Oligonucleotides

Abstract

The present invention relates to the field of oligonucleotides that bind to polyoma virus RNA. Such oligonucleotides can be used to treat any disease or condition caused by or associated with such viruses.

Description

Field of the Invention

[0001] The present invention relates to the field of oligonucleotides that bind to polyomavirus RNA. Such oligonucleotides can be used to treat any disease or disorder caused by or associated with such a virus. Background Art

[0002] Polyomaviruses are small, non-enveloped, double-stranded DNA viruses, and their natural hosts are typically mammals and birds. Most adult infections are asymptomatic, but can become pathological when the immune system is compromised. Examples of human polyomaviruses are BK virus (BKV), JC virus (JCV), and Merkel cell virus (MCV).

[0003] Both JCV and BKV are opportunistic pathogens that infect humans in early childhood (Leploeg, M.D. et al., Clinical Infectious Diseases, 2001). The seroprevalence in adults is high. Both viruses are thought to be latent in the host's renal cells (Wunderink, H.F. et al., American Journal of Transplantation, 2017). For example, reactivation can occur in immunosuppressed individuals (Wunderink, H.F. et al., American Journal of Transplantation, 2017; Parajuli, S. et al., Clinical Transplantation, 2018; Gard, L. et al., PLoS One, 2017).

[0004] Polyomaviruses have a common genomic structure. They have genes that are expressed both early and late in the infection cycle. Both early and late genes produce RNA, from which multiple proteins can be translated by alternative splicing. The late genes typically encode three capsid proteins, while the early genes encode small T antigen and large T antigen and usually include one or more alternatively spliced coding regions (Helle, F. et al., Viruses, (2017), 3; 9(17): 327, 1-18).

[0005] WO 2019 / 168402 describes antisense oligonucleotides that regulate the splicing of polyomavirus large T antigen pre-mRNA. Such antisense oligonucleotides can have a sequence complementary to the splice donor site and / or splice acceptor site in the pre-mRNA.

[0006] However, there remains a need for new and improved antisense oligonucleotides for treating diseases or disorders caused by or associated with polyomaviruses. Summary of the invention

[0007] In a first aspect, the present invention relates to an oligonucleotide comprising a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or comprising a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that at least one nucleobase of the SEQ ID NO is replaced by a nucleobase analogue having the same base pairing specificity as the replaced nucleobase.

[0008] In a second aspect, the present invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) a reverse complementary sequence of the oligonucleotide as defined in the first aspect, or (iii) a DNA capable of being transcribed into the oligonucleotide as defined in the first aspect.

[0009] In a third aspect, the present invention relates to a pharmaceutical composition comprising the oligonucleotide as defined in the first aspect or the vector as defined in the second aspect.

[0010] In a fourth aspect, the present invention relates to an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect for use as a medicament, in particular for use in treating a polyomavirus infection in a subject.

[0011] In a fifth aspect, the present invention relates to an ex vivo method comprising an ex vivo method for inhibiting polyomavirus replication in cells and an ex vivo method for producing a transplant, both of which methods comprise the use of an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect, or a pharmaceutical composition as defined in the third aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1: BKV T-Ag splice sites are conserved between genotypes, allowing a “one-size-fits-all” ASO approach. Publicly available complete genome sequences of BKV isolates were downloaded and full-genome T-Ag sequences were aligned and investigated for conservation between genotypes. Genotypes were identified using reference isolates described in the literature. Findings indicated that donor splice sites in T-Ag are predominantly conserved between genotypes, whereas acceptor splice sites are more variable in non-coding intronic regions. Based on these findings, we identified a stretch of nucleotides overlapping the donor splice site that showed 100% sequence conservation between genotypes. Streamlined BKV T-Ag phylogenetic tree (left) with sequence logos depicting splice site conservation for each genotype (right). The size of the letters (nucleotides) indicates the relative occurrence of the nucleotide present at that position for each genotype. Deletions are depicted as blank spaces or gaps in the sequence logos. Sequences are given in Table 1.

[0013]

[0014] Figure 2: Multiple ASOs were designed to target the exon 1 - intron donor site of the BK virus large T antigen. The targeted large T antigen donor splice sites were defined as SEQ ID NOs: 1 to 10 and were designed using an in-house developed design algorithm. Briefly, the algorithm takes into account the antisense oligonucleotide (ASO) GC content (40%-60%), melting temperature (> 48°C), and absence of CpG motifs. Each potential ASO was assigned a score that was increased when the requirements were not met. In general, ASOs with low scores were preferred over ASOs with high scores, but the predicted secondary structure of the target RNA and the ASO, as well as binding to enhancers of splicing (RESCUE) and / or silenced genes in the target RNA were also considered. Importantly, the score takes into account whether the design requirements were met but does not predict efficacy. Finally, targetable sequences need to contain at least 1 exonic or intronic nucleotide. The light boxes define 2'-OMe-fully modified ASOs (SEQ ID NOs: 12 to 21) derived from each of SEQ ID NOs: 1 to 10, and the dark boxes define GapmeR oligonucleotides targeting exon-intron junctions (SEQ ID NO: 42) or exon 1 sequences SEQ ID NOs: 43 to 45. Truncated ASOs are represented by SEQ ID NO: 11. The ASO represented by SEQ ID NO: 11 comprises a portion of SEQ ID NO: 5. The ASO represented by SEQ ID NO: 11 has been further modified to be a 2'-OMe fully modified ASO (all nucleotides have 2'-O-methyl bases) and each internucleotide bond is a phosphorothioate bond. The further modified ASO is represented by SEQ ID NO: 22.

[0015] Figure 3: Chemically modified ASOs targeting the BKV large T antigen exon 1-intron junction mediate 10- to 100-fold inhibition of BKV parameters. Human primary renal tubular epithelial cells (PTEC) were treated with novel candidate 2'-OMe-modified ASOs (SEQ ID NOs: 12 to 21) and subsequently infected with BKV. BKV mRNA and protein expression as well as viral particle release in the supernatant were investigated using PCR or western blot (n = 3 replicates). The graphs show the fold change for each individual ASO relative to the scrambled control on the following various outcome measures: T-Ag mRNA, VP1 mRNA, VP1 protein, and virus production. The dark gray thick line represents the average overall reduction observed for HYB_03 (20-mer, 2'O-methyl nucleotides and phosphorothioate backbone, represented by SEQ ID NO: 68), which was used as a reference. SEQ ID NO: 67 is the native RNA sequence from which SEQ ID NO: 68 was derived. SEQ ID NO: 67 is represented by 5'-CAGCACAAACCUCUGAGCUA-3'.

[0016] The variability in the activity of SEQ ID NO: 12 was due to poor nuclear localization and viability in cells from different replicates. The selected novel candidate sequences (SEQ ID NOs: 16 to 19) stood out for their high potency in inhibiting BKV mRNA and protein expression and virus production. In general, mRNA expression and production of viral particles were inhibited by at least 10-fold, while protein expression was reduced by 100-fold after treatment with these novel 2'-OMe modified ASO candidates compared to 2'-OMe modified scrambled controls.

[0017] Figure 4: 2'-OMe chemistry produces greater reduction in BKV parameters than ASOs with 2'-MOE chemistry when targeting exon 1-intron junctions. Human primary renal tubular epithelial cells (PTEC) were treated with chemical variants of new candidate ASOs (SEQ ID NO: 16 to 19) and subsequently infected with BKV. BKV protein expression and viral particle release in supernatants were studied using PCR or western blots. FAM-labeled scrambled controls, HYB_03 with FAM conjugates (i.e., SEQ ID NO: 68 (+FAM)), and unlabeled HYB_03 (-FAM) (i.e., SEQ ID NO: 68 (-FAM)) were used as references or controls (n=3 replicates). The figure shows the fold change of each individual ASO relative to the FAM-labeled scrambled control on various outcome measures (VP1 protein and virus production). Interestingly, ASOs containing MOE-PS (SEQ ID NO: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37, 38, or 69) showed low activity in inhibiting BKV, while OMe-PS variants (SEQ ID NO: 17, 18, 19, 22, 26, 30, 34, 38, and 68, HYB_03) showed strong inhibition of protein expression and virus production. The presence of 5'-methylcytidine did not seem to interfere with the efficacy of the ASOs. In addition to HYB_03 (SEQ ID NO: 68), the four most potent ASOs were selected as the most promising candidates, namely SEQ ID NO: 30, 18, 34, and 19.

[0018] Figure 5 : Oligonucleotide with SEQ ID NO: 19 produces effective reduction of BKV infected cells after "reinfection". Reinfection assays were performed to determine whether ASOs limit the production of active virus, whereby human proximal tubule epithelial cells were treated with a scrambled control and several ASOs that exhibited anti-BKV activity (HYB_03 (SEQ ID NO: 68), SEQ ID NO: 26, SEQ ID NO: 17, SEQ ID NO: 34, SEQ ID NO: 19). Human PTEC were pre-treated with ASOs (24 hours before infection) and infected with BKV, after which the cells were incubated for a period of 7 days. Culture supernatants were harvested on day 7 and plated on freshly plated PTEC in 10-fold dilutions for 3 days. Cells were stained for the expression of nuclei (DAPI) and large T antigen protein.

[0019] Figure 6: Oligonucleotide with SEQ ID NO: 19 produces effective reduction of BKV-derived RNA, protein and viral DNA after "reinfection". Reinfection assays were performed to determine whether ASOs limit the production of active virus, whereby human proximal tubule epithelial cells were treated with a scrambled control and several ASOs that exhibited anti-BKV activity (HYB_03 (SEQ ID NO: 68), SEQ ID NO: 26, SEQ ID NO: 17, SEQ ID NO: 34, SEQ ID NO: 19). Human PTEC were pre-treated with ASOs (24 hours before infection) and infected with BKV, after which the cells were incubated for a period of 7 days. Culture supernatants were harvested on day 7 and plated in 10-fold dilutions on freshly plated PTEC for 3 days, at which time we assessed the levels of large T mRNA, VP1 mRNA, and protein and viral DNA production.

[0020] Figure 7: ASOs targeting splicing induce aberrant splicing of early coding region pre-mRNA with a switch from large T antigen to small t antigen. Mouse Balb / c cells were transformed with pRPc vector containing the early coding region of the Gardner BK virus strain (Negrini, M. et al., Cancer Research, 1992). This drove constitutive expression of the early coding region of BKV in these cells, as evidenced by abundant expression of large T antigen mRNA (product 1) and small t antigen mRNA (product 3). Scrambled control, HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 were applied by lipofectamine at a concentration of 25 nM and RNA was harvested 24 hours after treatment. Mismatch controls of SEQ ID NO: 19 (single mismatch at nucleobase 10 (SEQ ID NO: 39), double mismatch at nucleobases 5 and 10 (SEQ ID NO: 40), and triple mismatch at nucleobases 5, 10, and 15 (SEQ ID NO: 41)) were applied by lipofectamine at a concentration of 25 nM and RNA was harvested 24 h after treatment. Note: These cells were kindly provided by Prof. Massimo Negrini (University of Ferrara, Italy). Treatment with HYB_03 and SEQ ID NO: 19 significantly affected the splicing and expression levels of early coding region pre-mRNAs, resulting in a clear shift from large T antigen as the major product (band 1) to an increase in various RNA products, including small t antigen (band 3). Introduction of a single mismatch resulted in partial restoration of normal splicing, while 2-3 mismatches almost completely restored splicing of large T antigen as the major RNA species. These data provide clear evidence of target engagement and specificity.

[0021] Figure 8: GapmeR targeting large T antigen splicing does not induce aberrant splicing and does not mediate a modest reduction in large T antigen mRNA. Mouse Balb / c cells were transformed with a pRPc vector containing the early coding region of the Gardner BK virus strain (Negrini, M. et al., Cancer Research, 1992). This drove constitutive expression of the early coding region of BKV in these cells, as evidenced by abundant expression of large T antigen mRNA (product 1) and small t antigen mRNA (product 3). In contrast to antisense oligonucleotides that use steric hindrance to regulate splicing, GapmeR was designed to be derived from the sequence of SEQ ID NO: 19 and applied by lipofectamine at a concentration of 25 nM, and RNA was harvested 24 hours after treatment. The GapmeR version of SEQ ID NO: 19 was applied by lipofectamine at a concentration of 25 nM, and RNA was harvested 24 h after treatment (SEQ ID NO: 42), but it did not show any significant activity on large T or small t antigen RNA expression levels. Additional GapmeRs (SEQ ID NOs: 43 to 45) targeting exon 1 of early coding region (pre) mRNA did not mediate a significant reduction in early coding region mRNA. Thus, the effect of GapmeR on T antigen splicing was not as great as previously observed with ASOs HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 targeting splice sites. These findings suggest that, although GapmeR is able to degrade the target mRNA, the splicing of the target mRNA is largely unaffected. Note: These cells were kindly provided by Prof. Massimo Negrini (University of Ferrara, Italy).

[0022] Fig. 9 : PBMC viability was not affected by treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of 4 different donors and incubated for 48 hours in the presence of increasing concentrations of ASO. After incubation, cell viability was measured using the Cell titer Blue viability assay. PBMCs were incubated at 65°C for 10 minutes as a positive control. As an additional control, PBMCs were activated using 1 µM R848 (TLR7 / 8 agonist), and all conditions were compared to saline-treated controls. Cell viability is expressed as a percentage relative to saline-treated controls. As shown in the figure, no live cells were detected in the positive control incubated at 65°C after 48 hours, while no significant effect on cell viability was observed in ASO-treated PBMCs.

[0023] Fig.10 : Treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 mediates minimal activation of proinflammatory cytokine responses in PBMCs. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of 4 different donors and incubated for 48 hours in the presence of increasing concentrations of ASO. After incubation, supernatants were harvested to measure cytokine production. As a positive control, PBMCs were activated using 1 µM R848 (TLR7 / 8 agonist, data not shown), and all conditions were compared to saline-treated controls. The relative production and release of 6 cytokines in response to exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 are shown in the left figure. A slight transient increase in the levels of some cytokines in response to ASO treatment was observed, but never to the same extent as the R848-treated control. The data represent cytokines within the detection limit in all 4 donors.

[0024] Fig.11 : Treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 mediates minimal activation of pro-inflammatory and anti-inflammatory cytokines in PBMCs. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of 4 different donors and incubated for 48 hours in the presence of increasing concentrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19. After incubation, supernatants were harvested to measure cytokine production. As a positive control, PBMCs were activated using 1 µM R848 (TLR7 / 8 agonist, data not shown), and all conditions were compared to saline-treated controls. The relative production and release of 6 cytokines in response to treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 are shown in the left figure. Slight transient increases in some cytokine levels in response to ASO treatment were observed, but never to the same extent as R848 treated controls. Data represent cytokines within detection limits for 2 of 4 donors.

