Method for producing negative strap RNA virus vector and negative strap RNA virus vector

Abstract

Provided is a method for producing a negative-strand RNA virus vector. In particular, the present invention provides a method for producing a negative strand RNA viral vector in the presence of a PKR inhibitory factor.

Description

Technical Field

[0001] The present invention relates to a method for producing a negative-strand RNA viral vector and the produced negative-strand RNA viral vector. Background Art

[0002] Negative-strand RNA viral vectors represented by Sendai virus vectors may be useful for gene introduction or cytokine induction. Negative-strand RNA viral vectors represented by Sendai virus vectors can be advantageously produced in packaging cells by production from cDNA (Patent Document 1).

[0003] E3L of vaccinia virus is a double-stranded RNA binding protein, and it is reported that it can promote interferon resistance and intracellular proliferation (Non-Patent Document 1). It is disclosed that K3L, E3L, VAI RNA, EBER, σ3, TRBP and their combination are used to inhibit protein kinase R (PKR) in the production of poxvirus or vaccinia virus; and PKR is a double-stranded RNA binding protein (Patent Document 2). It is disclosed that C8L and K3L are pseudosubstrates of protein kinase R (PKR) (Non-Patent Document 2). It is suggested that NS5A or NS5A (1-148) may inhibit the antiviral activity against HCV (Non-Patent Document 3). A method for producing viruses using VAI RNA is disclosed (Patent Document 3).

[0004] Prior art literature

[0005] Patent Literature

[0006] Patent document 1: WO2005 / 071092

[0007] Patent Document 2: WO98 / 040500

[0008] Patent document 3: WO95 / 011983

[0009] Non-patent literature

[0010] Non-patent document 1: T. Shors, et al., Virology, 239:269-276, 1997

[0011] Non-patent document 2: MK Kobayashi et al., Virology, 276:424-434, 2000

[0012] Non-patent document 3: T. Taguchi et al., J. Gen. Virol., 85:959-969, 2004 Summary of the invention

[0013] The present invention provides a method for producing a negative-strand RNA viral vector and the produced negative-strand RNA viral vector.

[0014] The present inventors have found that in a method for producing a negative-strand RNA virus, a PKR-inhibitory factor (e.g., a PKR-inhibitory viral factor, human nc886, human p58 IPK The method of expressing the genomic RNA of a negative-strand RNA virus in packaging cells in the presence of NS5A or NS5A, or a combination thereof, to form a negative-strand RNA virus can increase the amount of virus produced in the packaging cells.

[0015] According to the present invention, for example, the following inventions can be provided.

[0016] (1) A method for producing a negative-strand RNA virus or a viral vector, comprising the following steps:

[0017] The factor is operably linked to a control sequence, preferably a factor encoding a protein kinase R (PKR) inhibitory factor (e.g., a PKR inhibitory viral factor, human nc886, human p58 IPK or NS5A, or a combination thereof) to express the factor and supply it to packaging cells;

[0018] The genomic RNA of a negative-strand RNA virus or viral vector is expressed in a packaging cell to form a negative-strand RNA virus or viral vector in the presence of the above-mentioned factors {for example, the genomic RNA of a negative-strand RNA virus or viral vector is expressed in a packaging cell in the presence of a factor, particularly a PKR-inhibiting factor, such as a PKR-inhibiting viral factor, to form a negative-strand RNA virus or viral vector, wherein the genomic RNA and the above-mentioned PKR-inhibiting factor can be preferably expressed using the DNA described in (13) below}; and

[0019] Recovering the formed negative-strand RNA virus or viral vector,

[0020] Preferably, the virus or viral vector is heterologous to the PKR inhibitory factor, and / or the control sequence is heterologous to the PKR inhibitory factor.

[0021] (2) The method according to (1) above, wherein the negative-strand RNA virus or viral vector is a Sendai virus vector.

[0022] (3) The method according to (1) or (2) above, wherein the PKR inhibitory factor is selected from adenovirus VAI RNA, Epstein-Barr virus EBER, human nc886, HIV virus TAR, polio virus 2A pro , E3L of vaccinia virus, δ3 of reovirus, NS1 of influenza virus, human p58 IPK, NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus and ICP34.5 of herpes simplex virus, and one or more of the group consisting of their orthologs.

[0023] (4) The method according to any one of (1) to (3) above, wherein the minus-strand RNA virus or viral vector is produced in the absence of a helper virus.

[0024] (5) The method according to any one of (1) to (4) above, wherein the genomic RNA further comprises a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0025] (6) The method according to any one of (1) to (5) above, wherein the packaging cell comprises genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0026] (7) The method according to any one of (1) to (6) above, wherein the packaging cell is a Vero cell or LLC-MK2 cell.

[0027] (8) The method according to any one of (1) to (7) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and the cell population does not contain other cells.

[0028] (9) An RNA genome of a negative-strand RNA virus or a viral vector, which expressibly contains one or more genes encoding any one of the PKR inhibitory factors.

[0029] (10) A negative-strand RNA virus or viral vector comprising the RNA genome described in (9) above.

[0030] (11) The negative-strand RNA virus or viral vector according to (10) above, further comprising a target gene.

[0031] (12) A composition comprising the negative-strand RNA virus or viral vector described in (10) or (11) above.

[0032] (13) A DNA encoding the RNA genome described in (9) above.

[0033] (14) A gene expression vector comprising the DNA described in (13) above operably linked to a control sequence.

[0034] (15) The composition according to (12) above, wherein the infection titer is 1×10 5CIU / mL and above.

[0035] (16) The composition according to (12) above, wherein the infection titer is 1×10 6 CIU / mL and above.

[0036] (17) The composition according to (12) above, wherein the infection titer is 1×10 7 CIU / mL and above.

[0037] (18) The method according to any one of (1) to (8) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.

[0038] (19) The negative-strand RNA virus or viral vector according to any one of (9) to (11) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.

[0039] (20) The composition according to (12) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.

[0040] (21) The DNA according to (13) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.

[0041] (22) The gene expression vector according to (14) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.

[0042] (23) A method according to any one of (1) to (8) above, wherein the step of expressing the factor is carried out by introducing a plasmid vector having a gene encoding the factor operably linked to a first control sequence into a packaging cell.

[0043] (24) A method according to any one of (1) to (8) above, wherein the step of expressing the genomic RNA is carried out by introducing a plasmid vector having a gene encoding the genomic RNA operably linked to a second control sequence into a packaging cell.

[0044] (25) The method according to any one of (1) to (8) above, wherein the step of expressing the factor is carried out by introducing a plasmid vector having a gene encoding the factor operably linked to a first control sequence into a packaging cell, and

[0045] The step of expressing the genomic RNA is performed by introducing a plasmid vector having a gene encoding the genomic RNA operably linked to a second control sequence into a packaging cell.

[0046] (26) A method according to any one of (1) to (8) above, wherein the step of forming a negative-strand RNA virus or a viral vector includes the following steps: introducing a plasmid having a gene encoding viral genomic RNA operably linked to a second control sequence and a plasmid having a gene encoding viral constituent elements operably linked to a third control sequence into a packaging cell, and expressing the genomic RNA and viral constituent elements in the cell.

[0047] (27) The method according to (26) above, wherein the third control sequence is the EF1α promoter, and the viral constituents include either or both of the N protein and the L protein.

[0048] (28) The method according to (26) above, wherein the third control sequence is the EF1α promoter, and the viral constituent elements are one or more or all of the constituent elements selected from the group consisting of N protein, P protein and L protein.

[0049] (29) The method according to (28) above, wherein the packaging cells are Vero cells.

[0050] (30) The method according to (26) above, wherein the third control sequence is the EF1α promoter, and the viral constituents include either or both of the P protein and the L protein.

[0051] (31) The method according to (26) above, wherein the third control sequence is the EF1α promoter and the viral constituent element is the L protein.

[0052] (32) The method according to (30) above, wherein the packaging cells are LLC-MK2 cells.

[0053] (33) The method according to (31) above, wherein the packaging cells are LLC-MK2 cells.

[0054] (34) The method according to any one of the above, wherein the PKR inhibitory factor comprises:

[0055] (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L; and

[0056] (ii) K3L.

[0057] (35) The method according to any one of the above, wherein the PKR inhibitory factor comprises:

[0058] (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L; and

[0059] (iii)Y3.

[0060] (36) The method according to (34) above, wherein the PKR inhibitory factor further comprises VAI.

