2'fluoro; (vi) the nucleotide at position 7 optionally comprises a lipophilic moiety; the sense strand optionally further comprises an inverted abasic nucleotide (InvAb) at the 5' end linked to the nucleotide at position 1, and / or an inverted abasic nucleotide (InvAb) at the 3' end linked to the nucleotide at position 21; the sense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; and (c) the antisense strand comprises 21 nucleotides having the sequence: UUGGAGCCGAUCUUGGACUUG, from the 5' end: (vi) the nucleotide at position 1 is optionally modified with vinylphosphonate 2'-O-methyl or cis-cyclobutylphosphonate 2'-O-methyl; (vii) nucleotides at one or more positions selected from 2, 14, and 16 are optionally modified with 2'-deoxy-2'fluoro; (viii) nucleotides at one or more positions selected from 1, 3-6, 8-13, 15, and 17-21 are optionally modified with 2'-O-methyl; (ix) optionally, a nucleotide at one or more positions selected from 4, 5, and 7 is a deoxynucleotide; (x) optionally, the nucleotide at position 7 is a 3'-O-methyl modified nucleotide having a 2'-5' linked phosphate, an (L)-α-threofuranosyl modified (3'-2') nucleotide, or a glycol nucleic acid (GNA), or a non-locked nucleic acid (UNA); the antisense strand optionally comprises at least two phosphorothioate linkages at the 5' end and / or at least two phosphorothioate linkages at the 3' end; An siRNA wherein the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

29. The siRNA of claim 28, wherein in the sense strand, nucleotides at two or more positions selected from 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

30. The siRNA according to claim 28 or 29, wherein in the sense strand, nucleotides at three or more positions selected from 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

31. The siRNA according to any one of claims 28 to 30, wherein in the sense strand, 5 or more nucleotides selected from positions 1 to 6, 8, and 12 to 21 are modified with 2'-O-methyl.

32. The siRNA of any one of claims 28 to 31, wherein in the sense strand, each of nucleotides 1 to 6, 8, and 12 to 21 is modified with 2'-O-methyl.

33. The siRNA according to any one of claims 28 to 32, wherein in the sense strand, nucleotides at two or more positions selected from 9 to 11 are modified with 2'-deoxy-2'fluoro.

34. The siRNA of any one of claims 28 to 33, wherein in the sense strand, each of nucleotides 9 to 11 is modified with 2'-deoxy-2'fluoro.

35. The siRNA of any one of claims 28 to 34, wherein in the sense strand, the nucleotide at position 7 comprises a lipophilic moiety L22.

36. The siRNA of any one of claims 28 to 35, wherein the sense strand further comprises an InvAb at both the 5' end linked to the nucleotide at position 1 and the 3' end linked to the nucleotide at position 21.

37. The siRNA of any one of claims 28 to 36, wherein the sense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

38. The siRNA according to any one of claims 28 to 37, wherein in the antisense strand, nucleotides at two or more positions selected from 1, 3 to 6, 8 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

39. The siRNA according to any one of claims 28 to 38, wherein in the antisense strand, nucleotides at three or more positions selected from 1, 3 to 6, 8 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

40. The siRNA according to any one of claims 28 to 39, wherein in the antisense strand, 5 or more nucleotides selected from positions 1, 3 to 6, 8 to 13, 15, and 17 to 21 are modified with 2'-O-methyl.

41. The siRNA of any one of claims 28 to 40, wherein in the antisense strand, each of nucleotides at positions 1, 3, 6, 8-13, 15, and 17-21 is modified with 2'-O-methyl.

42. The siRNA of any one of claims 28 to 41, wherein in the antisense strand, nucleotides at two or more positions selected from 2, 14, and 16 are modified with 2'-deoxy-2'fluoro.

43. The siRNA of any one of claims 28 to 42, wherein in the antisense strand, each of nucleotides at positions 2, 14, and 16 is modified with 2'-deoxy-2'fluoro.

44. The siRNA according to any one of claims 28 to 43, wherein in the antisense strand, the nucleotides at positions 4 and 5 are each modified with 2'-O-methyl.

45. The siRNA according to any one of claims 28 to 43, wherein in the antisense strand, the nucleotide at position 4 is modified with 2'-O-methyl and the nucleotide at position 5 is a deoxynucleotide.

46. The siRNA according to any one of claims 28 to 43, wherein in the antisense strand, the nucleotide at position 4 is a deoxynucleotide and the nucleotide at position 5 is modified with 2'-O-methyl.

47. The siRNA of any one of claims 28 to 46, wherein the antisense strand comprises two phosphorothioate linkages at both the 5' end and the 3' end.

48. The siRNA of claim 28, wherein the sense strand comprises a nucleotide having the sequence of SEQ ID NO: 333, 541, 547, 557, or 569.

49. The siRNA of claim 28 or 48, wherein the antisense strand comprises a nucleotide having the sequence of SEQ ID NO: 334, 542, 548, 558, or 570.

50. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:333 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

334.

51. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:335, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

336.

52. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:339, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

340.

53. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:341, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

342.

54. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:507 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

508.

55. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:509 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

510.

56. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:511 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

512.

57. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:513 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

514.

58. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:515 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

516.

59. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:521 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

522.

60. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:527 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

528.

61. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:531 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

532.

62. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:533 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

534.

63. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:541, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

542.

64. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:547 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

548.

65. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:557 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

558.

66. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:567 and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

568.

67. An siRNA comprising a sense strand and an antisense strand that form a double-stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO:569, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO:

570.

68. A composition comprising an siRNA agent according to any one of claims 1 to 67 and a carrier.

69. A method for inhibiting expression of the MAPT gene in a cell or cell population, comprising contacting said cell or cell population with an siRNA described in any one of claims 1 to 67 or a composition described in claim 68.

70. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double-stranded region, (a) the antisense strand comprises or consists of a nucleotide sequence corresponding to any one of the antisense nucleotide sequences in Tables 1, 2, 3, 4, 5, 9, or 33; (b) the sense strand comprises or consists of a nucleotide sequence corresponding to any one of the sense nucleotide sequences in Tables 1, 2, 3, 4, 5, 9, or 33; or (c) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 1, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 1; (d) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 2, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 2; (e) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 3, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 3; (f) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 4, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 4; (g) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 5; (h) the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence of a row in Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence of the same row in Table 9; or (i) a small interfering ribonucleic acid, wherein the antisense strand comprises or consists of a nucleotide sequence corresponding to the antisense nucleotide sequence in a row of Table 5, and the sense strand comprises or consists of a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 33.

71. The siRNA agent of claim 70(a), 70(b), or 70(c), wherein the antisense strand, the sense strand, the antisense strand, or both, comprise at least one modified nucleotide.

72. 72. The siRNA agent of claim 70(a), 70(b), 70(c), or 71, wherein the antisense strand, the sense strand, the antisense strand, or both, comprise at least one modified internucleotide linkage.

73. The siRNA agent of any one of claims 70 to 72, wherein the antisense strand, the sense strand, or both the antisense strand and the sense strand are conjugated to one or more lipophilic moieties.

74. 74. The siRNA agent of claim 73, wherein the one or more lipophilic moieties are selected from L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21, L22, L23, and L24.

75. A composition comprising the siRNA agent of any one of claims 70 to 74 and a carrier.

Images