[0025] Fig.12: Exposure of human plasma to oligonucleotides having SEQ ID NO: 19, SEQ ID NO 30, SEQ ID NO: 18 or SEQ ID NO: 34 had minimal effect on plasma clotting time. Increasing concentrations of ASOs were added to normal human plasma, after which the activated partial thromboplastin time (aPTT) test was used to activate the intrinsic pathway of the coagulation cascade. The ASO conditions were compared to saline-treated control plasma. Activation of the intrinsic coagulation cascade in saline-treated control plasma resulted in a clotting time of 33.8 seconds. Addition of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 to plasma resulted in a dose-dependent extension of the clotting time. Data represent n = 1.

[0026] Figure 13: BKV-targeted ASOs are significantly taken up by the proximal and distal tubules of the mouse renal cortex. A) 9-week-old male C57BL6 mice received intravenous injections of 40 mg / kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 on days 0, 3, 7, and 10. These mice were compared to saline-treated animals. Group size was 5 mice per group per time point. B) Visual evidence of high levels of SEQ ID NO: 19 distributed to the kidney, and particularly to the proximal tubule epithelial cells, as demonstrated by staining with a specific Cy5-labeled FISH probe (SEQ ID NO: 19). Individual segments of the nephron were defined as the glomerulus (glom), proximal tubule epithelial cells (prox) and distal tubule epithelial cells (dist), and collecting duct epithelium ("coll") based on immunohistochemical staining for nephrin ("glom"), LTL ("prox"), E-cadherin ("dist"), and aquaporin-2 ("coll"). B) (right image), trace levels of SEQ ID NO: 19 were detected in the medullary portion of the kidney (see arrow).

[0027] Fig.14: Hybridization ELISA analysis of SEQ ID NO: 19 uptake in kidney and high blood flow organs. 9-week-old male C57BL6 mice received intravenous injections of 40 mg / kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 on days 0, 3, 7, and 10 and were compared to saline-treated animals (n = 5 mice per group). Results of experiments with SEQ ID NO: 19 are shown. Left panel: Quantification of SEQ ID NO: 19 levels in both kidneys (left and right), liver, spleen, and lungs is shown, indicating that the (relative) uptake per gram of kidney tissue is approximately 2.5 times that per gram of liver tissue. Similarly, a greater relative uptake was observed in the kidney compared to the lung and spleen. Right panel: Individual mouse tissue levels are depicted, indicating consistent tissue distribution characteristics in vivo.

[0028] Fig.15 : Multiple administration of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 over 2 weeks does not result in signs of kidney or liver damage in mouse serum. 9-week-old male C57BL6 mice received intravenous injections of 40 mg / kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 on days 0, 3, 7, and 10 and were compared with saline-treated animals. Serum levels of kidney and liver function markers were studied 14 days after the first administration (n = 5 mice per group). Upper panel: Serum levels of kidney (creatinine, urea and albumin) and liver (AST and ALT) biomarkers, indicating organ function and / or damage. Although some minor differences were detected between some groups, all levels were well within the normal range, so no signs of kidney or liver damage were observed.

[0029] Fig.16A: Repeated administration of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 over 2 weeks does not result in signs of renal injury. 9-week-old male C57BL6 mice received intravenous injections of 40 mg / kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 on days 0, 3, 7, 10 and were compared to saline-treated animals (n = 5 mice per group). Representative images of Sirius red (upper panel) and KIM-1 staining (lower panel) in the kidney after sacrifice. It can be clearly seen from the upper panel that administration of saline (0.9% NaCl) or ASO does not result in signs of ASO-related renal injury. Images are compared to a positive control (ischemia-reperfusion injury; IRI). B. Quantification of Sirius red staining in the kidney on day 14. Three animals receiving ASO showed increased renal collagen content (HYB_03, n = 2, SEQ ID 34, n = 1), but this could not be unequivocally attributed to administration of ASO and may be due to a potentially higher number of major blood vessels in the images used for quantification.

[0030] Figure 17: ASOs according to the invention have improved antiviral activity. PTEC were treated with ASOs 24 h before infection with BKV and BKV RNA expression was quantified at day 5 post infection. A) Relative T-Ag and VP1 RNA expression of cells treated with ASO8 (SEQ ID NO: 8), ASO23 (SEQ ID NO: 23 of WO 2019 / 168402) and ASO24 (SEQ ID NO: 24 of WO 2019 / 168402). B) Relative VP1 protein expression of cells treated with ASO8, ASO23 and ASO24. DETAILED DESCRIPTION DETAILED DESCRIPTION OF THE INVENTION

[0031] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methods, protocols and reagents described herein, as these may vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0032] Preferably, the terms used herein are as defined in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and Kölbl, H., eds. (1995), Helvetica Chimica Acta [Swiss Chemical Journal], CH-4010 Basel, Switzerland.

[0033] Several documents are cited throughout this specification. Each document cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, is incorporated herein by reference in its entirety.

[0034] Hereinafter, the elements of the present invention will be described. These elements are listed together with specific embodiments, however, it should be understood that they can be combined in any manner and in any quantity to create other embodiments. The various described examples and preferred embodiments should not be interpreted as limiting the present invention to only the embodiments clearly described. This specification should be understood as supporting and covering the embodiments that will clearly describe the embodiments and any number of disclosed and / or preferred element combinations. In addition, unless the context indicates otherwise, any arrangement and combination of all described elements in this application should be considered to be disclosed by the description of the application.

[0035] Throughout this specification and the following claims, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or any other group of integers or steps. In preferred embodiments, "comprising" may mean "consisting of." As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise.

[0036] exist First In one aspect, the present invention relates to an oligonucleotide, in particular an oligonucleotide comprising a nucleobase sequence having a base pairing specificity according to a nucleobase sequence of one of SEQ ID NOs: 1 to 11.

[0037] Typically, the oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or comprises a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that at least one nucleobase of said SEQ ID NO is replaced by a nucleobase analogue having the same base pairing specificity as the replaced nucleobase.

[0038] Oligonucleotides, basic structure

[0039] The oligonucleotide of the present invention is capable of specifically binding to polyomavirus pre-mRNA ("target RNA") produced after human cells are infected with polyomavirus. Therefore, it can also be described as a polyomavirus oligonucleotide or antisense oligonucleotide ("ASO") or polyomavirus antisense oligonucleotide. The portion of the target RNA to which the oligonucleotide is capable of specifically binding (i.e., a stretch of continuous nucleobases) is referred to herein as the "target region".

[0040] In a preferred embodiment, at least a portion of the oligonucleotide is at least substantially complementary to the target region. Therefore, the oligonucleotide comprises at least 12 continuous nucleobases, and the sequence of the continuous nucleobases is the reverse complementary sequence of at least 12 continuous nucleobase sequences in the target region. Preferably, the length of the target region is 12 to 30, i.e. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases, or 12 to 28 nucleobases. More preferably, the length of the target region is 17 to 26, i.e. 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleobases. Even more preferably, the length of the target region is 18 to 22, i.e. 18, 19, 20, 21 or 22 nucleobases. Most preferably, the length of the target region is 20 nucleobases.

[0041] Typically, the target region comprises a polyomavirus pre-RNA. The target region preferably comprises a splice donor site of intron 1 (or a portion thereof) and / or exon 1 (or a portion thereof) of the large T antigen of the corresponding polyomavirus. Preferably, the target region includes up to 30 consecutive nucleobases of intron 1 and / or (preferably and) exon 1, wherein 0 to 30 of the 30 consecutive nucleobases, i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleobases have a splice donor site of intron 1, and the remaining consecutive nucleobases have exon 1. In a preferred embodiment, the target region comprises one or two intron nucleobases adjacent to the splice donor site. In a preferred embodiment, the target region comprises 1-28, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 intronic nucleobases adjacent to the splice donor site. In another preferred embodiment, the target region comprises 1-28, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 exonic nucleobases adjacent to the splice donor site.

[0042] It is understood that the sum of the intronic and exonic nucleobase numbers does not exceed the total number of nucleobases in the oligonucleotide.

[0043] In embodiments, the oligonucleotide may comprise one or more nucleobases that are incapable of specifically binding to the target RNA, and in particular are not reverse complementary to the target RNA (in the case of a contiguous sequence that is reverse complementary to the target RNA).

[0044] The length of an oligonucleotide is up to 200, up to 175 or up to 150, preferably up to 100, and more preferably up to 50 nucleobases (including nucleotides and nucleotide analogs) long, for example 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobases. When the length of an oligonucleotide is greater than 50 nucleotides (for example when the length is 75 or 100 or 150 or 200 nucleotides), the oligonucleotide may also be referred to as a polynucleotide. In a preferred embodiment, the oligonucleotide is 12 to 27, preferably 12 to 22, i.e. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 nucleobases in length, more preferably from 17, 18, 19 or 20 to 22 nucleobases, i.e. 17, 18, 19, 20, 21 or 22 nucleotides in length. In a preferred embodiment, the oligonucleotide is 20 nucleobases in length.

[0045] In particular, a first aspect relates to an oligonucleotide comprising a nucleobase sequence (or nucleotide sequence) having a base pairing specificity according to a nucleobase sequence of one of SEQ ID NOs: 1 to 11. This means that the nucleobase sequence of the oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11, or it comprises a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11. "Similar" means that at least one nucleobase of the SEQ ID NO is replaced by a nucleobase analogue having the same base pairing specificity as the replaced nucleobase. Nucleobase analogues are modifications explained below. Preferred embodiments relate to SEQ ID NOs: 5, 6, 7, 8 and 10, preferably SEQ ID NO: 8. The above-mentioned embodiments of the oligonucleotides are all applicable (as long as they are compatible). In a preferred embodiment, the nucleobase sequence (or nucleotide sequence) of the oligonucleotide consists of a nucleobase sequence according to one of SEQ ID NOs: 1 to 11, or wherein the nucleobase sequence of the oligonucleotide consists of a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11.

[0046] Oligonucleotides, modified

[0047] Oligonucleotides may be modified (referred to herein as "modified oligonucleotides"). This is expected to improve stability, particularly resistance to nucleases. This is advantageous when the oligonucleotide is administered as is (ie, naked) to a patient.

[0048] Thus, in an embodiment, the oligonucleotide is a modified oligonucleotide. In an embodiment, the modification of the oligonucleotide is compared to a (natural) RNA oligonucleotide. A modified oligonucleotide comprises a modified internucleotide bond and / or a modified nucleotide. A modified nucleotide is a synonym for a nucleotide analog.

[0049] In a preferred embodiment, the oligonucleotide comprises a modification that renders the RNA duplex resistant to nucleases (preferably exonucleases, particularly RNase H), wherein the RNA duplex comprises the oligonucleotide and an oligonucleotide at least partially complementary thereto (complementary oligonucleotide, i.e., target RNA). In other words, the oligonucleotide provides resistance to nuclease degradation of the RNA duplex, which comprises the oligonucleotide and an oligonucleotide at least partially complementary thereto. This is preferably provided by internucleotide bond modifications as described above (e.g., phosphorothioate-modified nucleotides and / or sugar (scaffold) modifications (e.g., 2'-O-modified sugar modifications). Therefore, the oligonucleotide preferably comprises a modified region (i.e., at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 modified nucleotides) that provides duplex nuclease resistance.

[0050] Modified oligonucleotides may comprise nucleotide analogs and / or modified internucleotide bonds. When every internucleotide bond is modified, the oligonucleotide is said to have a "backbone modification".

[0051] Nucleotide analogs are preferably nucleotides comprising a base modification ("modified base") and / or a sugar modification ("modified sugar", also called scaffold modification). In embodiments, the base modifications are modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatine, lysine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidines (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5'-methylcytosine, 5'-methylcytidine, 5-hydroxymethylcytosine, Super T, or as described, for example, by Kumar et al. J. Org. Chem. 2014, 79, 5047; Leszczynska et al. Org. Biol. Chem. 2014, 12, 1052, pyrazolo[1,5-a]-1,3,5-triazine C-nucleosides (e.g., Lefoix et al. J. Org. Chem. 2014, 79, 3221), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, boronated cytosine (e.g., Niziol et al. Bioorg. Med. Chem. 2014, 22, 3906), pseudoisocytidine, C(Pyc) (such as, for example, Yamada et al. Org. Biomol. Chem. [Organic and Biomolecular Chemistry] 2014, 12, 2255) and N4-ethylcytosine or its derivatives; N 2 -Cyclopentylguanine (cPent-G), N 2 -cyclopentyl-2-aminopurine (cPent-AP) and N 2-propyl-2-aminopurine (Pr-AP), carbohydrate-modified uracil (as in, for example, Kaura et al. Org. Lett. 2014, 16, 3308), amino acid-modified uracil (as in, for example, Guenther et al. Chem. Commun. 2014, 50, 9007); or derivatives thereof; or degenerate or universal bases (like 2,6-difluorotoluene), or the absence of bases (like abasic sites) (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced by nitrogen (azaribose). Examples of derivatives of Super A, Super G, and Super T can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences). When incorporated into siRNA, cPent-G, cPent-AP and Pr-AP showed reduced immunostimulatory effects (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200). Additional examples of modified bases are described, for example, in WO 2014 / 093924.

[0052] Preferred modified bases are 5'-methylcytosine and 5'-methylcytidine. In a preferred embodiment, all cytosines of the oligonucleotide are modified to (ie replaced by) 5'-methylcytosine or preferably 5'-methylcytidine.

[0053] Typically, nucleobase analogs are used to replace nucleobases with the same base pairing specificity in at least the portion of the oligonucleotide that is complementary to the target region. "Base pairing" refers to the binding of two nucleobases to each other through hydrogen bonds. In particular, a nucleobase analog that replaces cytosine can base pair with guanine, a nucleobase analog that replaces guanine can base pair with cytosine, a nucleobase analog that replaces adenine can base pair with uracil, and a nucleobase analog that replaces uracil can base pair with adenine.

[0054] The oligonucleotide may comprise at least 1, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 base modifications. These may all be modifications of the same type, or they may comprise two or more different modifications.

[0055] The sugar (scaffold) modification may be a modification of the ribosyl moiety, such as a 2'-O-modified RNA nucleotide, such as a 2'-O-alkyl or 2'-O-(substituted) alkyl, for example 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O-(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl) (2'-AECM), 2'-O-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, 21, 6285) such as 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl, such as 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2'-O-[2-(methylthio)ethyl] (2'-MTE), 2'-(ω-O- Serinol); 2'-halo, such as 2'-F, FANA (2'-F arabinosyl nucleic acid); 2',4'-difluoro-2'-deoxy; carbocyclic sugar and azasugar modifications; other modified RNA nucleotides are 3'-O-substituted (e.g., 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl), 4'-substituted (e.g., 4'-aminomethyl-2'-O-methyl or 4'-aminomethyl-2'-fluoro; 5'-substituted, such as 5'-methyl) or CNA (Østergaard et al. ACS Chem. Biol. [ACS Journal of Biological Chemistry] 2014, 22, 6227). Derivatives of the above are also contemplated.