[0061] (37) The method according to (35) above, wherein the PKR inhibitory factor further comprises VAI.

[0062] (38) A method according to any one of the above, wherein the PKR inhibitory factor contains VAI, and VAI is a molecule having the sequence set forth in SEQ ID NO: 17.

[0063] (39) The method according to any one of the above, wherein the PKR inhibitory factor contains VAI, and the PKR inhibitory factor is a molecule having the sequence set forth in SEQ ID NO: 19.

[0064] (40) The method according to any one of the above, wherein the PKR inhibitory factor is a molecule having a sequence as set forth in any one of SEQ ID NOs: 18 and 21 to 26.

[0065] (41) The method according to any one of the above, wherein the PKR inhibitory factor contains nc886.

[0066] (42) The method according to any one of the above, wherein the PKR inhibitory factor is a molecule having the sequence set forth in SEQ ID NO: 13 or 14.

[0067] (43) The method according to (5) above, wherein the genomic RNA has a gene encoding the target protein, the PKR inhibitory factor is VAI or an RNA molecule having a sequence recorded in any one of sequence numbers 17 to 26, and VAI is contained in the 3'UTR of the gene encoding the target protein.

[0068] (44) The method according to any one of the above (43), wherein the packaging cell comprises genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0069] (45) The method according to (44) or (45) above, wherein the packaging cells are Vero cells or LLC-MK2 cells.

[0070] (46) The method according to any one of (44) to (46) above, wherein the packaging cells are a cell population composed of Vero cells or a cell population composed of LLC-MK2 cells, and the cell population does not contain other cells.

[0071] (47) According to the RNA genome described in (9) above, it has a gene encoding a target protein, and the PKR inhibitory factor is VAI or an RNA molecule having a sequence recorded in any one of sequence numbers 17 to 26, and VAI or an RNA molecule having a sequence recorded in any one of sequence numbers 17 to 26 is contained in the 3'UTR of the gene encoding the above-mentioned target protein.

[0072] (48) A negative-strand RNA virus or viral vector comprising the RNA genome described in (47) above.

[0073] (49) A method for producing a negative-strand RNA virus or a viral vector, comprising the following steps:

[0074] expressing NS5A from a gene encoding the factor operably linked to control sequences and supplied to packaging cells;

[0075] Expressing the genomic RNA of the negative-strand RNA virus or viral vector in the packaging cell in the presence of NS5A to form the negative-strand RNA virus or viral vector; and

[0076] Recovering the formed negative-strand RNA virus or viral vector,

[0077] The above-mentioned virus or viral vector is heterologous to the above-mentioned NS5A, and / or the above-mentioned control sequence is heterologous to the above-mentioned NS5A.

[0078] (50) A method for producing a negative-strand RNA virus or a viral vector, comprising the following steps:

[0079] The PKR inhibitory factor is expressed by a gene encoding the factor operably linked to a control sequence and supplied to the packaging cell. Here, the PKR inhibitory factor is human nc886 (VTRNA2-1) and human p58 IPK Either or both of

[0080] Expressing the genomic RNA of the negative-strand RNA virus or viral vector in the packaging cell in the presence of the above-mentioned PKR inhibitory factor to form the negative-strand RNA virus or viral vector; and

[0081] Recovering the formed negative-strand RNA virus or viral vector,

[0082] Here, the relationship between the control sequence and the PKR inhibitory factor may be heterologous.

[0083] (51) The method according to (49) or (50) above, wherein the negative-strand RNA virus or viral vector is a Sendai virus vector.

[0084] (52) The method according to any one of (49) to (51) above, wherein the genomic RNA further comprises a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0085] (53) The method according to any one of (49) to (52) above, wherein the packaging cell comprises genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0086] (54) The method according to any one of (49) to (53) above, wherein the packaging cell is a Vero cell or LLC-MK2 cell.

[0087] (55) The method according to any one of (49) to (54) above, wherein the packaging cells are a cell population composed of Vero cells or a cell population composed of LLC-MK2 cells, and the cell population does not contain other cells.

[0088] (56) An RNA genome of a negative-strand RNA virus or a viral vector, which expressibly contains any one or more genes encoding PKR inhibitory factors.

[0089] (57) A negative-strand RNA virus or viral vector comprising the RNA genome described in (56) above.

[0090] (58) The negative-strand RNA virus or viral vector according to (57) above, further comprising a target gene.

[0091] (59) A composition comprising the negative-strand RNA virus or viral vector described in (57) or (58) above.

[0092] (60) A DNA encoding the RNA genome described in (56) above.

[0093] (61) A gene expression vector comprising the DNA described in (60) above operably linked to a control sequence.

[0094] (71) A gene expression vector, which is a gene expression vector (preferably a plasmid) of the RNA genome containing a control sequence (preferably a promoter sequence), a first DNA and a second DNA in sequence, wherein:

[0095] The first DNA encodes the RNA genome of the RNA virus,

[0096] The second DNA encodes a protein kinase R (PKR) inhibitory factor (for example, a PKR inhibitory viral factor (preferably VAI RNA, EBER, nc886 and TAR, and their orthologs)),

[0097] A region containing the first DNA and the second DNA that are linked together is formed, the region being operably linked to a control sequence, whereby the first DNA and the second DNA are transcribed into one RNA.

[0098] (72) The gene expression vector according to (71) above, wherein the protein kinase R (PKR) inhibitory factor is VAI.

[0099] (73) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA.

[0100] (74) The gene expression vector according to (72) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA.

[0101] (75) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the control sequence and the first DNA.

[0102] (76) The gene expression vector according to (72) above, further comprising a self-cleaving ribozyme sequence between the control sequence and the first DNA.

[0103] (77) The gene expression vector according to (73) above, further comprising a self-cleaving ribozyme sequence between the control sequence and the first DNA.

[0104] (78) The gene expression vector according to (74) above, further comprising a self-cleaving ribozyme sequence between the control sequence and the first DNA.

[0105] (79) According to any one of the above inventions, the VAI RNA may have a sequence that is a part of SEQ ID NOs: 19, 20, and 23 to 26 and contains the nucleotide sequence described in SEQ ID NO: 17.

[0106] (80) An invention according to any one of the above, wherein the VAI RNA has a sequence that is a part of sequence numbers 19, 20, and 23 to 26 and corresponds to a sequence containing the nucleotide sequence recorded in sequence number 17, and contains (i) VAI RNA and (ii) either or both of the sequence on the 5' side and the sequence on the 3' side of the VAI RNA.

[0107] (91) A packaging cell for a negative-strand RNA virus or viral vector, which has a gene encoding a protein kinase R (PKR) inhibitory factor operably linked to a control sequence.

[0108] (92) Use of a packaging cell having a gene encoding a protein kinase R (PKR) inhibitory factor operably linked to a control sequence for producing a negative-strand RNA virus or a viral vector.

[0109] (93) The packaging cell according to (91) above, wherein the negative-strand RNA virus or viral vector is a Sendai virus vector.

[0110] (94) The use according to (92) above, wherein the negative-strand RNA virus or viral vector is a Sendai virus vector.

[0111] (95) The packaging cell according to (91) or (93) above, wherein the PKR inhibitory factor is selected from adenovirus VAI RNA, Epstein-Barr virus EBER, human nc886, HIV virus TAR, polio virus 2A pro , E3L of vaccinia virus, δ3 of reovirus, NS1 of influenza virus, human p58 IPK , NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus and ICP34.5 of herpes simplex virus, and one or more of the group consisting of their orthologs.

[0112] (96) The use according to (92) or (94) above, wherein the PKR inhibitory factor is selected from adenovirus VAI RNA, Epstein-Barr virus EBER, human nc886, HIV virus TAR, polio virus 2A pro , E3L of vaccinia virus, δ3 of reovirus, NS1 of influenza virus, human p58 IPK , NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus and ICP34.5 of herpes simplex virus, and one or more of the group consisting of their orthologs.

[0113] (97) A packaging cell according to any one of (91), (93) and (95) above, wherein the packaging cell comprises genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0114] (98) The use according to any one of (92), (94) and (96) above, wherein the packaging cell comprises genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a control sequence.

[0115] (99) The packaging cell according to any one of (91), (93), (95) and (97) above, wherein the packaging cell is a Vero cell or LLC-MK2 cell.

[0116] (100) The use according to any one of (92), (94), (96) and (98) above, wherein the packaging cells are Vero cells or LLC-MK2 cells.