[0056] In addition, the sugar (scaffold) modification may include a bicyclic nucleic acid monomer (BNA), which may be a bridged nucleic acid monomer. Each occurrence of the BNA may result in a monomer independently selected from the group consisting of: a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a wood-LNA monomer, an α-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a 2'-thio-LNA monomer, a (2'-O,4'-C) constrained ethyl (cEt) BNA monomer, a (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomer, 2',4'-BNA NC (N-Bn) monomer, ethylene-bridged nucleic acid (ENA) monomer, carba LNA (cLNA) monomer, 3,4-dihydro-2H-pyranose nucleic acid (DpNA) monomer, 2'-C-bridged bicyclic nucleotide (CBBN) monomer, heterocyclic bridged BNA monomer (such as triazole or tetrazolyl linked), amide-bridged BNA monomer, urea-bridged BNA monomer, sulfonamide-bridged BNA monomer, bicyclic carbocyclic nucleotide monomer, TriNA monomer, α-L-TriNA monomer, bicyclic DNA (bcDNA) monomer, F-bcDNA monomer, tricyclic DNA (tcDNA) monomer, F-tcDNA monomer, oxetane nucleotide monomer, locked PMO monomer derived from 2'-amino-LNA, guanidine-bridged nucleic acid (GuNA) monomer, spirocyclopropene-bridged nucleic acid (scpBNA) monomer and its derivatives.

[0057] Preferred sugar modifications are selected from the group consisting of 2'-O-modifications, preferably 2'-O-alkyl or 2'-O-(substituted)alkyl, more preferably 2'-O-methyl or 2'-O-(2-methoxy)ethyl (2'-MOE) and modifications to BNA monomers, preferably CRN monomers or locked nucleic acid (LNA) monomers. More preferably a combination of 2'-O-methyl sugar modifications and modifications to LNA. Even more preferably 2'-O-methyl as the only sugar modification.

[0058] The oligonucleotide may comprise at least 1, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar modifications. These may all be modifications of the same type, or they may comprise two or more different modifications.

[0059] The internucleotide bond modification can be selected from the group consisting of modified phosphodiesters of RNA, such as phosphorothioates (PS), chirally pure phosphorothioates, (R)-phosphorothioates, (S)-phosphorothioates, phosphorodithioates (PS2), phosphoroacetate (PACE), phosphoroacetamide (PACA), thiophosphoroacetate (thioPACE), thiophosphoroacetamide, phosphorothioate prodrugs, H-phosphonates, methyl phosphonates, methyl thiophosphonates, methyl phosphates, methyl phosphorothioates, ethyl phosphates, ethyl phosphorothioates, borophosphates, borothiophosphates, methyl borophosphates, methyl borothiophosphates, methyl borophosphonates, methyl borothiophosphates, phosphate esters, phosphotriesters, aminoalkylphosphotriesters and derivatives thereof. Another modification includes guanidine phosphate, phosphoramidite, aminophosphoryl ester, N3'→P5'aminophosphoryl ester, diaminophosphoroester, thiodiaminophosphoroester, aminosulfonate, dimethylene sulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, acetyl group, thioacetyl group, methyleneacetyl group, alkenyl, methylenehydrazine group, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimine (MMI) and thioacetamido nucleic acid (TANA) and their derivatives. The example of chiral pure thiophosphate bond is described in, for example, WO 2014 / 010250 or WO 2017 / 062862 (WaVe Life Sciences). The example of guanidine phosphate bond is described in WO 2016 / 028187 (Noogen). Various salts, mixed salts and free acid forms are also included, as well as 3'→3' and 2'→5' bonds.

[0060] The oligonucleotide may comprise at least 1, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 internucleotide linkage modifications. These may all be modifications of the same type, or they may comprise two or more different modifications.

[0061] Preferred internucleotide linkage modifications are PS, PS2, phosphoramidite or phosphorodiamidate, preferably PS. In a preferred embodiment, all internucleotide linkages of the oligonucleotide are PS linkages. In other words, the backbone of the oligonucleotide is PS.

[0062] In one embodiment, one of the multiple nucleotides at the 5' end of the oligonucleotide and / or one of the multiple nucleotides at the 3' end of the oligonucleotide is modified (i.e., a nucleotide analog and / or has a modified internucleotide bond), and the nucleotides at the central portion of the oligonucleotide are not modified. "5' or 3' end nucleotides" covers 20% of the nucleotides of the corresponding end oligonucleotide, and "central portion" covers the remaining nucleotides of the oligonucleotide. For example, if the oligonucleotide has a sequence consisting of 20 nucleotides, the 4 nucleotides at the 5' end of the oligonucleotide are the nucleotides at the 5' end, the 4 nucleotides at the 3' end of the oligonucleotide are the nucleotides at the 3' end, and the remaining 12 nucleotides are the nucleotides at the central portion of the oligonucleotide. If the number of nucleotides according to the percentage is not an integer, it is rounded to the nearest integer (the first decimal of at most 4 is rounded down, and the first decimal of at least 5 is rounded up). Therefore, in one embodiment, at least one nucleotide and / or at least one internucleotide bond present at the 5' end and / or 3' end of the oligonucleotide is modified, while other nucleotides and other internucleotide bonds are not modified.

[0063] The modifications covered are all defined herein. It is expected that modifying the oligonucleotide at such a position may help improve its stability or resistance to exonucleases. This is advantageous when the oligonucleotide is administered as is (i.e. naked) to a patient.

[0064] In an embodiment, the last 1, 2, 3, 4 nucleotides and / or internucleotide linkages at the 5' position of the oligonucleotide are modified.

[0065] In an embodiment, the last 1, 2, 3, 4 nucleotides and / or internucleotide linkages at the 3' position of the oligonucleotide are modified.

[0066] In an embodiment, the last 1, 2, 3, 4 nucleotides and / or internucleotide bonds at the 5' and 3' positions of the oligonucleotide are modified. Preferably, 2 nucleotides and / or 2 internucleotide bonds at the 5' and 3' positions of the oligonucleotide are modified. Preferably, 3 nucleotides and / or internucleotide bonds at the 5' and 3' positions of the oligonucleotide are modified. Preferably, 4 nucleotides and / or internucleotide bonds at the 5' and 3' positions of the oligonucleotide are modified.

[0067] For example, for SEQ ID NOs: 1 to 10, the oligonucleotide comprises an unmodified internucleotide bond between nucleotides 5 to 16 of SEQ ID NOs: 1 to 10, and a modified internucleotide bond between at least the two 5'-most nucleotides of the oligonucleotide and between at least the two 3'-most nucleotides of the oligonucleotide. For example, for SEQ ID NO: 11, the oligonucleotide comprises an unmodified internucleotide bond between nucleotides 5 to 15 of SEQ ID NO: 11, and a modified internucleotide bond between at least the two 5'-most nucleotides of the oligonucleotide and between at least the two 3'-most nucleotides of the oligonucleotide.

[0068] Preferably, at least 1, and preferably 2 to 4, more preferably 4, and optionally all nucleotides at the 5' and / or 3' end of the oligonucleotide are modified, in particular by having modified internucleotide bonds.

[0069] The modification (particularly of the 5' and / or 3' end nucleotides) preferably comprises a modified internucleotide bond, more preferably PS. Furthermore, the nucleotide is preferably a nucleotide analog. The nucleotide analog is characterized by comprising a modified sugar (preferably 2'-O-methyl), a modified base (preferably 5'-methylcytosine) and / or being an LNA monomer. For example, the following combinations characterizing nucleotide analogs are envisioned: only modified sugar; modified sugar and modified base; only LNA monomer; LNA monomer and modified base.

[0070] In a preferred embodiment, all internucleotide bonds of the oligonucleotide are PS bonds, and all nucleotides of the oligonucleotide have 2'-O-methyl bases. Preferably, all cytidines of the oligonucleotide are modified to 5-methylcytidine (i.e., the oligonucleotide does not contain cytidine, but contains 5-methylcytidine, particularly at positions that pair with guanosine in the target RNA).

[0071] Thus, in embodiments, when referring to modifications of the 5' and / or 3' end of an oligonucleotide, such modifications are:

[0072] - the modified internucleotide bond is PS, and / or

[0073] - The modified sugar is 2'-O-methyl

[0074] - The modified base is 5-methylcytosine and / or

[0075] -The modified nucleotides are locked nucleic acid (LNA) monomers.

[0076] Thus, in embodiments, when referring to modifications of the 5' and / or 3' end of an oligonucleotide, such modifications are:

[0077] - the modified internucleotide bond is PS,

[0078] - the modified sugar is 2'-O-methyl,

[0079] - The modified base is 5-methylcytosine and / or

[0080] -The modified nucleotides are locked nucleic acid (LNA) monomers.

[0081] Preferably, such modification is:

[0082] - the modified internucleotide bond is PS and

[0083] -The modified sugar is 2'-O-methyl.

[0084] Preferably, such modification is:

[0085] - the modified internucleotide bond is PS,

[0086] - The modified sugar is 2'-O-methyl and

[0087] -The modified base is 5-methylcytosine.

[0088] Preferably, such modification is:

[0089] - the modified internucleotide bond is PS and

[0090] -The modified nucleotides are locked nucleic acid (LNA) monomers.

[0091] Preferably, such modification is:

[0092] - the modified internucleotide bond is PS,

[0093] - The modified nucleotides are locked nucleic acid (LNA) monomers and

[0094] -The modified base is 5-methylcytosine.

[0095] In an embodiment, the oligonucleotide is as follows: the internucleotide bonds in the central portion of the oligonucleotide are unmodified, and preferably the 2 to 4 5'-most and / or 2 to 4 3'-most internucleotide bonds of the oligonucleotide are modified, preferably the internucleotide bonds are phosphorothioate internucleotide bonds.

[0096] In an embodiment, the oligonucleotide is modified such that every internucleotide linkage is a phosphorothioate linkage and all nucleotides have 2'-O-methyl bases.

[0097] In a preferred embodiment, the oligonucleotide is modified such that every internucleotide linkage is a phosphorothioate linkage, all cytidines are 5'-methylcytidines, and all nucleotides have 2'-O-methyl bases.

[0098] Examples of preferred oligonucleotides are characterized as follows:

[0099] - each internucleotide bond is a phosphorothioate bond and all nucleotides have 2'-O-methyl bases, for example: an oligonucleotide having a nucleotide sequence comprising or consisting of SEQ ID NO: 12 (nucleobase sequence of SEQ ID NO: 1), SEQ ID NO: 13 (nucleobase sequence of SEQ ID NO: 2), SEQ ID NO: 14 (nucleobase sequence of SEQ ID NO: 3), SEQ ID NO: 15 (nucleobase sequence of SEQ ID NO: 4), SEQ ID NO: 16 (nucleobase sequence of SEQ ID NO: 5), SEQ ID NO: 17 (nucleobase sequence of SEQ ID NO: 10), SEQ ID NO: 18 (nucleobase sequence of SEQ ID NO: 7), SEQ ID NO: 19 (nucleobase sequence of SEQ ID NO: 8), SEQ ID NO: 20 (nucleobase sequence of SEQ ID NO: 9), SEQ ID NO: 21 (nucleobase sequence of SEQ ID NO: 10) or SEQ ID NO: 22 (nucleobase sequence of SEQ ID NO: 11). ID NO: 22 (nucleotide sequence of SEQ ID NO: 11)

[0100] - Each internucleotide bond is a phosphorothioate bond, all cytidines are 5'-methylcytidines, and all nucleotides have 2'-O-methyl bases, for example: an oligonucleotide having a nucleotide sequence comprising or consisting of SEQ ID NO: 26 (the nucleobase sequence of SEQ ID NO: 11), SEQ ID NO: 30 (the nucleobase sequence of SEQ ID NO: 6), or SEQ ID NO: 34 (the nucleobase sequence of SEQ ID NO: 7).

[0101] Therefore, in a preferred embodiment, the oligonucleotide comprises a nucleotide sequence according to one of SEQ ID NOs: 12 to 22, 26, 30 and 34. In a more preferred embodiment, the nucleotide sequence of the oligonucleotide consists of a nucleotide sequence according to one of SEQ ID NOs: 12 to 22, 26, 30 and 34. In these embodiments, SEQ ID Nos: 17-19, 26, 30 and 34 are preferred; among them, SEQ ID NOs: 19, 26, 30 and 34 are preferred, especially SEQ ID NO: 19.

[0102] Thus, in an embodiment, the oligonucleotide consists of SEQ ID NO: 19, 34, 17, 18, 30 or 26 and exhibits attractive therapeutic activity as demonstrated in the experimental section (see e.g. Figure 4 , 5 , 6). In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0103] Thus, in an embodiment, the oligonucleotide comprises SEQ ID NO: 19 or 8. In an embodiment, such an oligonucleotide is 20 to 100 nucleotides in length. In an embodiment, the oligonucleotide consists of SEQ ID NO: 19 or 8. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0104] Thus, in an embodiment, the oligonucleotide comprises SEQ ID NO: 34 or 18 or 7. In an embodiment, such an oligonucleotide is 20 to 100 nucleotides in length. In an embodiment, the oligonucleotide consists of SEQ ID NO: 34 or 18 or 7. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0105] Thus, in an embodiment, the oligonucleotide comprises SEQ ID NO: 30 or 17 or 6. In an embodiment, such an oligonucleotide is 20 to 100 nucleotides in length. In an embodiment, the oligonucleotide consists of SEQ ID NO: 30 or 17 or 6. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0106] Thus, in an embodiment, the oligonucleotide comprises SEQ ID NO: 26 or 16 or 5. In an embodiment, such an oligonucleotide is 20 to 100 nucleotides in length. In an embodiment, the oligonucleotide consists of SEQ ID NO: 26 or 16 or 5. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0107] In an embodiment, an oligonucleotide is provided which comprises or consists of one of SEQ ID NO: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and is 20 to 100 nucleotides in length. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0108] In an embodiment, an oligonucleotide is provided which comprises or consists of one of SEQ ID NOs: 34, 30 or 26 and is 20 to 100 nucleotides in length. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0109] In an embodiment, there is provided an oligonucleotide comprising or consisting of SEQ ID NO: 19 or 34 and having a length of 20 to 100 nucleotides. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

[0110] Oligonucleotides, conjugated

[0111] In some embodiments, the oligonucleotide is conjugated to one or more ligands. The ligand is preferably capable of targeting and / or delivering the oligonucleotide to (or into) an organ, tissue and / or cell, such as the kidney, renal tissue or renal cells, or the bladder, bladder tissue or bladder cells, particularly bladder epithelial cells.

[0112] Examples of ligands are, for example, peptides, vitamins, aptamers, carbohydrates or mixtures of carbohydrates (Han et al., Nature Communications, 2016, doi: 10.1038 / ncomms10981; Cao et al., Mol. Ther. Nucleic Acids, 2016, doi: 10.1038 / mtna.2016.46), proteins, small molecules, antibodies (or antigen binding fragments thereof), polymers, drugs. Examples of carbohydrate conjugate group ligands are glucose, mannose, galactose, maltose, fructose, N-acetylgalactosamine (GalNac), glucosamine, N-acetylglucosamine, glucose-6-phosphate, mannose-6-phosphate and maltotriose. The carbohydrates can be present in a variety of forms, for example as terminal groups on a dendritic or branched linker moiety that connects the carbohydrate to a component of the composition. The carbohydrates can also be contained in a carbohydrate cluster moiety, such as a GalNAc cluster moiety. The carbohydrate cluster moiety may include a targeting moiety and, optionally, a conjugate linker. In some embodiments, the carbohydrate cluster moiety comprises 1, 2, 3, 4, 5, 6 or more GalNAc groups. As used herein, "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a scaffold or linker group (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting", Bioconjugate Chem., 2003, (14): 18-29; Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor", J. Med. Chem. 2004, (47): 5798-5808). In this context, "modified carbohydrate" means any carbohydrate that has one or more chemical modifications relative to a naturally occurring carbohydrate.As used herein, "carbohydrate derivative" means any compound that can be synthesized using a carbohydrate as a starting material or intermediate. As used herein, "carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. The two types of excipients can be combined to form a single composition as identified herein. Examples of trivalent N-acetylglucosamine clusters are described in WO 2017 / 062862 (Inspur Life Sciences), which also describes sulfonamide small molecule clusters. Examples of single conjugates of the small molecule sertraline have also been described (Ferrés-Coy et al., Mol. Psych. 2016, 21, 328), as well as conjugates of protein-bound small molecules including ibuprofen (e.g. US 6,656,730 ISIS / Ionis Pharmaceutical), spermine (e.g. Noir et al., J. Am. Chem Soc. 2008, 130, 13500), anisamide (e.g. Nakagawa et al., J. Am. Chem. Soc. 2010, 132, 8848), and folic acid (e.g. Dohmen et al., Mol. Ther. Nucl. Acids 2012, 1, e7).

[0113] In an embodiment, the oligonucleotide is conjugated to lithocholic acid or eicosapentaenoic acid.

[0114] In an embodiment, the oligonucleotide is conjugated (preferably via its 5' or 3' end, more preferably via its 3' end) to a peptide, vitamin, aptamer, carbohydrate or mixture of carbohydrates, protein, small molecule, antibody, polymer, drug, lithocholic acid, eicosapentaenoic acid or cholesterol moiety.

[0115] In preferred embodiments, the oligonucleotide is conjugated to a small molecule, an aptamer or an antibody (or an antigen binding fragment thereof). Preferred antibodies (or antigen binding fragments thereof) are specific for CD71 (transferrin receptor) (e.g. as described in WO 2016 / 179257 (CytoMx)) or directed against an equilibrative nucleoside transporter (ENT), such as the 3E10 antibody, as described, for example, in Weisbart et al., Mol. Cancer Ther. 2012, 11, 1.

[0116] In another preferred embodiment, the oligonucleotide is conjugated to a GalNac moiety and / or a cholesterol moiety. For example, the oligonucleotide is conjugated to a cholesterol moiety at its 3' end and to a GalNac moiety at its 5' end.

[0117] Typically, conjugation is at the 5' or 3' end of the oligonucleotide, preferably the 3' end.

[0118] Oligonucleotides, function

[0119] Functionally, the oligonucleotide (optionally with modifications and / or conjugations as described above) is characterized by being able to perform at least one of the following effects:

[0120] 1) Regulate the splicing of T antigen pre-mRNA,

[0121] 2) Reduce the production of T antigen mRNA,

[0122] 3) reducing the production of VP1 mRNA, and preferably VP1 protein,

[0123] 4) inhibiting viral replication, preferably reducing the number of viral particles produced by cells, and

[0124] 5) Limit the ability of the virus to reinfect, that is, limit the ability of infected cells to produce infectious viral particles.

[0125] 1) Modulation of T antigen pre-mRNA splicing can be assessed by monitoring the formation of a given splicing product of the pre-mRNA; the goal is a lower amount of a given splicing product because it indicates inhibition of polyomavirus. Lower amounts can mean at least 5% lower, or at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% lower than the amount of the same splicing product at the beginning of treatment with the oligonucleotide. PCR can be used for assessment.

[0126] 2) The reduction in T antigen mRNA production can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the mRNA initially produced at the start of treatment with the oligonucleotide. Preferably, the T antigen mRNA is no longer detectable. mRNA production can be detected using techniques known to the skilled artisan, such as RT-PCR or Northern blotting.

[0127] 3) The reduction in VP1 mRNA (and preferably VP1 protein) production may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the mRNA (or protein) initially produced at the start of treatment with the oligonucleotide. Preferably, VP1 mRNA (or protein) is no longer detectable. mRNA and protein production may be detected using techniques known to the skilled artisan, including RT-PCR or Northern blotting for mRNA and Western blotting for protein.

[0128] 4) Viral replication can be inhibited so that the amount of viral DNA is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the initial viral DNA at the beginning of oligonucleotide treatment. In embodiments, viral DNA is no longer detectable. The number of viral particles can be reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the initial number of viral particles at the beginning of oligonucleotide treatment. In embodiments, viral particles are no longer detectable. The number of viral particles produced or replicated by the virus can be assessed using techniques known to technicians. For example, PCR can be used to detect the number of viral particles (viral load) produced or replicated by the virus. The experimental section of the specification provides an exemplary method for detecting viral load.

[0129] 5) The restriction of viral reinfection ability can be quantified such that the number of cells infected by virus produced by an infected cell treated with the oligonucleotide is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% compared to the number of cells infected by virus produced by an infected cell not treated with the oligonucleotide

[0130] Preferably, the oligonucleotides exhibit at least effect 1. This effect on splicing is shown in the examples. Without being bound by theory, it is believed that the oligonucleotides inhibit the use of the splice sites they target. The resulting reduction in large T antigen production affects the expression of capsid proteins and thus the production of the virus. Without being bound by theory, it is believed that the imbalance of T antigen-specific splicing products induced by the oligonucleotides has a more pronounced effect on viral reproduction than the effect of reducing T antigen mRNA by RNAi-like methods.

[0131] In one embodiment, the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, and (ii) effect 4; or the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, and (ii) effect 5. Preferably, the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, (ii) effect 4, and (iii) effect 5.

[0132] In another embodiment, the oligonucleotide exhibits at least (i) effect 3 and (ii) effect 4; or the oligonucleotide exhibits at least (i) effect 3 and (ii) effect 5. Preferably, the oligonucleotide exhibits at least (i) effect 3, (ii) effect 4 and (iii) effect 5.

[0133] Therapeutic effect is defined below in the context of medical use.

[0134] Polyomavirus

[0135] In the context of the specification, the polyomavirus may be any polyomavirus. In an embodiment, the polyomavirus is a human polyomavirus, including all genera, like α, β and δ genera. In a preferred embodiment, the polyomavirus is an α or β virus, preferably a β virus. Non-limiting examples of human polyomaviruses are listed in Table 1 below. In a preferred embodiment, the polyomavirus is a BK polyomavirus (or BK virus, also referred to herein as BKPyV or BKV), a JC polyomavirus (or JC virus, also referred to herein as JCV) or a Merkel cell polyomavirus (MC polyomavirus, MC virus, or also referred to herein as MCV). In a particularly preferred embodiment, the polyomavirus is a BK virus or a JC virus, preferably a BK virus.

[0136] [Table 1]: Examples of human polyomavirus

[0137]

[0138] exist Second aspect The present invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) a reverse complementary sequence of the oligonucleotide as defined in the first aspect, or (iii) a DNA capable of being transcribed into the oligonucleotide as defined in the first aspect.

[0139] In a preferred embodiment, the vector is a nucleic acid vector. Thus, the vectors according to (i) and (ii) are preferably RNA vectors, and the vector according to (iii) is preferably a DNA vector. Nucleic acid vectors include plasmid vectors, cosmid vectors, phage vectors (such as lambda phage) and viral vectors. Viral vectors are preferred, and in some embodiments, the viral vector may be selected from the group consisting of: adenoviral vectors, adeno-associated viral vectors, retroviral vectors and lentiviral vectors. A preferred viral vector is an adeno-associated viral vector (AAV). Examples are AAV of serotype 1 (AAV1), AAV of serotype 2 (AAV2), AAV of serotype 3 (AAV3), AAV of serotype 4 (AAV4), AAV of serotype 5 (AAV5), AAV of serotype 6 (AAV6), AAV of serotype 7 (AAV7), AAV of serotype 8 (AAV8), AAV of serotype 9 (AAV9), AAV of serotype rh10 (AAVrh10), AAV of serotype rh8 (AAVrh8), AAV of serotype Cb4 (AAVCb4), AAV of serotype rh74 (AAVrh74), AAV of serotype DJ (AAVDJ), AAV of serotype 2 / 5 (AAV2 / 5), AAV of serotype 2 / 1 (AAV2 / 1), AAV of serotype 1 / 2 (AAV1 / 2), and AAV of serotype Anc80 (AAVAnc80). AAV2 is a preferred example.

[0140] However, non-nucleic acid vectors are also contemplated, and include, for example, virus-like particles (VLPs), or "VLPs" refer to non-replicating empty virus shells. VLPs are typically composed of one or more viral proteins, such as, but not limited to, those proteins referred to as capsid proteins, coat proteins, shell proteins, surface proteins, and / or envelope proteins. They contain functional viral proteins responsible for viral penetration of cells, thereby ensuring effective cell entry. Methods for producing specific VLPs are known in the art.

[0141] exist The third aspect The present invention relates to a composition comprising an oligonucleotide as defined in the first aspect or a vector as defined in the second aspect. In a preferred embodiment, the composition is a pharmaceutical composition.

[0142] The pharmaceutical composition preferably contains one or more pharmaceutically acceptable excipients, such as fillers, preservatives, solubilizers, carriers, diluents, excipients, salts, adjuvants and / or solvents, as described, for example, in Remington: The Science and Practice of Pharmacy, 20th ed. Baltimore, Maryland: Lippincott Williams & Wilkins, 2000.

[0143] Excipients can enhance the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, cellular uptake and intracellular transport of oligonucleotides, and in particular, they can be excipients capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microvesicles, vesicles, micelles, lipoplexes and / or liposomes. Examples of nanoparticles include polymer nanoparticles, (mixed) metal nanoparticles, carbon nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles. Examples of nanoparticles and oligonucleotide combinations are spherical nucleic acids (SNAs), such as, for example, Barnaby et al. Cancer Treat. Res. [Cancer Treatment Research] 2015, 166, 23.

[0144] Preferred excipients are targeting excipients that are capable of targeting and / or delivering the oligonucleotide to (or into) an organ, tissue and / or cell, such as the kidney, renal tissue or renal cells, or the bladder, bladder tissue or bladder cells, particularly bladder epithelial cells. Many of these excipients are known in the art (e.g., see Bruno, K. et al., (2011), Adv. Drug. Deliv. Rev [Advanced Drug Delivery Review], 63(13): 210-1226), examples include polymers (e.g., polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g., spermine, spermidine, putrescine, cadaverine), chitosan, poly(amidoamine) (PAMAM), poly(esteramine), polyvinyl ether, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrin, hyaluronic acid, polyacetylneuraminic acid (colominic acid) ( acid and its derivatives), dendrimers (e.g., poly(amidoamine)), lipids (e.g., 1,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lysophosphatidylcholine derivatives [e.g., 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyelin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-ditetradecylcarbamoylmethylacetamide (RPR209120), phosphoglycerol derivatives [e.g., 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol sodium salt (DPPG-Na)], phosphatidic acid derivatives [1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], Phosphatidylethanolamine derivatives [such as dioleoyl-LR-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE)], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-dioleoyloxy-2-(6-carboxy-sperminyl)-propionamide (DOSPER), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium (DMRIE), N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecyl ammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), bL-arginyl-2,3-L-diaminopropionic acid-N-palmitoyl-N-oleoyl-amide trihydrochloride (AtuFECT01), N,N-dimethyl-3-aminopropane derivatives [e.g., 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylamino 1,2-Dioleyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS)]), proteins (e.g., albumin, gelatin, atellocollagen), and linear or cyclic peptides (e.g., protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG, cell penetrating peptides (CPP), targeting peptides, cell translocation peptides, endosomal escape peptides). Examples of such peptides have been described, such as muscle targeting peptides (e.g. Jirka et al., Nucl. Acid Ther. 2014, 24, 25), CPPs (e.g. the Pip series, including WO 2013 / 030569 and the oligoarginine series, e.g. US 9,161,948 (Sarepta), WO 2016 / 187425 (Sarepta) and the M12 peptide, e.g. Gao et al., Mol. Ther. 2014, 22, 1333), or blood-brain barrier (BBB) ​​crossing peptides, such as (branched) ApoE derivatives (Shabanpoor et al., Nucl. Acids Ther. 2017, 27, 130). Carbohydrates and carbohydrate clusters as described above for oligonucleotide conjugation are also suitable as excipients. ,

[0145] The pharmaceutical composition is formulated to contain a pharmaceutically effective amount of the oligonucleotide. It can be formulated for administration via topical, systemic and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, genitourinary, intradermal, cutaneous, intestinal, intravitreal, intracavernous, intracerebral, intrathecal, epidural or oral routes.

[0146] Preferably, the pharmaceutical composition is formulated as an emulsion, suspension, pill, tablet, capsule or soft gel for oral delivery, or in the form of an aerosol or dry powder for delivery to the respiratory tract and lungs.

[0147] In an embodiment, the pharmaceutical composition further comprises another active ingredient for treating polyomavirus infection.

[0148] exist The fourth aspect The present invention relates to an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect for use as a medicament, in particular for use in the treatment of a polyomavirus infection in a subject.

[0149] For the sake of brevity, the oligonucleotide, vector and pharmaceutical composition are collectively referred to as "pharmaceutical" hereinafter.

[0150] Therefore, although the medicament is generally used to treat polyomavirus infection in a subject, it is preferably also used to treat diseases associated with polyomavirus. The meaning of polyomavirus is as defined above with respect to the first aspect. "Diseases associated with polyomavirus" include cystitis (particularly hemorrhagic cystitis, such as in recipients of bone marrow transplants), ureteritis, interstitial nephritis (also known as nephropathy; particularly transplant nephropathy) and progressive multifocal leukoencephalopathy (particularly in immunocompromised subjects).