[0117] (101) A packaging cell according to any one of (91), (93), (95), (97) and (99) above, wherein the packaging cell is a cell group composed of Vero cells or a cell group composed of LLC-MK2 cells, and the cell group does not contain other cells.

[0118] (102) The use according to any one of (92), (94), (96), (98) and (100) above, wherein the packaging cells are a cell group composed of Vero cells or a cell group composed of LLC-MK2 cells, and the cell group does not contain other cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0119] Figure 1A The secondary structure of VAI RNA. The arrow indicates the 74th base.

[0120] Figure 1B The sequence containing VAI RNA and its mutation introduction sequence.

[0121] Figure 2 Results of an experiment to confirm the reconstitution efficiency of negative-strand RNA viral vectors produced in the presence or absence of VAI.

[0122] Figure 3 To confirm Figure 2 Results of experiments on the infectious titer of negative-strand RNA viral vectors produced in .

[0123] Figure 4 Results of an experiment to confirm the reconstitution efficiency of negative-strand RNA viral vectors produced in the presence or absence of nc886.

[0124] Figure 5 The results of an experiment to confirm the reconstitution efficiency of negative-strand RNA viral vectors produced in the presence or absence of PKR-inhibiting viral factors.

[0125] Figure 6 To confirm Figure 5 Results of experiments on the infectious titer of negative-strand RNA viral vectors produced in .

[0126] Figure 7 Results of an experiment to confirm the reconstitution efficiency of negative-strand RNA viral vectors produced in the presence or absence of a fusion sequence of a PKR inhibitor.

[0127] Figure 8 These are the results of experiments in which expression promoters were compared using LLC-MK2-F cells and the reconstruction efficiency of minus-strand RNA viral vectors produced in the presence or absence of a PKR inhibitor was confirmed.

[0128] Fig. 9 These are the results of experiments conducted using Vero-F cells to compare promoters for expression and to confirm the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a PKR inhibitor.

[0129] Fig.10 Results of an experiment to confirm the reconstitution efficiency of negative-strand RNA viral vectors produced in the presence or absence of various PKR inhibitors.

[0130] Fig.11 To confirm Fig.10 Results of experiments on the infectious titer of negative-strand RNA viral vectors produced in .

[0131] Fig.12 Results of an experiment to confirm the reconstitution efficiency of minus-strand RNA viral vectors produced with or without a PKR inhibitor in the viral genome.

[0132] Fig.13 To confirm Fig.12 Results of experiments on the infectious titer of negative-strand RNA viral vectors produced in .

[0133] Fig.14 This is a result of confirming the reconstitution efficiency of a negative-strand RNA viral vector using VAI RNA extending to the 5' and 3' sides.

[0134] Fig.15 The results show the effect of the introduction of hammerhead ribozyme between the T7 promoter and the DNA encoding the SeV genome on the SeV reconstruction efficiency using packaging cells stably expressing a PKR inhibitory factor.

[0135] Fig.16 The effects of introducing hammerhead ribozyme between T7 promoter and DNA encoding SeV genome and introducing HDV ribozyme between DNA encoding SeV genome and VAI RNA on SeV reconstruction efficiency are shown.

[0136] Fig.17 The results of a PCR experiment showing that HDV ribozyme self-cleaves VAI RNA from the SeV genome.

[0137] Fig.18 The results show the effect of introduction of VAI (330 bp) 74c into the SeV reconstruction plasmid on the SeV reconstruction efficiency.

[0138] Fig.19 The results show the effect of the combined use of VAI (330 bp) 74c introduced into the SeV reconstruction plasmid and E3Y3 on the SeV reconstruction efficiency.

[0139] Fig. 20 The results show the effect of the combined use of VAI (330 bp) 74c introduced into the SeV reconstruction plasmid and E3Y3 on the infection titer of SeV.

[0140] Fig.21A Shown are maps of the pCAG-SeV and pEF1-SeV constructs used in the experiments.

[0141] Fig. 21B The reconstitution efficiencies of pCAG-SeV and pEF1-SeV are shown.

[0142] Fig. 22 The effect of VAI RNA on the reconstruction efficiency of mumps virus (MuV; genus Mumps virus, family Paramyxoviridae) is shown.

[0143] Fig.23 The effect of VAI RNA on the reconstruction efficiency of measles virus (MeV; Morbillivirus, Paramyxoviridae).

[0144] Fig.24 The effect of E3Y3 on the reconstitution efficiency of vesicular stomatitis virus (VSV; genus Vesiculovirus, family Rhabdoviridae) is shown.

[0145] Fig.25 The figure shows the reconstitution efficiency of SeV, MeV, and MuV using heterologous RNA polymerases.

[0146] Fig.26 Shown is the reconstitution efficiency of VSV using a heterologous RNA polymerase.

[0147] Fig.27A Shown is a map of the p3vLPNP construct used in the experiments.

[0148] Fig.27B The results of SeV reconstitution using pCAG-SeV or pEF1-SeV and p3vLPNP are shown.

[0149] Fig.28A Shown is a map of the p3vLPT7NP construct used in the experiments.

[0150] Fig.28B The diagram of pEF-T7-SeV+GOI / dF-Hv (pEF-T7) used in the experiment is shown. The position of the target gene (GOI) can be changed to any position (e.g., + position, PM position, MHN position, HNL position, etc.). It is also possible to further carry the F gene to make SeV autonomously replicating. In this case, F-expressing cells may not be used, and for example, clinical vaccine manufacturing cells may be used as packaging cells.

[0151] Fig.28C The results of SeV reconstruction using a combination of p3vLPNP or p3vLPT7NP and pEF1-SeV or pEF-T7 are shown. The upper picture shows the reconstruction results using LLC-MK2-F cells, the middle picture shows the reconstruction results using Vero-F cells, and the lower picture shows the reconstruction efficiency of SeV in LLC-MK2-F cells.

[0152] Fig.29A The structure of a vector for producing packaging cells carrying F and the factors of the present invention is shown.

[0153] Fig.29B Show use Fig.29A The cells obtained by expressing the described vector and Cre recombinase were found to proliferate SeV-Cre well in the cells. DETAILED DESCRIPTION

[0154] In this specification, "negative-strand RNA virus vector" refers to a recombinant virus obtained by transforming a virus having a negative-strand RNA as a genome (i.e., a negative-strand RNA virus) into a target gene introduction virus. As negative-strand RNA viruses, Orthomyxoviridae (orthomyxoviruses such as influenza virus), Paramyxoviridae (paramyxoviruses such as measles virus), Rhabdoviridae (rhabdoviruses such as rabies virus), Filoviridae (filamentous viruses such as Ebola virus and Marburg virus), and Bunyaviridae (Bunyaviruses such as Hantaan virus) can be listed. As paramyxoviruses, viruses of the subfamily Paramyxovirinae can be listed. As viruses of the subfamily Paramyxovirinae, viruses of the genus Respirovirus, such as Sendai virus, can be listed.

[0155] In this specification, "protein kinase R" (PKR) is a protein phosphorylase that can be activated by double-stranded RNA. PKR is encoded by the EIF2AK2 gene in humans. PKR contains a double-stranded RNA binding domain on the N-terminal side and a kinase domain on the C-terminal side. The kinase domain has a cell apoptosis induction function. PKR dimerizes by binding to double-stranded RNA, and then causes autophosphorylation and activation. Activated PKR phosphorylates the eukaryotic translation initiation factor eIF2α. By phosphorylation of eIF2α, the translation of mRNA in the cell can be inhibited. Activated PKR can also induce cell apoptosis in cells to prevent the spread of viruses. Some viruses have factors that counteract PKR (i.e., PKR-inhibiting viral factors). For example, some types of viruses produce decoy RNA that binds to PKR to prevent activation. As decoy RNA, VAI RNA of adenovirus (e.g., a sequence recorded in sequence number 17), EBER of Epstein-Barr virus (e.g., a sequence recorded in sequence number 4), and TAR of HIV (e.g., a sequence recorded in sequence number 5) can be listed. As a molecule that induces PKR degradation, poliovirus 2A is known pro (For example, a sequence as recorded in sequence number 6). For RNA factors, a terminator (for example, a T7 terminator for T7 polymerase) can be connected to the 3' end of the nucleotide encoding the RNA. As factors that mask the double-stranded RNA of the virus and prevent PKR activation, E3L of vaccinia virus (for example, a sequence as recorded in sequence number 7), σ3 of reovirus (for example, a sequence as recorded in sequence number 8), Us11 of herpes simplex virus (for example, a sequence as recorded in sequence number 29), and NS1 of influenza virus (for example, a sequence as recorded in sequence number 28) can be listed. As pseudosubstrates, K3L of vaccinia virus (for example, a sequence as recorded in sequence number 10) and Tat of HIV (for example, a sequence as recorded in sequence number 11) can be listed. As molecules that induce dephosphorylation of substrates, ICP34.5 of herpes simplex virus (for example, a sequence as recorded in sequence number 12) can be listed. These factors are PKR-inhibiting viral factors. These factors can be natural types.