[0151] As used herein, the term "infection" refers to a viral infection, i.e., a virus enters at least one cell of a host and replicates in the at least one cell. The infection may be acute (i.e., active) (such as, for example, in the case of polyomavirus) or may also be latent (i.e., inactive, hidden, dormant). In acute infection, the virus is replicating, infecting cells and may cause symptoms, while in latent infection, the virus does not replicate and infect more cells independently of the host cell genome, but is "hidden" in the cell. Latent infection can be interrupted by acute infection, wherein the hidden virus begins to replicate and infects other cells. In the case of pre-existing latent infection, the use of treating infection preferably involves preventing acute infection by preventing the hidden virus from infecting other cells (i.e., spreading). In other words, this can be described as the treatment of latent infection, wherein the treatment is not necessarily curative (but the virus can be controlled). In other words, the subject treated with the drug may be asymptomatic. In an embodiment, the subject treated with the drug is asymptomatic and seropositive. In another embodiment, the subject treated with the drug is asymptomatic and seronegative.

[0152] The drug is administered in a therapeutically effective amount. The induction of such a therapeutic effect can be assessed in vitro (i.e., without cells or in cells) or in vivo (i.e., in animals (e.g., animal models) or patients). It can be assessed at the molecular level and / or at the cellular level.

[0153] "Therapeutic effect" refers in particular to the effects 1) to 5) defined above in relation to the first aspect of the present invention, i.e. these effects are also referred to as therapeutic effects 1) to 5) respectively. Further therapeutic effects are:

[0154] 6) Preventing infection-related cellular effects,

[0155] 7) Relieve infection-related cellular effects,

[0156] 8) preventing disease in infected subjects, and / or

[0157] 9) Slow down, preferably stop, and more preferably reverse disease progression.

[0158] 6) and 7): The cellular effect associated with infection may be cell death (e.g., by apoptosis or cell lysis), and its alleviation will be a reduction in cell death. Such a reduction in cell death may be at least 5% compared to the level of cell death at the beginning of treatment. Preferably, a reduction in cell death means at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 80%, at least 90% or 100%. Cell death can be determined by directly detecting cell death or by detecting cell survival, for example by harvesting cell populations and (immuno)staining cell cycle markers, determining one or more cell cycle stages by FACS analysis or by PCR (for expression levels of cell cycle RNA) with appropriate markers.

[0159] 8) and 9): Whether the disease is prevented or whether the progression is slowed, stopped or reversed can be determined by evaluating symptoms or parameters of the disease associated with polyomavirus infection. Such symptoms are known in the art. For example, to evaluate the progression of kidney disease, parameters (such as glomerular filtration rate or creatinine level) can be determined.

[0160] Additional parameters that may be assessed under 8) or 9) as (molecular) markers for the presence or status or progression of a disease or condition include: cyclin E2 (CCNE2), cell division cycle protein 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51 associated protein-1 (RAD51AP1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1) and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

[0161] Treatment with an oligonucleotide as defined herein may increase downregulation or reduction of at least one of these genes (Abend, J. et al. (2010) Global effects of BKV infection of gene expression in human primary epithelial cells; 397(1):73). In embodiments, downregulation or reduction is induced following infection or reinfection of the cells with BKV.

[0162] In embodiments, downregulation or reduction is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% of the initial expression level of the gene at the beginning of treatment with the oligonucleotide. In embodiments, expression is no longer detectable. Expression can be assessed using techniques known to the skilled person. In embodiments, expression is assessed using Northern blotting or PCR.

[0163] Therefore, in an embodiment, the oligonucleotide, vector or pharmaceutical composition as defined herein can be used as a medicament, preferably for treating polyomavirus infection in a subject, wherein the oligonucleotide, vector or pharmaceutical composition can exhibit at least one of the following effects:

[0164] 1) Regulate the splicing of T antigen pre-mRNA,

[0165] 2) Reduce the production of T antigen mRNA,

[0166] 3) reducing the production of VP1 mRNA, and preferably VP1 protein,

[0167] 4) Inhibit viral replication,

[0168] 5) Limit the ability of the virus to reinfect, that is, limit the ability of infected cells to produce infectious virus particles,

[0169] 6) Preventing infection-related cellular effects,

[0170] 7) Relieve infection-related cellular effects,

[0171] 8) preventing disease in infected subjects, and

[0172] 9) Slow down, preferably stop, and more preferably reverse disease progression.

[0173] In an embodiment, the oligonucleotide, vector or pharmaceutical composition as defined herein is for use as a medicament, preferably for treating a polyomavirus infection in a subject, wherein the disease has been prevented (8) or progression has been slowed, stopped or reversed (9) when at least one parameter of a disease associated with said polyomavirus infection has been reduced, the parameter being selected from the group consisting of: glomerular filtration rate, creatinine level, cyclin E2 (CCNE2), cell division cycle protein 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51 associated protein-1 (RAD51AP1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1) and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

[0174] It is envisaged that the therapeutic effect comprises at least one of the therapeutic effects 1) to 5) as defined above in relation to the first aspect, and preferably also comprises at least one of the therapeutic effects 6) to 9).The effect is assessed by comparison with the state at the start of treatment.

[0175] The subject is preferably a human. Typically, polyomaviruses infect and replicate in a permissive host (i.e., a host that allows the virus to bypass its defenses and replicate, such as an immunocompromised host). This can also be described in terms of immunodeficiency, which is a state in which the immune system is impaired or completely lost in its ability to fight infectious diseases and cancers. This state may be temporary or permanent. In one embodiment, immunodeficiency is acquired ("secondary"), usually due to external factors that affect the patient's immune system. Examples of these external factors include HIV infection, (extreme) age and environmental factors, such as malnutrition. Immunodeficiency can also be induced by drugs, such as glucocorticoids, cytostatics, antibodies, and compounds that act on immunoaffinity proteins (such as calcineurin inhibitors, belatacept (an immunoglobulin-like molecule with an extracellular domain of CTLA-4) and similar molecules). This may be a desired effect, such as in organ transplant surgery as an anti-rejection measure, and in subjects with an overactive immune system, such as in autoimmune diseases. However, sometimes this desired effect has the additional effect of reducing the subject's ability to resist polyomavirus infection. Subjects with any type of immunodeficiency are referred to as immunocompromised. In another embodiment, the immunodeficiency is hereditary. For example, it may be a genetic defect (usually recessive) that affects B-cell or T-cell lymphocyte development, phagocytes, complement, cytokines or their receptors, antibodies, or other components of the innate or adaptive immune system.

[0176] Thus, in an embodiment, the subject is immunocompromised, e.g., due to one of the above factors and / or another infection, cancer, or use of a drug administered to the subject to treat another condition or disease. In one embodiment, the other condition is an organ, tissue, or cell (particularly kidney) transplant. Thus, in one embodiment, the subject is a recipient of an organ, tissue, or cell transplant (also collectively referred to herein as a "transplant").

[0177] exist Fifth Aspect , the present invention relates to ex vivo methods, including ex vivo methods for inhibiting polyomavirus replication in cells and ex vivo methods for producing transplants.

[0178] The ex vivo method of inhibiting polyomavirus replication in a cell comprises (i) providing a cell infected with a polyomavirus and contacting the cell with an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect, or a pharmaceutical composition as defined in the third aspect; or (ii) providing a cell comprising an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect, or a pharmaceutical composition as defined in the third aspect, and contacting the cell with a polyomavirus. The ex vivo method of producing a transplant comprises providing one or more donor organs, tissues or cells (preferably comprising kidney cells), and contacting cells of the one or more donor organs, tissues or cells with an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect, or a pharmaceutical composition as defined in the third aspect.

[0179] General Definition

[0180] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly and generally understood by one of ordinary skill in the art to which this invention belongs and are to be read in light of this disclosure.

[0181] "Nucleobases", sometimes referred to as bases, are typically adenine, cytosine, guanine, thymine or uracil or derivatives thereof. Cytosine, thymine and uracil are pyrimidine bases and are typically attached to the scaffold via their 1-nitrogen. Adenine and guanine are purine bases and are typically attached to the scaffold via their 9-nitrogen. RNA nucleobases as referred to herein are adenine, cytosine, guanine and uracil.

[0182] Unless otherwise indicated, "nucleotides" referred to herein represent RNA nucleotides, preferably naturally occurring RNA nucleotides. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate and uridine monophosphate. They consist of a pentose ribose, a phosphate group connected via a phosphate ester, and a 1'-connected base. Sugars connect bases and phosphates, and are therefore often referred to as scaffolds of nucleotides. Therefore, modifications in pentoses are often referred to as scaffold modifications. Therefore, sugar modifications can be referred to as scaffold modifications. For large modifications (severe modification), the original pentose may be completely replaced by another part that similarly connects bases and phosphates. It is therefore understood that, although pentoses are usually scaffolds, scaffolds are not necessarily pentoses. Nucleotides are usually connected to adjacent nucleotides by condensation of their 5'-phosphate moieties with the 3'-hydroxyl moieties of adjacent nucleotide monomers. Similarly, their 3'-hydroxyl moieties are usually connected to the 5'-phosphates of adjacent nucleotide monomers. This forms a phosphodiester bond. Phosphodiesters and scaffolds form alternating copolymers. Bases are grafted onto the copolymer, i.e., onto the scaffold moiety. Due to this feature, the alternating copolymers formed by the linked monomers of the oligonucleotide are generally referred to as the backbone of the oligonucleotide. Since the phosphodiester bonds connect adjacent monomers together, they are generally referred to as backbone bonds. It should be understood that when the phosphate group is modified to make it a similar part (such as thiophosphate), such a part is still referred to as the backbone bond of the monomer. This is referred to as backbone bond modification. Therefore, generally, the backbone of an oligonucleotide is composed of alternating scaffolds and backbone bonds.

[0183] In the context of oligonucleotides, the term "specifically binds" means that the oligonucleotide is able to anneal to its target. The term "binds" may be replaced by "hybridizes," "targets," "directed against," "antisense to," or "complementary to." Binding of an oligonucleotide to its target pre-mRNA can be assessed using an EMSA (electrophoretic mobility shift assay) using the oligonucleotide and incubating it with polyomavirus RNA.

[0184] When used for oligonucleotides, the term "annealing" is understood to mean the bonding of an oligonucleotide to an at least substantially complementary sequence (for base pairing involving hydrogen bonds), which base pairing may be Watson-Crick, Hoogsteen or reversed Hoogsteen base pairing. Stringent hybridization conditions involve hybridization at 68°C in 5x SSC / 5x Denhardt solution / 1.0% SDS, and washing at room temperature in 0.2x SSC / 0.1% SDS, or equivalent conditions recognized in the art thereof (e.g., hybridization at 60°C in 2.5x SSC buffer, followed by several washing steps at 37°C with low buffer concentrations, and maintaining stable conditions). Moderate conditions involve washing in 3x SSC at 42°C, or equivalent conditions recognized in the art thereof. The parameters of salt concentration and temperature may be varied to achieve an optimal level of identity between the probe and the target nucleic acid. Guidance regarding such conditions is available in the art, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, New York; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, NY) Unit 2.10.

[0185] The hybridization of complementary strands is typically improved along with the length of sequence.The specific hybridization of two chains is realized by the continuous fragment of 12,13,14,15,16,17,18,19 or 20 (preferably 18,19 or 20) or more complementary core bases.The sequence of oligonucleotide can (but not necessarily) be complementary to the target sequence 100% that it will hybridize.In addition, oligonucleotide can hybridize with one or more sections so that in hybridization event, do not relate to interleaving or adjacent sections.For example, oligonucleotide comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence complementarity with the target region in pre-mRNA.For example, in 20 core bases of oligonucleotide, 18 are complementary to the target region and therefore the oligonucleotide of specific hybridization will represent 90% complementarity. When the sequence of an 18-nucleotide oligonucleotide is the reverse complement of a contiguous stretch of at least 12 nucleobases of polyomavirus large T antigen pre-mRNA, the remaining 6 complementary nucleobases may be clustered with or discontinuous with these 12. The percent complementarity of an oligonucleotide to a target pre-mRNA region can be routinely determined using BLAST programs (Basic Local Alignment Search Tool) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0186] Preferably, if the continuous fragment of at least 12 nucleobases of the sequence is at least substantially complementary to the target, the oligonucleotide can anneal with the target. "Substantially complementary" means substantially the same as the reverse complementary sequence of the target sequence. "Substantially identical" means that the oligonucleotide does not need to be 100% identical to the reference sequence and may include mismatches and / or spacers as defined herein. Preferably, substantially identical oligonucleotides (if not 100% identical) include 1 to 3, i.e. 1, 2 or 3 mismatches and / or spacers, preferably one mismatch or spacer per oligonucleotide, so that the expected annealing will not fail due to mismatches and / or spacers. In order to be able to anneal (despite the presence of mismatches and / or spacers), preferably, the oligonucleotide does not include more than 1 mismatch per 10 nucleotides (if the first decimal is 5 or higher, then round up, otherwise round down). As used herein, the term "spacer" refers to a non-nucleotide spacer molecule that, when connecting two nucleotides, increases the distance between the two nucleotides to a distance of about one nucleotide (i.e., the distance that the two nucleotides would be separated if they were connected by a third nucleotide). Non-limiting examples of spacers are inosine, d-uracil, halobases, amino-dT, C3, C12, Spacer 9, Spacer 18, and dSpacer.

[0187] The oligonucleotide may comprise a 3' and / or 5' overhang, ie a continuous stretch of nucleobases which is substantially non-complementary to the target region. Such an overhang does not prevent the oligonucleotide from specifically binding to its target region.

[0188] The terms "complement" and "reverse complement" are used similarly because the complement of a target nucleic acid has a sequence that is the reverse complement of the target sequence, wherein "reverse" reflects that the sequence is usually recited from the 5' end of the nucleic acid.

[0189] "Pre-mRNA" or "pre-mRNA" is an immature single strand of messenger ribonucleic acid (mRNA). Polyomavirus T antigen pre-mRNA is synthesized from a polyomavirus DNA template in the cell nucleus by transcription. Pre-mRNA contains one or more introns, which are spliced ​​during the maturation of pre-mRNA into mRNA. The splicing process removes introns from the transcript and connects exons together. Introns are typically flanked by donor sites (5' end of the intron) and acceptor sites (3' end of the intron). Splice sites are required for splicing and typically include a nearly invariant sequence GU at the 5' end of the intron and a splice acceptor site at the 3' end of the intron, which usually has an invariant AG sequence. The GU and AG sequences and the inserted sequence are spliced ​​out of the pre-mRNA. A feature of polyomavirus T antigen pre-mRNA is that it can be spliced ​​alternatively or not, resulting in the production of at least two, usually 3, 4 or 5 different spliced ​​mRNAs. Viral reproduction depends on the availability of the viral genome, the presence of viral proteins, cellular machinery and, in particular, the delicate interplay between the various stages and components. The splicing process of viral RNA is an important method for regulating the viral reproduction process and affects the levels and possible timing of certain products formed in the cell. The term "splice site" refers to the sequence that defines the splicing locus ("splice sequence").

[0190] As used herein, "capable of being transcribed" means that the DNA nucleobase sequence is identical to the RNA nucleobase sequence, except that the DNA has thymines in place of all the uracils in the RNA.