[0156] In this specification, "nc886" is a non-coding RNA, also known as VTRNA2-1, CBL3 and hvg-5. nc886 acts as a direct inhibitor of PKR. nc886 may have, for example, the sequence described in SEQ ID NO: 13. In this specification, "p58 IPK " is a protein that was discovered as a cytoplasmic protein and acts as a PKR inhibitor. p58 IPK For example, human p58 IPK , may have, for example, the sequence of SEQ ID NO: 9. These factors may be natural types.

[0157] In this specification, "NS5A" is a non-structural protein possessed by hepatitis C virus (HCV). NS5A is a phosphorylated protein and is generally considered to be necessary for the genome replication of HCV. In addition, NS5A (for example, a sequence having sequence number 15) can inhibit the antiviral activity against HCV and encephalomyocarditis virus (refer to Medical Journal of Kobe University, 2003, 64 (1 / 2): 7-15). NS5A can be missing its C-terminal side (for example, after the 149th amino acid). For example, NS5A can be NS5A (1-148) having amino acids 1 to 148 (for example, a sequence having sequence number 16). These factors can be natural.

[0158] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 17, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, replaced, inserted, and / or added in the sequence recorded in sequence number 17, or (iii) a nucleic acid containing a sequence having a consistency of 90% or more or 95% or more with the sequence recorded in sequence number 17, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). According to the embodiments described below, by inhibiting PKR in packaging cells, the reconstruction rate of the virus is improved. Therefore, the inhibited PKR is preferably the animal species from which the packaging cells are derived. For example, Vero cells are from African green monkeys, and LLC-MK2 cells are from rhesus monkeys. Therefore, it is preferred to inhibit the PKR of African green monkeys and rhesus monkeys in these cells, respectively.

[0159] In a preferred embodiment, the VAI RNA may have a sequence on the 5' side of the VAI RNA added to its 5' end. In a preferred embodiment, the VAI RNA may be extended to the 5' side in a manner that includes an adjacent region on the 5' side. As the sequence added to the 5' end, the sequences at positions 1 to 84 of sequence numbers 19, 20, and 23 to 26 or a portion thereof that exists continuously with the VAI RNA may be cited. For example, the VAI RNA may have the nucleotide sequence recorded in sequence number 34.

[0160] In a preferred embodiment, the VAI RNA may have a sequence on the 3' side of the VAI RNA added to its 3' end. In a preferred embodiment, the VAI RNA may be extended to the 3' side in a manner that includes an adjacent region on the 3' side. As the sequence added to the 3' end, the sequences at positions 265 to 330 of sequence numbers 19, 20, and 23 to 26 or a portion thereof that exists continuously with the VAI RNA may be cited. For example, the VAI RNA may have the nucleotide sequence recorded in sequence number 35.

[0161] In a preferred embodiment, the VAI RNA may have a sequence on the 5' side of the VAI RNA added to its 5' end, and a sequence on the 3' side of the VAI RNA added to its 3' end. In a preferred embodiment, the VAI RNA may be extended to the 5' side and the 3' side in a manner that includes an adjacent region on the 5' side and an adjacent region on the 3' side, respectively. As the sequence added to the 5' end, the sequences at positions 1 to 84 of sequence numbers 19, 20, and 23 to 26, or a portion thereof that is continuous with the VAI RNA, may be listed. As the sequence added to the 3' end, the sequences at positions 265 to 330 of sequence numbers 19, 20, and 23 to 26, or a portion thereof that is continuous with the VAI RNA, may be listed.

[0162] In a preferred embodiment, VAI RNA may have a sequence that is a part of SEQ ID NOs: 19, 20, and 23 to 26 and corresponds to a sequence containing the nucleotide sequence recorded in SEQ ID NO: 17, and the sequence contains (i) VAI RNA, and (ii) either or both of the sequence on the 5' side and the sequence on the 3' side of VAI RNA. For example, VAI RNA may have a sequence that is a part of SEQ ID NOs: 19, 20, and 23 to 26 and contains the nucleotide sequence recorded in SEQ ID NO: 17.

[0163] In one embodiment, EBER can be (i) a nucleic acid containing the sequence recorded in sequence number 4, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 4, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 4, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0164] In one embodiment, TAR can be (i) a nucleic acid containing the sequence recorded in sequence number 5, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 5, or (iii) a nucleic acid containing a sequence with an identity of more than 90% or more than 95% with the sequence recorded in sequence number 5, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0165] In one method, 2A proIt can be (i) a peptide containing the sequence recorded in sequence number 6, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in sequence number 6, or (iii) a peptide containing a sequence whose identity with the sequence recorded in sequence number 6 is 90% or more or 95% or more, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0166] In one embodiment, E3L can be (i) a peptide containing the sequence recorded in SEQ ID NO: 7, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in SEQ ID NO: 7, or (iii) a peptide containing a sequence having an identity of 90% or more or 95% or more to the sequence recorded in SEQ ID NO: 7, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0167] In one embodiment, σ3 can be (i) a peptide containing the sequence recorded in sequence number 8, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 8, or (iii) a peptide containing a sequence whose identity with the sequence recorded in sequence number 8 is greater than 90% or greater than 95%, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0168] In one way, p58 IPK It can be (i) a peptide containing the sequence recorded in sequence number 9, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in sequence number 9, or (iii) a peptide containing a sequence whose identity with the sequence recorded in sequence number 9 is 90% or more or 95% or more, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0169] In one embodiment, K3L can be (i) a peptide containing the sequence recorded in sequence number 10, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 10, or (iii) a peptide containing a sequence whose identity with the sequence recorded in sequence number 10 is 90% or more or 95% or more, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0170] In one embodiment, Tat can be (i) a peptide containing the sequence recorded in SEQ ID NO: 11, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in SEQ ID NO: 11, or (iii) a peptide containing a sequence having an identity of 90% or more or 95% or more to the sequence recorded in SEQ ID NO: 11, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0171] In one embodiment, ICP34.5 can be (i) a peptide containing the sequence recorded in SEQ ID NO: 12, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in SEQ ID NO: 12, or (iii) a peptide containing a sequence whose identity with the sequence recorded in SEQ ID NO: 12 is 90% or more or 95% or more, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0172] In one embodiment, nc886 can be (i) a nucleic acid containing the sequence recorded in sequence number 13, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 13, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 13, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0173] In one embodiment, nc886 can be (i) a nucleic acid containing the sequence recorded in sequence number 14, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 14, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 14, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0174] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 18, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 18, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 18, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0175] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 19, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 19, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 19, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0176] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 20, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 20, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 20, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0177] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 21, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 21, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 21, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0178] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 22, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 22, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 22, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0179] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 23, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 23, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 23, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0180] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 24, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 24, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 24, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0181] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 25, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 25, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 25, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0182] In one embodiment, VAI RNA can be (i) a nucleic acid containing the sequence recorded in sequence number 26, (ii) a nucleic acid consisting of a sequence in which 1, 2, 3, 4, or 5 nucleic acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 26, or (iii) a nucleic acid containing a sequence that is 90% or more or 95% identical to the sequence recorded in sequence number 26, or (iv) a fragment thereof, and can be a nucleic acid having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0183] In one embodiment, NS1 can be (i) a peptide containing the sequence recorded in SEQ ID NO: 28, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence recorded in SEQ ID NO: 28, or (iii) a peptide containing a sequence whose identity with the sequence recorded in SEQ ID NO: 28 is 90% or more or 95% or more, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0184] In one embodiment, Us11 can be (i) a peptide containing the sequence recorded in sequence number 29, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted and / or added in the sequence recorded in sequence number 29, or (iii) a peptide containing a sequence whose identity with the sequence recorded in sequence number 29 is greater than 90% or greater than 95%, or (iv) a fragment thereof, and can be a peptide having the function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0185] In one embodiment, E3K3 may be a fusion sequence of a part of E3L (e.g., the 107 amino acid sequence on the C-terminal side of E3L) or the whole thereof and a part of K3 or the whole thereof, and may preferably be a fusion sequence of a part of E3L (more preferably, the 107 amino acid sequence on the C-terminal side of E3L) and K3, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). In one embodiment, E3K3 may be (i) a peptide comprising a sequence as described in SEQ ID NO: 30, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added to the sequence as described in SEQ ID NO: 30, or (iii) a peptide comprising a sequence having an identity of 90% or more or 95% or more to the sequence as described in SEQ ID NO: 30, or (iv) a fragment thereof, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0186] In one embodiment, E3Y3 may be a fusion sequence of a part of E3L (e.g., the 107 amino acid sequence on the C-terminal side of E3L) or the whole thereof and a part of Y3 or the whole thereof, and may preferably be a fusion sequence of a part of E3L (more preferably, the 107 amino acid sequence on the C-terminal side of E3L) and Y3, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). In one embodiment, E3Y3 may be (i) a peptide comprising a sequence as described in SEQ ID NO: 31, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added to the sequence as described in SEQ ID NO: 31, or (iii) a peptide comprising a sequence having an identity of 90% or more or 95% or more to the sequence as described in SEQ ID NO: 31, or (iv) a fragment thereof, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR).

[0187] In this specification, "packaging cell" refers to a cell that produces a viral vector. Generally, from the viewpoint of improving safety, the viral genome of the viral vector is engineered in the following manner: the factor that undertakes more than one function selected from the group consisting of proliferation, replication and diffusion (including infection to other cells) is destroyed, so that the cell cannot proliferate, replicate or spread after infection. However, in order to be able to proliferate, replicate and spread when producing a viral vector, the viral vector is produced while supplementing the destroyed factors in the packaging cell. Therefore, in the packaging cell, in order to produce a viral vector, a part of the destroyed viral factor is expressed in a way that supplements the destroyed viral factor and restores the amount of virus produced. The packaging cell can stably retain such a factor in the genome, or it can temporarily retain such a factor. In either case, in the production of the virus, the supplemented viral factor can be supplied to the cell of the packaging cell. As an example, traditionally, the Sendai virus vector can be obtained by, for example, using a packaging cell supplied with an F gene to produce a Sendai virus having a genome with an F gene defect. The supplied F gene is activated in the presence of trypsin, but F genes (F5R) of the type activated by the ubiquitous furin protease in cells have also been developed, and the convenience of virus manufacturing has been improved (for example, refer to WO2005 / 071085A). In recent years, the technology of producing Sendai virus from cDNA has been developed. For example, using the Z strain as a weak strain as the basic framework, a vector that has been made to further improve safety for use in human medical treatment has been produced. For example, a technology has been developed to lose the transmissibility of the virus by deleting any one or more of the F, HN and M genes from the viral genome. For example, it is preferred to use the F gene-deleted viral genome. The viral genome is operably connected to a control sequence (for example, a T7 promoter), and the production of the viral genome can be driven by the above-mentioned control sequence. Thus, the Sendai virus genome can be produced in packaging cells by cDNA. When using the T7 promoter as a control sequence (for example, the first, second, or third control sequence), the T7 RNA polymerase can be supplied by a helper virus such as vaccinia virus, for example. In the packaging cells, N, P, F and L are expressed in an operably linked manner to a control sequence that drives transcription based on RNA polymerase (e.g., polII), thereby supplying viral particle components and forming viral particles in the packaging cells. As packaging cells, LLC-MK2 cells from monkey kidneys are used, for example. Viral particles that can infect cells once but cannot spread to other cells thereafter are obtained. Viral particles can be concentrated and / or purified as needed before use. In the case of integrating foreign genes into viruses, in order to enable transcription based on RNA-dependent RNA polymerase, virus-specific control sequences are introduced as needed.

[0188] According to the present invention, a method for producing a negative-strand RNA virus or a negative-strand RNA virus vector is provided. As negative-strand RNA viruses, Orthomyxoviridae (orthomyxoviruses such as influenza virus), Paramyxoviridae (paramyxoviruses such as measles virus), Rhabdoviridae (rhabdoviruses such as rabies virus), Filoviridae (filoviruses such as Ebola virus and Marburg virus), and Bunyaviridae (Bunyaviruses such as Hantavirus) can be listed. As the negative-strand RNA virus, preferably a virus of the Paramyxoviridae family, preferably a paramyxovirus, and preferably Sendai virus.

[0189] In this specification, "control sequence" refers to a sequence having the activity of driving a gene connected thereto in an operably manner, and transcribing RNA from the gene. A control sequence is, for example, a promoter. Promoters include, for example, class I promoters (which can be used for transcription of rRNA precursors), class II promoters (consisting of a core promoter and an upstream promoter element, which can be used for transcription of mRNA), and class III promoters (further roughly divided into type I, type II, and type III).

[0190] Regarding the negative-strand RNA virus vector, in one embodiment, the factors related to the proliferation or infection of the negative-strand RNA virus to the cell are destroyed (e.g., deleted) on its genome, and the proliferation or infection ability in cells other than the packaging cell is reduced or has no substantial infection ability. As described above, such a vector can be prepared under the condition of supplying the destroyed factors related to the proliferation or infection to the packaging cell, thereby conferring the initial infectivity to the cell. Thus, the vector obtained from the packaging cell has infectivity, but the vector that subsequently infects cells other than the packaging cell cannot further produce infectious particles, thereby improving the safety of the vector.

[0191] In one embodiment, the method of the present invention comprises the following steps:

[0192] (A) A protein kinase R (PKR) inhibitory factor is expressed from a gene encoding the factor operably linked to a first control sequence and supplied to packaging cells.

[0193] The first control sequence can be a promoter capable of RNA, such as mRNA transcription, for example, various pol II promoters can be used. As pol II promoters, although not particularly limited, examples include CMV promoter, EF1 promoter (EF1α promoter), SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, CAG promoter and CBh promoter. As promoters capable of RNA transcription, promoters from phage-driven RNA polymerases such as T7 promoter, T3 promoter and SP6 promoter, and pol III promoters such as U6 promoter can also be used. For circular DNA, T7 promoter can be preferably used, and for linear DNA, SP6 promoter can be preferably used. The promoter can also be an inducible promoter. These promoters can be preferably used for the transcription of RNA factors. An inducible promoter is a promoter that can induce the expression of a polynucleotide connected to the promoter in a functional manner only in the presence of an inducing factor driving the promoter. As inducible promoters, promoters that induce gene expression by heating, such as heat shock promoters, can be cited. In addition, as inducible promoters, promoters whose inducing factors driving the promoters are drugs can be cited. As such drug-inducible promoters, for example, Cumate operon sequences, λ operon sequences (e.g., 12×λOp), tetracycline-based inducible promoters, etc. can be cited. As tetracycline-based inducible promoters, for example, tetracycline or its derivatives (e.g., doxycycline) or promoters that drive gene expression in the presence of a reverse tetracycline-controlled transactivator (rtTA) can be cited. As tetracycline-based inducible promoters, for example, TRE3G promoter can be cited.

[0194] Some types of viruses have PKR-inhibitory viral factors to counteract PKR. In the present invention, as PKR-inhibitory viral factors, PKR-inhibitory viral factors naturally present in such viruses can be used. Therefore, the species from which the viral genome and the PKR-inhibitory viral factor are derived can be the same species, but preferably different species.

[0195] As factors that inhibit protein kinase R (PKR), for example, bait RNA that binds to PKR can be listed. As bait RNA, for example, VAI RNA, EBER, nc886 and TAR, and their orthologs can be listed. In a preferred embodiment, the bait RNA can be VAI RNA and its orthologs, especially from adenovirus. In a preferred embodiment, the bait RNA can be EBER and its orthologs, especially from Epstein-Barr (EB) virus. In a preferred embodiment, the bait RNA can be nc886 and its orthologs, especially from humans. In a preferred embodiment, the bait RNA can be TAR and its orthologs, especially from human immunodeficiency virus (HIV). In the present invention, these factors can be preferably used.