[0191] With respect to the effects of oligonucleotides, reference herein to "initiating treatment with an oligonucleotide" is intended to include treatment that contacts infected cells with the oligonucleotide. Treatment may be in vitro (eg, cell culture) or in vivo (non-human animal or human) treatment.

[0192] In the broadest sense, "ex vivo" means in vitro. In preferred embodiments, it refers to experiments or measurements performed in or on tissues of an organism in an external environment with minimal variation from natural conditions. Example

[0193] Example 1

[0194] result

[0195] ASO nanowalk and candidate modifications

[0196] Previously, we developed antisense oligonucleotides (ASOs) that target the exon-intron junctions of the BKV early coding region pre-mRNA, which leads to the production of large T antigen, small t antigen, and truncated T antigen mRNA (WO 2019 / 168402). These studies produced several ASOs that showed the ability to attenuate the expression of: 1) large T antigen and VP1 mRNA; 2) VP1 protein; and 3) viral DNA production. In the BKV early coding region pre-mRNA, most 5' ASOs had only 1 nucleobase in the intronic region of the large T antigen sequence, while most 3' ASOs had only 1 nucleobase in the exonic portion of large T antigen exon 1. As Figure 2 As shown, the positioning of the ASOs continuously shifts 2 nucleotides downstream of SEQ ID NO: 1 in the 5' to 3' direction, allowing efficient splicing of the entire exon 1-intron junction with SEQ ID NOs: 1 to 11 (RNA sequences) and the corresponding 2'-OMe modified ASOs (SEQ ID NOs: 12 to 22) described herein. Therefore, for these studies, 11 additional ASOs (SEQ ID NOs: 12 to 22) were generated and screened for activity in human PTEC.

[0197] Surprisingly, these new 2'-OMe-modified ASOs ( Figure 2 ) showed superior targeting activity against large T antigen exon 1 and / or intron donor sites ( Figure 3-4 ).

[0198] This insight was gained through screening studies in human proximal tubule epithelial cells (hPTEC), which resulted in potent efficacy against 1) TAg and VP1 mRNA; 2) VP1 protein; and 3) viral particle production, e.g. Figure 3 Subsequently, we extensively tested various modifications of these lead candidates by replacing 2'OMe-cytosine with 5-methylcytidine (SEQ ID NOs: 26, 30, 34, and 38) and with varying percentages of 2'-methoxy-ethyl (MOE)-modified oligonucleotides (SEQ ID NOs: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37). These studies consistently showed that ASOs with 2'-O-methyl modifications produced the greatest reduction in VP1 protein and BKV DNA replication ( Figure 4). These data, together with our previous studies in which we varied the amount of phosphorothioate incorporated into the ASO backbone, prompted us to continue using fully 2′-OMe and phosphorothioated ASOs.

[0199] ASO targeting BKV limits 'reinfection'

[0200] Based on the observed reduction in viral DNA produced in response to treatment with our BKV-targeting ASOs, we chose to perform 'reinfection' studies. To this end, we treated hPTEC with SEQ ID NO: 26, SEQ ID NO: 17, SEQ ID NO: 34, or SEQ ID NO: 19 and infected these hPTEC with BKV 16 h later. The cells were incubated in culture for 7 days and the conditioned medium containing active and inactive viral particles was harvested. The conditioned medium was then diluted 10-fold and placed on untreated hPTEC. After 72 h, the cells were fixed and immunostained for large T antigen positivity ( Figure 5 ), indicating that the number of large T antigen-positive cells was significantly reduced after treatment with SEQ ID NO: 19 (and HYB_03 (SEQ ID NO: 68)) relative to control cells (left). In addition, the degree of positivity after treatment with SEQ ID NO: 19 (and HYB_03 (SEQ ID NO: 68)) was lower than that observed in control cells (and cells treated with SEQ ID NO: 26 and SEQ ID NO: 17). Figure 6 As shown, evaluation of TAg and VP1 mRNA levels showed the greatest reduction after pre-treatment with SEQ ID NO: 19, as did evaluation of VP1 protein. After treatment with SEQ ID NO: 19, viral DNA levels and the number of reinfected cells were significantly reduced.

[0201] ASO targeting BKV induces aberrant splicing of BKV early coding region pre-mRNA

[0202] Subsequently, we investigated in pRPc cells the ability of our BKV-targeting ASOs to disrupt the proper splicing of the BKV early coding region pre-mRNA. To this end, we administered our ASOs to pRPc cells and harvested RNA 24 h after transfection. Figure 7As shown, these studies showed that cells treated with lipofectamine and scrambled control ASOs did not display altered splicing characteristics (lanes 1-3). In contrast, both HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 resulted in a decrease in large T antigen mRNA levels (product 1) and a shift toward slightly increased small t antigen mRNA (product 3, lanes 4-5). At the same time, there was clear evidence of the presence of aberrant splicing products between products 1 and 3, as well as mRNA products that were smaller than product 1. In addition, we introduced mismatched nucleobases into position 10 of SEQ ID NO: 19 (SEQ ID NO: 39), positions 5 and 10 (SEQ ID NO: 40), and positions 5, 10, and 15 (SEQ ID NO: 41), resulting in a gradual titration of the splicing effect ( Figure 7 , lanes 6-8). These studies clearly demonstrated that SEQ ID NO: 19 mediates the elimination of large T antigen mRNA in a hybridization-dependent manner. Next, we similarly assessed whether SEQ ID NO: 19 designed as a gapmer (RNA-DNA-RNA hybrid antisense oligonucleotide) could lead to similar or higher levels of large T antigen (pre) mRNA degradation in an RNase H-dependent manner. Figure 8 As shown in (lane 3), SEQ ID NO: 19 GapmeR (SEQ ID NO: 42) did not produce an effective reduction in large T antigen mRNA levels (product 1), while additional GapmeRs (SEQ ID NOs: 42 to 45) targeting exon 1 of the early coding region pre-mRNA similarly did not result in a significant reduction in large T or small t antigen mRNA expression levels.

[0203] Exposure of PBMCs to ASOs targeting BKV does not affect viability

[0204] We next assessed whether exposure to increasing levels of BKV-targeting ASOs would affect cell viability by exposing peripheral blood-derived mononuclear cells (PBMCs) to 1 or 10 μM ASO for 48 h. Fig. 9As shown, various controls for cell viability were introduced, including exposure to 65˚C for 30 minutes prior to 48 h of culture (which induces a decrease in cell viability) and treatment with R848 (a TLR3 agonist) to enhance PBMC viability (Doyle SL, et al. (2007), J. Biol Chem. 282 (51): 36953-36960). Exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 (without increasing concentrations) did not appear to affect PBMC viability.

[0205] Exposure of PBMCs to BKV-targeted ASOs results in mild activation of cytokine production

[0206] To control for potential activation of proinflammatory cytokine expression by monocytes and macrophages in response to exposure to increasing levels of BKV-targeting ASOs, we treated PBMCs with 1 or 10 µM ASOs for 48 h and harvested the culture media for multiplex ELISA analysis of cytokine production. Fig.10 and 11 As shown, exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 did not show a significant increase in the production of pro-inflammatory or anti-inflammatory cytokines.

[0207] Coagulation time is not affected by BKV-targeting ASOs

[0208] Sometimes, ASOs are described as affecting the time required for physiological clotting of blood. This could be detrimental to patients receiving oligonucleotide-based therapies, including ASOs targeting BKV following renal transplantation. Therefore, we chose to evaluate whether exposure of blood to increasing concentrations of our BKV-targeting ASOs would increase clotting time by determining the activated partial thromboplastin time (aPTT). To this end, human plasma was collected and exposed to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 at concentrations of 1 and 10 µM. Fig.12 As shown, clotting time was slightly increased upon exposure to higher concentrations of BKV-targeted ASO.

[0209] ASO targeting BKV shows excellent biodistribution in the kidney

[0210] Since BKV is primarily present in the tubular epithelial cells of the kidney (and the bladder epithelium), we conducted four intravenous dosing studies with five candidate ASOs (at a concentration of 40 mg / kg on days 0, 3, 7, and 10, and sacrifice on day 14, Figure 13, left panel) to examine the biodistribution of our BKV-targeting ASOs in the kidney (and specifically in the proximal and distal tubular epithelial cells). As shown in Figure 13 (left and middle images), the oligonucleotide with SEQ ID NO: 19 clearly showed uptake in the proximal tubules, with weak staining observed in the distal compartment of the kidney fragment (Figure 13, right image). We developed a hybrid ELISA (hELISA) probe to determine the levels of SEQ ID NO: 19 in various organs in a quantitative manner. As Fig.14 As shown, these studies indicate that the kidney is the major organ for uptake of SEQ ID NO: 19 (per organ per gram), with uptake being approximately 2.75 times that of the liver and 4 times that of the spleen. These extrarenal organs are widely considered to be excellent reservoirs for ASO uptake, clearly revealing the superior distribution of ASOs in the kidney.

[0211] BKV-targeted ASO therapy does not affect renal or liver function

[0212] In the context of our four intravenous dosing studies (40 mg / kg on days 0, 3, 7, and 10, with sacrifice on day 14), we did not observe any overt signs of renal or hepatic toxicity / injury. Fig.15 As shown, serum levels of creatinine and blood urea nitrogen and urine albumin levels were well within normal ranges after treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19. Similarly, serum levels of aspartate aminotransferase and alanine aminotransferase and their ratios did not produce any evidence of liver toxicity after 4 administrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19.

[0213] BKV-targeted ASO therapy does not cause significant renal injury

[0214] Immunohistochemical staining (for evidence of renal injury) following four administrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 did not show signs of overt / acute renal injury. Preliminary evaluation of KIM-1 and picrosirius red staining did not clearly indicate renal injury or collagen deposition (see Fig.16 ).

[0215] Materials and Methods

[0216] Accession numbers used for phylogenetic analysis

[0217] The complete genome sequences of BK polyomavirus isolates were downloaded from the public NCBI database. From these records, only isolates with reported complete genomes were used for splice site conservation in the large T antigen. The Dunlop strain was used as the reference genome. Isolates "MM" and "FNL-9" were removed due to large deletions in introns or duplications overlapping with the receptor splice sites, respectively. The accession numbers for the 245 unique genome sequences are provided below:

[0218] <h2 style=";text-align:left;direction:ltr">AB211369.1;AB211370.1;AB211371.1;AB211372.1;AB211373.1;AB211374.1;AB211375.1;AB211376.1;AB211377.1;AB211378.1;AB211379.1;AB2 11381.1;AB211382.1;AB211383.1;AB211384.1;AB211385.1;AB211386.1;AB211387.1;AB211388.1;AB211389.1;AB211390.1;AB211391.1;AB21348 7.1;AB217917.1;AB217918.1;AB217919.1;AB217920.1;AB217921.1;AB260028.1;AB260029.1;AB260030.1;AB260031.1;AB260032.1;AB260033.1; AB263912.1;AB263913.1;AB263914.1;AB263915.1;AB263916.1;AB263917.1;AB263918.1;AB263919.1;AB263920.1;AB263921.1;AB263922.1;AB26 3923.1;AB263924.1;AB263925.1;AB263926.1;AB263927.1;AB263928.1;AB263929.1;AB263930.1;AB263931.1;AB263932.1;AB263934.1;AB263935 .1;AB263936.1;AB263938.1;AB269825.1;AB269826.1;AB269827.1;AB269828.1;AB269829.1;AB269830.1;AB269831.1;AB269832.1;AB269834.1;A B269836.1;AB269837.1;AB269838.1;AB269840.1;AB269841.1;AB269842.1;AB269843.1;AB269844.1;AB269845.1;AB269846.1;AB269847.1;AB269 848.1;AB269849.1;AB269850.1;AB269851.1;AB269852.1;AB269853.1;AB269854.1;AB269855.1;AB269856.1;AB269857.1;AB269858.1;AB269859.<h2 style=";text-align:left;direction:ltr">1;AB269860.1;AB269861.1;AB269862.1;AB269863.1;AB269864.1;AB269 865.1;AB269866.1;AB269867.1;AB269868.1;AB269869.1;AB298941.1;AB 298942.1;AB298945.1;AB298946.1;AB298947.1;AB301086.1;AB301087.1;AB301089.1;AB301090.1;AB301091.1;AB301092.1;AB301093.1;AB3010 94.1;AB301095.1;AB301096.1;AB301097.1;AB301099.1;AB301100.1;AB301101.1;AB365130.1;AB365132.1;AB365133.1;AB365134.1;AB365136.1 ;AB365137.1;AB365138.1;AB365139.1;AB365140.1;AB365141.1;AB365142.1;AB365144.1;AB365145.1;AB365146.1;AB365148.1;AB365149.1;AB3 65150.1;AB365151.1;AB365153.1;AB365154.1;AB365156.1;AB365157.1;AB365158.1;AB365159.1;AB365160.1;AB365162.1;AB365164.1;AB36516 5.1;AB365166.1;AB365167.1;AB365168.1;AB365170.1;AB365173.1;AB365174.1;AB365175.1;AB365176.1;AB365178.1;AB369087.1;AB369088.1; AB369089.1;AB369090.1;AB369092.1;AB369093.1;AB369094.1;AB369095.1;AB369096.1;AB369097.1;AB369098.1;AB369099.1;AB369101.1;AB46 4953.1;AB464954.1;AB464956.1;AB464957.1;AB464958.1;AB464960.1;A B464961.1;AB464962.1;AB485695.1;AB485696.1;AB485697.1;AB485698.1;AB485699.1;AB485700.1;AB485701.1;AB485703.1;AB485704.1;AB485707.1;AB485709.1;AB48571 0.1;AB485711.1;AB485712.1;AY628224.1;AY628225.1;AY628226.1;AY628227.1;AY628228.1;AY628 229.1;AY628230.1;AY628231.1;AY628232.1;AY628233.1;AY628234.1;AY628235.1;AY628236.1;AY6 28237.1;AY628238.1;DQ305492.1;EF376992.1;FR720308.1;FR720309.1;FR720310.1;FR720311.1;FR 720312.1; FR720313.1; FR720315.1; FR720317.1; FR720318.1; FR720320.1; FR720321.1; JF894228.1; JN192431.1; JN192432.1; JN192433.1; JN192435.1; JN192437.1; JN192438.1; JN192439.1; ;JQ713822.1;KF055891.1;KF055892.1;KF055893.1;KP412983.1;KP984526.1;KY114802.1;KY114803 .1; KY132094.1; KY487998.1; LC029413.1; LC309239.1; LC309240.1; LT960370.1; M23122.1; V01108.1. .