[0196] As VAI, VAI having the sequence recorded in sequence number 17 can be used. VAI may also contain the sequence before and after it on the adenovirus genome. Therefore, the PKR-inhibitory viral factor may have the sequence recorded in sequence number 19. VAI may also contain VAII. For example, the PKR-inhibitory viral factor may have the sequence recorded in sequence number 21. VAI may have one or more mutations selected from the group consisting of substitution, deletion, insertion and addition. For example, as a PKR-inhibitory viral factor, it may have a sequence having a substitution at the base of VAI corresponding to the 74th base of the sequence recorded in sequence number 17. The substitution of the 74th base of the sequence recorded in sequence number 17 may be a substitution to any one of G, A and C, preferably a substitution to C. In a preferred embodiment, the PKR-inhibitory viral factor may have a sequence recorded in sequence number 18 or 20. In a preferred embodiment, the PKR-inhibitory viral factor may have a sequence recorded in sequence number 22 or 23.

[0197] In addition, for example, the PKR-inhibitory viral factor may have a sequence having a substitution at the base of VAI corresponding to the 191st base of the sequence described in SEQ ID NO: 19. In a preferred embodiment, the PKR-inhibitory viral factor may have the sequence described in SEQ ID NO: 24.

[0198] In a preferred embodiment, the PKR inhibitory viral factor may have the sequence set forth in SEQ ID NO: 25. In a preferred embodiment, the PKR inhibitory viral factor may have the sequence set forth in SEQ ID NO: 26.

[0199] In one embodiment, nc886 may have the sequence of sequence number 13. nc886 may also have the sequence before and after VAI. nc886 may also have the sequence before and after VAI, and may have the sequence recorded in sequence number 14.

[0200] As factors that inhibit protein kinase R (PKR), there are also molecules that induce PKR degradation. Examples of molecules that induce PKR degradation include 2A pro In a preferred embodiment, the molecule that induces PKR decomposition may be 2A pro and their orthologs, especially from poliovirus. In the present invention, these factors can be preferably used.

[0201] As factors that inhibit protein kinase R (PKR), factors that mask the double-stranded RNA of the virus can also be listed. Factors that mask the double-stranded RNA of the virus can mask the double-stranded RNA of the virus and prevent the activation of PKR. As factors that mask the double-stranded RNA of the virus, for example, E3L, σ3, Us11 and NS1 and their orthologs can be listed. In a preferred embodiment, the factor that masks the double-stranded RNA of the virus can be E3L and its orthologs, especially from vaccinia virus. In a preferred embodiment, it can be σ3 and its orthologs, especially from reovirus. In a preferred embodiment, it can be Us11 and its orthologs, especially from herpes simplex virus (HSV). In a preferred embodiment, the factor that masks the double-stranded RNA of the virus can be NS1 and its orthologs, especially from influenza virus. In the present invention, these factors can be preferably used.

[0202] As a protein kinase R (PKR) inhibitory factor, another factor that inhibits PKR dimerization can be mentioned. As a factor that inhibits PKR dimerization, for example, p58 IPK and NS5A and their orthologs. In a preferred embodiment, the factor that inhibits the dimerization of PKR may be p58 IPK and its orthologs, especially from humans. In a preferred embodiment, the factor that inhibits the dimerization of PKR can be NS5A and its orthologs, especially from hepatitis C virus (HCV). In the present invention, these factors can be preferably used. NS5A can be missing its C-terminal side (for example, after the 149th amino acid). For example, NS5A can be NS5A (1-148) having its 1st to 148th amino acids.

[0203] As factors that inhibit protein kinase R (PKR), pseudosubstrates of PKR can also be mentioned. As pseudosubstrates, for example, K3L and Tat and their orthologs can be mentioned. In a preferred embodiment, the pseudosubstrate can be K3L and its orthologs, especially from vaccinia virus. In a preferred embodiment, the pseudosubstrate is Tat and its orthologs, especially from HIV. In the present invention, these factors can be preferably used.

[0204] As factors of protein kinase R (PKR) inhibition, molecules that induce dephosphorylation of substrates can be listed. As molecules that induce dephosphorylation of substrates, for example, ICP34.5 and its orthologs can be listed. In a preferred embodiment, the molecules that induce dephosphorylation of substrates are ICP34.5 and its orthologs, which are from herpes simplex virus (HSV). In the present invention, these factors can be preferably used.

[0205] In one embodiment, the protein kinase R (PKR) inhibitory factor is selected from the group consisting of adenovirus VAI RNA, Epstein-Barr virus EBER, human nc886, HIV virus TAR, polio virus 2A pro , E3L of vaccinia virus, δ3 of reovirus, NS1 of influenza virus, human p58 IPK , NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus and ICP34.5 of herpes simplex virus, and one or more of the group consisting of their orthologs.

[0206] In one embodiment, the protein kinase R (PKR) inhibitory factor can be stably integrated into the genome of the packaging cell. Expression can be driven by the first control sequence. The first control sequence can be a constitutive promoter or an inducible promoter.

[0207] In one embodiment, the protein kinase R (PKR) inhibitory factor can be transiently introduced into the packaging cell. For example, the protein kinase R (PKR) inhibitory factor can be carried on a plasmid DNA. The plasmid DNA can be introduced into the cell using a technique well known to those skilled in the art, whereby the protein kinase R (PKR) inhibitory factor can be expressed in the cell by the plasmid DNA. The expression can be driven by the first control sequence. The first control sequence can be a constitutive promoter or an inducible promoter.

[0208] In one embodiment, the packaging cells may be, for example, Vero cells or LLC-MK2 cells. In one embodiment, the packaging cells may be a cell group composed of Vero cells or a cell group composed of LLC-MK2 cells. In one embodiment, cells other than packaging cells are not used in the production of the virus. In one embodiment, the packaging cells express the F gene. In a preferred embodiment, the packaging cells stably express the F gene. In a preferred embodiment, the F protein can be activated by trypsin. In a preferred embodiment, the F protein may be F5R. In a preferred embodiment, a composition for SeV reconstruction containing Vero cells or LLC-MK2 cells is provided. Reconstruction refers to supplying the components of a virus or a viral vector to packaging cells to form a virus or a viral vector. SeV reconstruction can be carried out as described in this specification.

[0209] According to the present invention, there is provided a method for producing a negative-strand RNA virus or a negative-strand RNA viral vector, comprising the following steps:

[0210] (B) causing the packaging cells to express the genomic RNA of the negative-strand RNA virus or viral vector to form the negative-strand RNA virus or viral vector in the presence of the above-mentioned factors {for example, expressing the genomic RNA of the negative-strand RNA virus or negative-strand RNA viral vector in the packaging cells in the presence of a PKR inhibitory factor, such as a PKR inhibitory viral factor, to form the negative-strand RNA virus or negative-strand RNA viral vector}.

[0211] The genomic RNA of a negative-strand RNA virus or a negative-strand RNA viral vector can be expressed, for example, by a gene expression vector having a DNA encoding the genomic RNA operably connected to the second control sequence. The gene expression vector can use, for example, a vector that at least transiently expresses the above-mentioned genomic RNA in a cell, for example, in a preferred example, it can be a plasmid vector. In the above-mentioned genomic RNA, in order to minimize the cytotoxicity of the vector, the P protein can have a mutation of 511F, the M protein can have a mutation of 69E, 116A and 183S, the HN protein can have a mutation of 262T, 264R and 461E, and the L protein can have a mutation of 1197S and 1796E (for example, refer to WO2003 / 025570). When the genomic RNA is produced in the cell, it is complexed with the constituent elements (for example, F, N, P, L) of other viral particles supplied to the packaging cell to form a virus or a viral vector (virion). At this time, if there are protein kinase R (PKR) inhibitory factors, NS5A, or nc886, or their equivalents in the cells, the amount of virus particles produced increases. The packaging cells can be cultured under conditions suitable for culture. The gene encoding the viral genome can be driven by a T7 promoter. In this case, T7 polymerase can be supplied to the packaging cells. The gene encoding the viral genome can be driven by a CAG promoter or an EF1 promoter.

[0212] In one embodiment, the formation of SeV in packaging cells can be promoted by further supplying the components of SeV (eg, N, P, and L, and their equivalents) to packaging cells. The components of SeV can be supplied, for example, by introducing a plasmid vector into packaging cells.

[0213] In one embodiment, genes encoding constituent elements (e.g., N, P, L) of viral particles are operably connected to the third control sequence. In one embodiment, genes encoding constituent elements (e.g., F, N, P, L) of viral particles operably connected to the third control sequence are integrated on the plasmid. In one embodiment, the third control sequence can be a CAG promoter (e.g., a sequence recorded in sequence number 2). In one embodiment, at least one or all of the third control sequences can be non-CAG promoters, such as EF1α promoters (e.g., a sequence recorded in sequence number 1). In a preferred embodiment, genes encoding constituent elements (e.g., N, P, L) of viral particles can be carried on one or more gene expression vectors (preferably plasmids). In this case, these constituent elements can be operably connected to one control sequence or two or more control sequences. The control sequence can be, for example, a CAG or EF1 promoter. In one embodiment, the plasmid can also be equipped with a gene encoding T7 polymerase (T7 polymerase gene).

[0214] In one embodiment of the present invention, the method for producing a negative-strand RNA virus or a negative-strand RNA viral vector further comprises the following steps:

[0215] (C) Recovering the formed negative-strand RNA virus or negative-strand RNA viral vector.

[0216] The virus particles formed in the cells can be appropriately recovered. The virus particles formed in the cells can be released outside the cells. Therefore, the virus particles can be recovered from the culture medium. The recovered virus particles can be appropriately purified and / or concentrated. Thus, an isolated virus vector, a purified virus vector, or a concentrated virus vector can be provided. The obtained virus vector can be appropriately stored. For example, it can be stored in a deep freezer (e.g., about -80°C), a freezer (e.g., about -20°C), or a refrigerator (about 4°C). It can also be stored in liquid nitrogen. The virus vector can be provided for titer determination (titer determination) as needed. The titer of the virus can be determined by methods well known to those skilled in the art.

[0217] In one embodiment, the infection titer of the negative-strand RNA virus or negative-strand RNA virus vector obtained by the method of the present invention can be 1×10 5 CIU / mL or above, 2×10 5 CIU / mL or above, 3×10 5 CIU / mL or above, 4×10 5 CIU / mL or above, 5×10 5 CIU / mL or above, 6×10 5 CIU / mL or above, 7×10 5 CIU / mL or above, 8×10 5CIU / mL or above, 9×10 5 CIU / mL or more, 1×10 6 CIU / mL or above, 2×10 6 CIU / mL or above, 3×10 6 CIU / mL or above, 4×10 6 CIU / mL or above, 5×10 6 CIU / mL or above, 6×10 6 CIU / mL or above, 7×10 6 CIU / mL or above, 8×10 6 CIU / mL or above, 9×10 6 CIU / mL or more, 1×10 7 CIU / mL or above, 2×10 7 CIU / mL or above, 3×10 7 CIU / mL or above, 4×10 7 CIU / mL or above, or 5×10 7 CIU / mL or more. The infection titer of a virus or vector that does not have F can be measured using, for example, Vero cells that do not have F.

[0218] In one embodiment of the present invention, the species from which the virus or viral vector is derived and the species from which the PKR inhibitory factor is derived may be heterologous. In this embodiment, the species from which the first control sequence and the PKR inhibitory factor are derived may be homologous.

[0219] In one embodiment of the present invention, the first control sequence may be heterologous to the species from which the PKR inhibitory factor originates. In this embodiment, the species from which the virus or viral vector originates may be homologous to the species from which the PKR inhibitory factor originates.

[0220] In one embodiment of the present invention, the species from which the virus or viral vector is derived may be heterologous to the species from which the PKR inhibitory factor is derived, and the first control sequence may be heterologous to the species from which the PKR inhibitory factor is derived.

[0221] In one embodiment of the present invention, the gene encoding the PKR inhibitory factor is integrated into the genome of the packaging cell. In one embodiment of the present invention, the gene encoding the PKR inhibitory factor is integrated into the vector (e.g., plasmid DNA) to be introduced into the packaging cell. The integration position can be before the N gene on the SeV genome (+ position), between the N gene and the P gene (NP position), between the P gene and the M gene (PM position), between the M gene and the HN gene (MHN position), between the HN gene and the L gene (HNL position), or after the L gene (Le position). When the factor is RNA, the integration position can be in the 3'UTR of the gene encoding the target protein. Usually, the N gene is sometimes also described as the NP gene.

[0222] In a preferred embodiment of the present invention, the gene encoding the PKR inhibitory factor is integrated into the RNA genome of a negative-strand RNA virus or a negative-strand RNA virus vector. In this embodiment, the gene encoding the PKR inhibitory factor can also be integrated into the genome of a packaging cell or a vector (e.g., plasmid DNA) to be introduced into a packaging cell. Therefore, in a preferred embodiment, the gene encoding the PKR inhibitory factor is integrated into the RNA genome of a negative-strand RNA virus or a negative-strand RNA virus vector and is also integrated into the genome of a packaging cell or a vector (e.g., plasmid DNA) to be introduced into a packaging cell. By doing so, even when the number of genomes is small, the PKR inhibitory factor can be supplied from the packaging cell, and when the number of genomes increases, the PKR inhibitory factor is also supplied from the genome, and the negative-strand RNA virus or negative-strand RNA virus vector can be well increased. In addition, after the obtained negative-strand RNA virus or virus vector is infected with other cells (non-packaging cells), the PKR inhibitory factor is also supplied from the virus genome, and the virus or virus vector can be well proliferated in the cell. Thus, for example, the effect of increasing the expression amount of the target gene carried in the virus or virus vector can be obtained.

[0223] In one embodiment of the present invention, viral particles are produced in the absence of a helper virus.

[0224] In one embodiment of the present invention, the virus or viral vector is a paramyxovirus or a paramyxovirus vector, and the RNA genome is an F gene-deficient RNA genome. In this embodiment, the first control sequence can be a CAG promoter or an EF1 promoter, such as an EF1 promoter. In this embodiment, in addition, the second control sequence is a T7 promoter, and T7 RNA polymerase can be produced from a cell genome or a plasmid by transcription and translation. In a preferred embodiment, the paramyxovirus is a Sendai virus. In addition, in a preferred embodiment, the paramyxovirus vector is a Sendai virus vector.

[0225] In one embodiment, the paramyxovirus or paramyxovirus vector can express N, P and L proteins. In one embodiment, the paramyxovirus or paramyxovirus vector does not express one, two or three selected from the group consisting of F, HN and M proteins. For example, the RNA genome is missing RNA encoding one, two or three proteins selected from the group consisting of F, HN and M proteins. In a preferred embodiment, the paramyxovirus or paramyxovirus vector does not express F protein.

[0226] In one embodiment, the Paramyxovirus or Paramyxovirus vector has an RNA genome that expressibly contains the V protein and / or the C protein.

[0227] According to the present invention, an RNA genome of a negative-strand RNA virus or a negative-strand RNA viral vector and a DNA encoding the RNA genome are provided. In one embodiment, the RNA genome can expressively contain a gene encoding any one or more of the factors that inhibit PKR (e.g., a PKR-inhibiting viral factor). According to the present invention, a negative-strand RNA viral vector containing the above-mentioned RNA genome is also provided. The negative-strand RNA virus or the negative-strand RNA viral vector further has virus particles that encapsulate the RNA genome. Such a virus or viral vector can exert a stronger proliferation ability after cell infection. In a preferred embodiment, the negative-strand RNA virus can be a paramyxovirus, more preferably a Sendai virus. In addition, in a preferred embodiment, the negative-strand RNA viral vector can be a paramyxovirus vector, more preferably a Sendai virus vector. In one embodiment, the DNA encoding the RNA genome is operably connected to the second control sequence. In one embodiment, a gene expression vector containing the DNA encoding the RNA genome operably connected to the second control sequence is provided.