[0219] Similarly, the complete genome sequences of 13 different prototype human polyomaviruses were downloaded. The accession numbers are as follows:

[0220] NC_001538; NC_001699; NC_009238; NC_009539; NC_010277; NC_014406; NC_014407; NC_014361; NC_015150;

[0221] Conservation of the splice site of the large T antigen

[0222] Whole genome nucleotide sequences from all reference human polyomaviruses were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / nuccore) on February 20, 2018, and aligned with WebPrank (available online at: https: / / www.ebi.ac.uk / goldman-srv / webprank / ) using default settings. A phylogenetic UPGMA tree was constructed, and sequence logos were created for each splice site to show conservation between different human polyomaviruses. All downloaded RefSeq accession numbers are provided below:

[0223] Reference sequences: NC_001538, NC_001699, NC_009238, NC_009539, NC_010277, NC_014406, NC_014407, NC_014361, NC_015150, NC_018102, NC_020106, NC_020890, NC_024118

[0224] The whole genome nucleotide sequences of all human polyomavirus isolates were downloaded from the NCBI website on February 20, 2018. The whole gene sequences of the large T antigen were retrieved only from the unique genome sequences and aligned with WebPrank using default settings. Sequence logos were created for each splice site in the large T antigen to show conservation within and between different human polyomaviruses.

[0225] The accession numbers for all downloads are as follows:

[0226] <h2 style=";text-align:left;direction:ltr">BKPyV: AB211369.1, AB211370.1, AB211371.1, AB211372.1, AB211373.1, AB211374.1, AB211375.1, AB211376.1, AB211377.1, AB211378.1, AB211379 .1, AB211380.1, AB211381.1, AB211382.1, AB211383.1, AB211384.1, AB211385.1, AB211386.1, AB211387.1, AB211388.1, AB211389.1, AB211390.1, AB211391.1, AB213487.1, AB217917.1, AB217918.1, AB217919.1, AB217920.1, AB217921.1, AB260028.1, AB260029.1, AB260030.1, AB260031.1, AB2 60032.1, AB260033.1, AB260034.1, AB263912.1, AB263913.1, AB263914.1, AB263915.1, AB263916.1, AB263917.1, AB263918.1, AB263919.1, AB26392 0.1, AB263921.1, AB263922.1, AB263923.1, AB263924.1, AB263925.1, AB263926.1, AB263927.1, AB263928.1, AB263929.1, AB263930.1, AB263931.1 AB263932.1, AB263933.1, AB263934.1, AB263935.1, AB263936.1, AB263937.1, AB263938.1, AB269822.1, AB269823.1, AB269824.1, AB269825.1, AB 269826.1, AB269827.1, AB269828.1, AB269829.1, AB269830.1, AB269831.1, AB269832.1, AB269833.1, AB269834.1, AB269835.1, AB269836.1, AB269 837.1, AB269838.1, AB269839.1, AB269840.1, AB269841.1, AB269842.1, AB269843.1, AB269844.1, AB269845.1, AB269846.1, AB269847.1, AB269848.<h2 style=";text-align:left;direction:ltr">1、AB269849.1、AB269850.1、AB269851.1、AB269852.1、AB269853.1、AB269 854.1、AB269855.1、AB269856.1、AB269857.1、AB269858.1、AB269859.1、AB 269860.1, AB269861.1, AB269862.1, AB269863.1, AB269864.1, AB269865.1, AB269866.1, AB269867.1, AB269868.1, AB269869.1, AB298940.1, AB2989 41.1, AB298942.1, AB298943.1, AB298944.1, AB298945.1, AB298946.1, AB298947.1, AB301086.1, AB301087.1, AB301088.1, AB301089.1, AB301090.1 、AB301091.1、AB301092.1、AB301093.1、AB301094.1、AB301095.1、AB3010 96.1、AB301097.1、AB301098.1、AB301099.1、AB301100.1、AB301101.1、AB3 01102.1, AB301103.1, AB365130.1, AB365131.1, AB365132.1, AB365133.1, AB365134.1, AB365135.1, AB365136.1, AB365137.1, AB365138.1, AB36513 9.1, AB365140.1, AB365141.1, AB365142.1, AB365143.1, AB365144.1, AB365145.1, AB365146.1, AB365147.1, AB365148.1, AB365149.1, AB365150.1, AB365151.1, AB365152.1, AB365153.1, AB365154.1, AB365155.1, AB365156.1, AB365157.1, AB365158.1, AB365159.1, AB365160.1, AB365161.1, AB36 5162.1, AB365163.1, AB365164.1, AB365165.1, AB365166.1, AB365167.1, AB365168.1, AB365169.1, AB365170.1, AB365171.1, AB365172.1, AB365173.<h2 style=";text-align:left;direction:ltr">1, AB365174.1, AB365175.1, AB365176.1, AB365177.1, AB365178.1, AB369087.1, AB369088.1, AB369089.1, AB369090.1, AB369091.1, AB369092.1, AB 369093.1, AB369094.1, AB369095.1, AB369096.1, AB369097.1, AB369098.1, AB369099.1, AB369100.1, AB369101.1, AB464953.1, AB464954.1, AB4649 55.1、AB464956.1、AB464957.1、AB464958.1、AB464959.1、AB464960.1、AB 464961.1、AB464962.1、AB464963.1、AB485694.1、AB485695.1、AB485696.1 、AB485697.1、AB485698.1、AB485699.1、AB485700.1、AB485701.1、AB4857 02.1、AB485703.1、AB485704.1、AB485705.1、AB485706.1、AB485707.1、AB4 85708.1, AB485709.1, AB485710.1, AB485711.1, AB485712.1, AY628224.1, AY628225.1, AY628226.1, AY628227.1, AY628228.1, AY628229.1, AY62823 0.1, AY628231.1, AY628232.1, AY628233.1, AY628234.1, AY628235.1, AY628236.1, AY628237.1, AY628238.1, DQ305492.1, EF376992.1, FR720308.1 FR720309.1、FR720310.1、FR720311.1、FR720312.1、FR720313.1、FR72031 4.1、FR720315.1、FR720316.1、FR720317.1、FR720318.1、FR720319.1、FR72 0320.1, FR720321.1, FR720322.1, FR720323.1, JF894228.1, JN192431.1, JN192432.1, JN192433.1, JN192434.1, JN192435.1, JN192436.1, JN192437.1. JN192438.1, JN192439.1, JN192440.1, JN192441.1, JQ713822.1, KF055891.1, KF055 892.1, KF055893.1, KP412983.1, KP984526.1, KY114802.1, KY114803.1, KY132094.1, K Y487998.1, LC029411.1, LC029412.1, LC029413.1, LC029414.1, LC309239.1, LC309240 .1, LT934539.1, LT960370.1, M23122.1, MF627830.1, MF627831.1, V01108.1, V01109.1.

[0227] Splice site conservation and phylogenetic trees

[0228] The full gene sequences (including intronic sequences) of the large T antigen of 13 different polyomavirus reference sequences and all unique BK polyomavirus isolates were aligned using clustalW (“msa” package in R). A phylogenetic tree was constructed using the UPGMA method (“phangorn” and “ggtree” packages in R). Sequence markers were constructed for acceptor and donor splice sites to show nucleotide-specific conservation between subtypes (“msa” package in R).

[0229] ASO Design

[0230] Antisense oligonucleotides (ASOs) were designed to target the donor splice site of the BK virus large T antigen (SEQ ID NOs: 1 to 10). Additional ASOs were designed to be derived from SEQ ID NOs: 1 to 10 and have improved chemistry. They contain 2´-O-methyl bases, are 20 nucleotides in length, and are further modified with an all-phosphorothioate backbone (*) and optionally with 5-methylcytidine (positions indicated). The secondary structure and binding energy of the ASOs were predicted using RNA structure. All ASO sequences are shown below:

[0231] Table 3: Oligonucleotides with modified RNA chemistry

[0232]

[0233]

[0234]

[0235] Note: * indicates phosphorothioate bond; Crepresents 5-methylcytidine; oA, oC, oU, oG and oT represent 2'-O-methyl modified RNA; mA, mC, mU, mG, mT represent 2'-methoxyethyl modified RNA; dA, dC, dU, dG, dT represent deoxyribonucleic acid; nA, nC, nU, nG, nT represent locked nucleic acid residues. Here, any modification of C can be applied to C And indicate accordingly.

[0236] Cell culture

[0237] Immortalized proximal tubule kidney epithelial HK2 cells (ATCC ® CRL-2190™) were obtained from ATCC and maintained at 37°C, 5% CO2 in Dulbecco's Modified Eagle's medium-F12 1:1 mixture with 15 mM Hepes, 2.5 mM L-glutamine (Lonza), and supplemented with triiodothyronine, epidermal growth factor (EGF), insulin-transferrin-seleno-ethanolamine (ITS-X), hydrocortisone, and 100 U / mL penicillin-streptomycin. Human proximal tubule epithelial cells (PTEpiC) (Sciencell, #4100) were maintained in complete epithelial cell medium (Sciencell, #4101) consisting of 500 ml basal medium, 2% fetal bovine serum, and 1X epithelial cell growth supplement. hPTEC experiments were performed between passages 4 and 6. pRPc cells, a mouse cell line transformed with the early coding region of BKV (Negrini, M. et al., Cancer Research, 1992), constitutively express the BKV large T antigen. pRPc cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS. All cells were cultured at 37°C and 5% CO2 in the presence of 100 U / mL penicillin, 100 μg / mL streptomycin solution (Invitrogen, Breda, The Netherlands).

[0238] BK polyomavirus (ATCC® VR-837™) was obtained from ATCC and diluted in complete HK2 medium to reduce the infectious load. For treatment experiments, cells were plated at 32,000 cells / cm 2Cells were plated at a density of 100 μg / ml in 6-well or 12-well plates (Corning) and grown overnight. ASO treatment was performed by incubating cells with lipofectamine 3000 (Thermo Fisher) at an ASO concentration of 50 nM for 5 h, and then the lipofectamine was washed off. BK polyomavirus infection was performed 24 h after washing the cells by incubating the cells with medium containing BK polyomavirus for 2 h, and then washing the cells three times to remove excess viral particles. Supernatants were collected after these initial washes and on days 3, 5, and 7 after infection to determine viral particle production using PCR. Viral load samples were collected before infection to determine infectious load. RNA and protein were harvested on day 7 to determine the expression of large T antigen and VP1.

[0239] Viral load determination

[0240] To determine the viral load in the culture supernatant, 200 µL was collected from each well at each time point. Pierce Universal Nuclease was added to each sample to degrade unpackaged DNA for 15 minutes at room temperature and then inactivated with 5 mM EDTA. Viral DNA was isolated from the supernatant using a DNA mini kit (Qiagen) and viral load was determined using Taqman PCR as described below (Wunderink, HF, et al., J. Clin. Virol., 2017).

[0241] To monitor the quality of DNA extraction and potential PCR inhibition, we added a low concentration of phocine herpesvirus to the lysis buffer. DNA was eluted in a final volume of 100 μL of elution buffer, of which 10 μL was used as input for real-time quantitative PCR (qPCR). A 90-bp fragment within the BKPyV VP1 gene was amplified using primers 440BKVs 5′-GAAAAGGAGAGTGTCCAGGG-3′ (SEQ ID NO: 46) and 441BKVas 5′-GAACTTCTACTCCTCCTTTTATTAGT-3′ (SEQ ID NO: 47) and Taqman probe 576BKV-TQ-FAM FAM 5′-CCAAAAAGCCAAAGGAACCC-3′-BHQ1 (SEQ ID NO: 48) (sequence provided by the LUMC Department of Medical Microbiology). BKPyV qPCR and Phococcus herpesvirus PCR were used in dual assays to monitor DNA quality and potential PCR inhibition. In addition, BKPyV qPCR was validated to detect BKPyV genotypes I-IV.

[0242] Quantitative PCR reactions were performed in a total volume of 50 μL, containing 25 μL HotStarTaq master mix (Qiagen, Hilden, Germany), 0.5 μmol / L of each primer, 0.35 μmol / L BKPyV probe, and 3.5 mmol / L MgCl2. Reactions were performed using a CFX96 Real-Time Detection System (Bio-Rad, Hercules, CA, USA) under the following cycling conditions: 15 min at 95°C, followed by 45 amplification cycles (95°C for 30 s; 55°C for 30 s; 72°C for 30 s). For quantification, a standard of quantitative BKPyV-positive urine samples was used. The analytical sensitivity of the BKPyV qPCR was approximately 10 copies / mL. On each plate, three negative controls were included; these controls tested negative in all PCR assays. PCR results with a cycle threshold of ≥ 40 were considered negative.

[0243] Antibodies and Western blotting

[0244] Determine protein concentration using the BCA method. Run samples on 4%-15% TGX gels and transfer them to nitrocellulose or PVDF membranes. The antibodies used were: rabbit polyclonal anti-actin HRP (loading control), rabbit polyclonal anti-SV40 VP1 (ab53977, Abcam), mouse monoclonal anti-SV40 T antigen [PAb416] (ab16879, Abcam), mouse monoclonal anti-SV40 T antigen (PAb108, Thermo Fisher Scientific), rabbit polyclonal anti-SV40 VP1 (Abcam, ab53977), biotinylated Lotus Tetragonolobus Lectin (LTL; Vector Laboratories, B-1325), sheep polyclonal anti-nephrin (AF4269, R&D Systems), purified mouse anti-E-cadherin (Becton Dickinson, 610181), rabbit polyclonal anti-GAPDH (Cell Signaling, Inc. Signalling, D16H11) and rabbit polyclonal anti-phosphorothioate (kindly provided by Dr. Jonathan Watts, University of Massachusetts Medical School). Primary antibodies for large T antigen and VP1 were incubated overnight at 4°C, and primary antibodies for actin were incubated for 30 minutes at room temperature. Secondary antibodies for large T antigen and VP1 were goat polyclonal anti-mouse HRP (P044701-2, Agilent) and goat polyclonal anti-rabbit HRP (P044801-2, Agilent), respectively. In addition, goat anti-rabbit 488 (Life Technologies, A-11008), donkey anti-rabbit 488 (Invitrogen, A21206), donkey anti-rat 647 (Invitrogen, ab150155), donkey anti-sheep 647 (Invitrogen, A21448), donkey anti-mouse IgG2a 647 (Invitrogen, A31571), streptavidin 568 (Invitrogen, S11226), and isotype control rabbit IgG (Dako, X0936) were used. The membrane was incubated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific), and protein bands were visualized using the ChemiDocMP Imaging System (Bio-Rad). Nuclei were counterstained with Hoechst.

[0245] Immunohistochemistry

[0246] After killing mice, mouse kidneys, livers, lungs, spleens, bladders, and hearts were excised and perfused with PBS and fixed in 10% buffered formalin and paraffin embedded. Kidney tissue was cut into 4 μm thick sections and placed on slides. Freshly sectioned sections were dewaxed in xylene for 10 minutes, and then the sections were rehydrated in a graded ethanol series and placed in PBS. Subsequently, the sections were stained for ASO (using antibodies that detect phosphorothioate backbones or by fluorescent in situ hybridization with RNA-based probes), for renal injury, by staining of kidney injury marker-1 (KIM-1) for tubules, or for interstitial collagen, by Sirius red staining.

[0247] Real-time qPCR

[0248] ASO-treated and BKV-infected cells were lysed in Trizol and RNA was isolated using the RNeasy kit (Qiagen). DNase I (Qiagen) treatment was added during the isolation process to remove excess DNA, and cDNA was synthesized using Promega reverse transcriptase, DTT, dNTPs, and random primers. Real-time PCR was performed on a CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad) using SYBR™ Select Master Mix (Thermo Fisher Scientific) and the following primers:

[0249] Table 4: Primers

[0250]

[0251] Activated partial thromboplastin time (aPTT) assay

[0252] Magnetic beads were added to StartMax cuvettes (DiagnosticaStago). Plasma was diluted with Owren-Koller diluent (DiagnosticaStago), and 50 μL of aPTT reagent (TriniClot) was added to each cuvette. Subsequently, 50 μL of diluted plasma containing 5 uL of ASO solution was added to the aPTT reagent and incubated at 37°C for 170 seconds. Next, the cuvettes were placed in a magnetic field, which was activated to activate coagulation. At 180 seconds, 50 μL of 25 mMCaCl2 was added to each cuvette using a repeater pipette, and coagulation time measurements were automatically recorded with each pipetting operation.

[0253] Peripheral blood mononuclear cell cytokine production assay

[0254] PBMCs were thawed and added to the culture medium for 5 minutes and collected by centrifugation. Cells were resuspended and initial viability was assessed by trypan blue exclusion and then diluted to 1.67 x 10 6 cells / mL. Subsequently, negative controls (medium) and positive controls were prepared in culture medium (R848 (Invivogen, USA)). Cytokine production in response to exposure to 1 μM or 10 μM ASO was assessed by adding 20 μL of negative or positive control or appropriate ASO concentration to round-bottom wells, followed by the addition of 180 μL of culture medium containing PBMCs and incubation at 37°C (5% CO2) for 48 h. Subsequently, the culture medium was pipetted into Eppendorf tubes, centrifuged at 1200 rpm for 6 min, and the supernatant was transferred to a custom multiplex ELISA plate to detect GM-CSF, IFN-γ, IL-6, IL-12 (p70 subunit), MIP-1b, TNF-α, G-CSF, IFN-α2, IL-1b, IL-2, IL-10, and IL-17.

[0255] Cell viability was assessed by adding negative or positive control materials or ASOs to flat-bottom wells and 190 μL of culture medium containing PBMCs and incubating for 48 h at 37°C (5% CO2). Subsequently, CellTiter-Blue reagent was added to each well, the wells were mixed and incubated for 4 h, and then fluorescence was measured at 555 / 585 nm.

[0256] Hybrid ELISA (hELISA)

[0257] Tissues harvested from mice were placed in lysis buffer and diluted to non-saturating concentrations. Subsequently, the standard curve and tissue samples were diluted 1:50 in sample buffer by adding 1 µL of the standard curve or tissue sample to 49 µL of sample buffer in a single well of a 96-well plate. Next, 50 μL of probe mix (consisting of 20 nM capture probe and 20 nM detection probe) was added to each well, and the 96-well plate was covered with a photorefractive seal. Next, the probes were hybridized in a thermal cycler at 95°C for 5 minutes, 40°C for 30 minutes, and finally held at 12°C. Next, MSD Gold plates (Mesoscale) were prepared by washing with KPL wash buffer, and the hybridized samples were then transferred from the 96-well plate to the MSD Gold plate (in duplicate). The MSD Gold plate was covered with a photorefractive seal and incubated at room temperature for 30 minutes on an orbital shaker at 650 rpm. Next, each well was washed 3 times with KPL buffer, and 0.5 µg / mL SULFO tag anti-digoxigenin antibody (in 1% Blocker A buffer) was added to each well. The plate was sealed with a photorefractive strip and incubated on an orbital shaker at 650 rpm for 60 minutes. The plate was then washed 3 times with KPL buffer, and MSD Gold buffer was added to each well and the plate was read spectrophotometrically.

[0258] animal

[0259] C57Bl6 wild-type mice were housed in the animal facility of the Leiden University Medical Center animal facility. Mice received food and water ad libitum. For biodistribution and preliminary safety studies, ASO (40 mg / kg) was administered intravenously via the tail vein on days 0, 3, 7, and 10. After sacrifice (day 14), blood (and urine) was collected from each mouse and allowed to stand at room temperature for 30 minutes and then centrifuged at 6,000 rpm at 4°C to collect the upper serum. Creatinine, blood urea nitrogen (BUN or urea), albumin, aspartate aminotransferase (AST), and alanine aminotransferase (ALT) were determined in the Clinical Chemistry Laboratory of LUMC.

[0260] Example 2

[0261] result

[0262] The ASO according to the invention has improved antiviral activity

[0263] To illustrate the antiviral activity of the ASO according to the invention, the antiviral activity of the ASO according to SEQ ID NO: 8 (ASO8) was compared with the antiviral activity of the structurally similar ASOs according to SEQ ID NOs 23 and 24 (ASO23 and ASO24) of WO 2019 / 168402, respectively. ASO23 and ASO24 differ from ASO8 only in that their 20 nucleotide target region in the polyomavirus large T antigen pre-mRNA starts one nucleotide upstream or downstream.

[0264] Human renal proximal epithelial cells (PTEC) were treated with 50 nM ASOs 24 h prior to infection with BKV, and BKV RNA and protein expression was quantified at day 5 post infection. In this in vitro model, treatment with ASO8 resulted in a 93.8% and 96.5% reduction in T-Ag and VP1 mRNA, respectively, relative to untreated controls. These reductions were superior to those achieved with ASO23 (T-Ag: 91.9% and VP1: 92.0%) and ASO24 (T-Ag: 92.4% and VP1: 90.4%). See Fig.17A The improvement provided by ASO8 was confirmed by downstream measurement of VP1 protein expression, which was more effectively suppressed after treatment with ASO8 (92.5%), compared to 80.7% and 89.4% for ASO23 and ASO24, respectively. Fig. 17B Overall, these results indicate that ASO8 is effective in inhibiting BKV replication and is improved compared to structurally similar ASOs. This improvement was completely unexpected given the structural similarity and, therefore, nearly identical target region.

[0265] Materials and Methods

[0266] Transfection and infection of cells

[0267] Human renal proximal epithelial cells (PTECS, Sciencell, catalog number: 4100) were maintained at 37°C and 5% CO2 in REBM basal medium (Lonza, catalog number: CC-3191) supplemented with 0.5% FCS with REGMTM SingleQuotsTM Supplement (Lonza, catalog number: CC-4127, referred to herein as REGM). Prior to transfection, PTECs were plated at 21,000 cells / cm 2Cells were plated at a density of 1:3000 in 12-well plates (Corning, Inc., catalog number: 3512) overnight. Transfection with 50 nM ASO was achieved using Lipofectamine 3000 (Invitrogen, catalog number: L3000075) following the manufacturer’s instructions. After 5 h of incubation, all REGM was replaced with fresh REGM and cells were maintained overnight, after which cells were infected with BKV (ATCC, catalog number: VR-837; diluted 1:3000 from the original stock) for 2 h. REGM containing virus was aspirated and all wells were washed three times before adding fresh REGM. Cells were maintained in culture medium for 5 days after infection, with REGM supplementation on day 3 post infection. Untreated cells served as controls.

[0268] Quantitative real-time PCR

[0269] RNA was isolated using the RNeasy kit (Qiagen, catalog number: 74106) following the manufacturer's instructions with RLT buffer and 1% 2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148-100 mL) and DNase I treatment (Qiagen, catalog number: 1010395). An additional DNA removal step was included after RNA elution to remove any excess BKV DNA using the TURBO DNA-free™ kit (Thermo Fisher Scientific, catalog number: AM1907). cDNA synthesis was performed using M-MLV Reverse Transcriptase (Cat. No. M1708) in M-MLV RT 5X Buffer (Cat. No. M531A), 10 mM dNTP Mix (Cat. No. U1518), RNasin® Ribonuclease Inhibitor (Cat. No. N2518), Oligo (dT) 15 Primer (Cat. No. C110A), and 0.1 M molecular grade DTT (all Promega, Cat. No. Y00147). Quantitative real-time PCR analysis of BKV RNA expression was performed on a CFX Opus Real-Time PCR System (Bio-Rad) using SYBR Select Master Mix (Thermo Fisher Scientific, Catalog No. 4472908) and the following primers according to the table below: T-Ag: GAGGAGGATGTAAAGGTAGCTCA (forward, SEQ ID NO: 70) and ACTGGCAAACATATCTTCATGGC (reverse, SEQ ID NO: 71); VP1: TGCAGGGTCACAAAAAGTGC (forward, SEQ ID NO: 72) and AGCACTCCCTGCATTTCCAA (reverse, SEQ ID NO: 73); GAPDH: ACAACTTTGGTATCGTGGAAGG (forward, SEQ ID NO: 74) and GCCATCACGCCACAGTTTC (reverse, SEQ ID NO: 75). Changes in mRNA expression were determined using the ΔΔCt method.

[0270]

[0271] VP1 protein quantification using Simple Western analysis

[0272] At day 5 post-infection, cells were lysed with 1:100 Pierce Protease and Phosphatase Inhibitor Mini Tablets (Thermo Fisher Scientific, Catalog No. A32959) in RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific, Catalog No. 89901), and protein concentration was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Catalog No. 23225). VP1 protein expression was quantified using the Jess Simple Western System (Biotechne). Briefly, 0.5 mg / mL protein lysate samples were analyzed using a 12-230 kDa separation module (ProteinSimple, Catalog No. SM-W004-1) and an anti-rabbit detection module (ProteinSimple, Catalog No. DM-001). Antibodies were diluted in antibody diluent when required. VP1 protein was detected using 1:20 anti-SV40 VP1 antibody (Abcam, catalog number: ab53977) and 1:20 goat anti-rabbit IgG / HRP (Agilent, catalog number: P044801-2). β-actin expression was used as a loading control, and 1:20 β-actin mouse monoclonal antibody (Cell Signaling Technology, catalog number: #3700S) and 1:20 goat anti-mouse IgG / HRP (Agilent, catalog number: P044701-2) were used as secondary antibodies. The assay consisted of a 30-min separation time at 375 V, followed by a 5-min antibody dilution time, 60-min primary antibody time, and 30-min secondary antibody time. Peak area calculations were performed using the dropped line of the high dynamic range chemiluminescent signal. Peak finding thresholds and widths were adjusted on a capillary-by-capillary basis to ensure proper fitting of the signal.

Claims

1. An oligonucleotide comprising a nucleobase sequence according to one of SEQ ID NOs: 8, 1, 2, 3, 4, 5, 6, 7, 9, 10 and 11 or comprising a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that At least one nucleobase of the SEQ ID NO is replaced with a nucleobase analog having the same base pairing specificity as the replaced nucleobase.

2. The oligonucleotide according to claim 1, wherein the nucleobase sequence of the oligonucleotide consists of a nucleobase sequence according to one of SEQ ID NOs: 1 to 11, or wherein the nucleobase sequence of the oligonucleotide consists of a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that At least one nucleobase of the SEQ ID NO is replaced with a nucleobase analog having the same base pairing specificity as the replaced nucleobase.

3. The oligonucleotide according to claim 1 or 2, wherein the oligonucleotide comprises a modification capable of rendering an RNA duplex resistant to RNase H, wherein the RNA duplex comprises the oligonucleotide and an oligonucleotide complementary thereto (complementary oligonucleotide).

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide comprises a modified internucleotide linkage, preferably a phosphorothioate internucleotide linkage.

5. The oligonucleotide of claim 4, wherein the oligonucleotide comprises a nucleotide sequence according to one of SEQ ID NOs: 12 to 21 or comprises a nucleotide sequence according to SEQ ID NO: 22, preferably wherein the nucleotide sequence of the oligonucleotide consists of a nucleotide sequence according to one of SEQ ID NOs: 12 to 22.

6. The oligonucleotide of claim 5, wherein the oligonucleotide comprises the nucleotide sequence according to SEQ ID NO: 19, preferably wherein the nucleotide sequence of the oligonucleotide consists of the nucleotide sequence according to SEQ ID NO:

19.

7. The oligonucleotide of claim 4, comprising unmodified internucleotide bonds between nucleotides 5 to 16 of SEQ ID NOs: 1 to 11, and modified internucleotide bonds between at least two of the 5'-most nucleotides of the oligonucleotide and between at least two of the 3'-most nucleotides of the oligonucleotide.

8. A vector, preferably a viral vector, comprising (i) an oligonucleotide as defined in any one of claims 1 to 7, (ii) a reverse complementary sequence of an oligonucleotide as defined in claim 1 or 2, or (iii) a DNA capable of being transcribed into an oligonucleotide as defined in claim 1 or 2.

9. A pharmaceutical composition comprising an oligonucleotide as defined in any one of claims 1 to 7 or a vector as defined in claim 8.

10. An oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9 for use as a medicament.

11. An oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9 for use in treating a polyomavirus infection in a subject.

12. The oligonucleotide, vector or pharmaceutical composition for use according to claim 10 or 11, wherein the oligonucleotide, the vector or the pharmaceutical composition is administered to an immunocompromised subject.

13. The oligonucleotide, vector or pharmaceutical composition for use according to claim 12, wherein the immunocompromised subject is a transplant recipient, preferably a kidney transplant recipient.

14. An in vitro method for inhibiting polyomavirus replication in a cell, the method comprising: (i) providing a cell infected with a polyomavirus, and contacting the cell with an oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9; or (ii) providing a cell comprising an oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9, and contacting the cell with a polyoma virus.

15. An ex vivo method for producing a transplant, the method comprising providing one or more donor organs, tissues or cells, preferably comprising kidney cells, and contacting the one or more donor organs, tissues or cells with an oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9.

16. An oligonucleotide as defined in any one of claims 1 to 7, a vector as defined in claim 8 or a pharmaceutical composition as defined in claim 9 for use as claimed in claim 11, 12 or 13, capable of exhibiting at least one of the following effects: 1) Regulate the splicing of T antigen pre-mRNA, 2) Reduce the production of T antigen mRNA, 3) reducing the production of VP1 mRNA, and preferably VP1 protein, 4) Inhibit viral replication, 5) Limit the ability of the virus to reinfect, 6) Preventing infection-related cellular effects, 7) Reduce cellular effects associated with infection, 8) preventing disease in infected subjects, and 9) Slow down, preferably stop, and more preferably reverse disease progression.

17. An oligonucleotide, a vector or a pharmaceutical composition for use as claimed in claim 16, wherein the disease has been prevented (8) or its progression has been slowed, stopped or reversed (9) when at least one parameter of a disease associated with the polyomavirus infection has been reduced, the parameter being selected from the group consisting of: glomerular filtration rate, creatinine level, cyclin E2 (CCNE2), cell division cycle protein 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survival protein (BIRC5), RAD51 associated protein-1 (RAD51AP1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1) and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

Images