[0228] In a preferred embodiment, a gene expression vector containing DNA encoding an RNA genome (particularly a SeV genome) may contain a sequence of a self-cleaving ribozyme (e.g., a hammerhead ribozyme or an HDV ribozyme) adjacent to either or both of the upstream and downstream of the RNA genome. In addition, the gene expression vector may be connected to the sequence of other factors (e.g., a PKR inhibitory factor, a factor that promotes RNA amplification) across the sequence of the self-cleaving ribozyme (e.g., a hammerhead ribozyme or an HDV ribozyme), thereby transcribing the RNA genome and the sequence of the other factors into a series of RNA. By constructing in this way, after the RNA genome is transcribed, the RNA is cleaved at the sequence of the self-cleaving ribozyme (e.g., a hammerhead ribozyme or an HDV ribozyme), and the other factors may be removed to obtain RNA substantially consisting of the RNA genome. By connecting, for example, a PKR inhibitory factor or a factor that promotes RNA amplification as the sequence of the other factor, the other factor may be removed from the completed genome after the genome has been amplified by exerting its effect. For example, the other factors may be arranged on the 5' side of the RNA genome, and the sequence of a hammerhead ribozyme may be arranged between the other factors and the region encoding the RNA genome, or the other factors may be arranged on the 3' side of the RNA genome, and the sequence of an HDV ribozyme may be arranged between the region encoding the RNA genome and the other factors. More specifically, the gene expression vector containing the DNA encoding the RNA genome may be constructed in such a manner as to contain, in order, a promoter (e.g., T7 promoter, CAG promoter, EF1 promoter, etc.), a sequence of a first self-cleaving ribozyme (e.g., a 3' self-cleaving ribozyme, preferably a hammerhead ribozyme), a DNA encoding the RNA genome, a sequence of a second self-cleaving ribozyme (e.g., a 5' self-cleaving ribozyme, preferably an HDV ribozyme), and a sequence of the other factors. In addition, as another preferred embodiment, it can be composed in a manner that contains a promoter (e.g., T7 promoter, CAG promoter, EF1 promoter, etc.), sequences of other factors, a first self-cleaving ribozyme (e.g., 3' self-cleaving ribozyme, preferably a hammerhead ribozyme), DNA encoding an RNA genome, and a second self-cleaving ribozyme (e.g., 5' self-cleaving ribozyme, preferably an HDV ribozyme) sequence in sequence. In the above, the self-cleaving ribozyme is only shown as an example, and the preferred embodiment is not limited to this. In particular, when using a self-cleaving ribozyme, the self-cleaving ribozyme can be configured in a manner that the number of bases of the RNA genome is 6n {here, n is a natural number}. For example, the gene expression vector can further contain a terminator sequence (e.g., a T7 terminator sequence for T7 polymerase) downstream of the sequence of other factors. Various sequences of self-cleaving ribozymes (e.g., hammerhead ribozymes) are known.As self-cleaving ribozymes, there are no particular limitations, and examples thereof include hammerhead ribozymes, hepatitis delta virus (HDV) ribozymes, twister ribozymes, twister-sister ribozymes, pistol ribozymes, hairpin ribozymes, and axe ribozymes. These self-cleaving ribozymes may be, for example, 5' self-cleaving ribozymes and / or 3' self-cleaving ribozymes. Among them, the sequence of Hh-Rbz as a 3' self-cleaving ribozyme (e.g., sequence number 36) and the sequence of the hepatitis delta virus ribozyme (HDV-Rbz) as a 5' self-cleaving ribozyme (e.g., sequence number 37) etc. may be used. In a further preferred embodiment, a gene expression vector containing DNA encoding an RNA genome (particularly a SeV genome) and the genome may be equipped with a T7 polymerase gene operably connected to a promoter, and the expression of the DNA may be driven by a T7 promoter. The carrying position of the T7 polymerase gene may be, for example, set to the outside of the ribozyme, for example, not included in the SeV genome. In one embodiment, the SeV genome carries genes encoding N, P, M, HN, and L, and may further carry a target gene (GOI).

[0229] The above-mentioned gene expression vector can be introduced into F-expressing cells together with an auxiliary vector containing NP, P and L for reconstruction of SeV. The above-mentioned gene expression vector or auxiliary vector can also be equipped with a gene encoding a factor that inhibits protein kinase R (PKR). The above-mentioned gene expression vector or auxiliary vector can also be equipped with a T7 polymerase gene to drive transcription of the SeV genome through a T7 promoter. The above-mentioned gene expression vector or auxiliary vector can also be equipped with an F gene.

[0230] In addition, the gene expression vector of the genome containing the DNA encoding the SeV genome can be equipped with genes encoding N, P, M, HN and L, and the method of reconstructing SeV with 1 plasmid is studied by driving N, P and L with a promoter (e.g., T7 promoter, pol II promoter). In addition, the region containing the gene encoding the SeV genome (or consisting of the gene encoding the SeV genome) can also be sandwiched by the first self-cleaving ribozyme and the second self-cleaving ribozyme as described above. In the case of driving the transcription of the SeV genome with the T7 promoter, the outside of the first self-cleaving ribozyme and the second self-cleaving ribozyme can also be equipped with the T7 polymerase that is operably connected to the promoter. The gene expression vector can also be equipped with the F gene.

[0231] In a preferred embodiment, the gene expression vector expressing the constituent factors of RNA virus can further carry PKR inhibitory factors and factors that promote RNA amplification. In the above-mentioned gene expression vector, the above-mentioned constituent factors can be connected to the sequences of other factors (such as PKR inhibitory factors and factors that promote RNA amplification) across the sequence of the above-mentioned self-cleaving ribozyme (for example, as mentioned above, it can be hammerhead ribozyme or HDV ribozyme), thereby transcribe the RNA genome and the sequences of the above-mentioned other factors into a series of RNA. Alternatively, in a preferred embodiment, the PKR inhibitory factors and factors that promote RNA amplification can be independently carried on plasmids.

[0232] According to the present invention, a combination of a gene expression vector containing a DNA encoding the RNA genome of the above-mentioned virus and a vector for reconstruction of the above-mentioned virus containing a DNA encoding the constituent factors of the above-mentioned virus is provided. By co-expressing the combination in a cell, it can be used to reconstruct the particles of the above-mentioned virus in the cell. In one embodiment, a combination for reconstructing viral particles is provided, which contains a DNA encoding the RNA genome of the above-mentioned virus and a DNA encoding the constituent factors of the above-mentioned virus, and these DNAs contain DNA encoding factors sufficient to constitute viral particles, and are carried on one or more gene expression vectors. The DNA encoding the RNA genome and the constituent factors of the above-mentioned virus are connected to a control sequence in an operably manner. The control sequence can be a promoter, and as a promoter, it is not particularly limited, and examples thereof include T7 promoter, CAG promoter and EF1 promoter.

[0233] Sendai virus or Sendai virus vector may further have a target gene in its RNA genome. The target gene may be a gene to be introduced into a cell. The target gene may be expressed in the introduced cell and produce RNA or protein. The target gene may be expressibly carried in the RNA genome. The target gene may be an exogenous gene. Exogenous gene is a term used to distinguish between the cell to be introduced and the endogenous gene.

[0234] According to the present invention, packaging cells and methods for producing packaging cells can be provided. The method for producing packaging cells of the present invention includes the step of introducing into a cell clone a vector carrying a gene encoding a factor required for reconstruction of a virus or a viral vector. The cell clone into which the vector has been introduced can express the gene carried. In one embodiment of the present invention, the method may include the step of introducing into a cell clone a vector carrying a gene encoding F and a gene encoding a factor of the present invention.

[0235] The vector may be equipped with the above-mentioned gene operably connected to a promoter (e.g., CAG promoter and EF1α promoter, etc.). The vector has a drug resistance gene, and cell clones stably introduced with the vector can be obtained by drug selection. Cells with a large number of copies of the introduced vector can be selected according to drug concentration dependence. For example, for the neomycin resistance gene, G418 can be used at a concentration of 0.5 to 3 mg / mL.

[0236] The vector may have a region located between the promoter and the gene and sandwiched by site-specific recombination sequences. The drug resistance gene may be present in the region sandwiched by site-specific recombination sequences.

[0237] The region sandwiched by the site-specific recombination sequence can be removed in cell cloning by making the site-specific recombinase play a role, and thus, the above-mentioned promoter can drive (for example, more strongly drive) the expression of the above-mentioned gene. As the site-specific recombinase, it is not particularly limited, and many known site-specific recombinases known to those skilled in the art, any one of which can be used, for example, Cre recombinase can be used. In this case, the site-specific recombination sequence suitable for Cre recombinase can be set to loxP. Cre recombinase can also be supplied by other vectors. As other vectors, SeV vectors and plasmids can be listed.

[0238] The region sandwiched by the site-specific recombination sequence may be provided with an inducible suicide gene. The inducible suicide gene can cause cell death in the presence of a specific substance. As an inducible suicide gene, for example, iCaspase9 (iC9) can be cited, which can induce cell apoptosis in the presence of a low molecular compound (AP1903). The inducible suicide gene can cause cells whose regions sandwiched by the site-specific recombination sequence are not removed to die by apoptosis.

[0239] Thus, the present invention can provide packaging cells that have a gene encoding F and a gene encoding a factor of the present invention in a manner that can be expressed in a cell clone.

[0240] Example

[0241] Preparation of negative-strand RNA viral vector

[0242] The negative strand RNA viral vector was expressed in viral packaging cells. In particular, the effectiveness of PKR inhibitors during expression was evaluated.

[0243] As a negative-strand RNA viral vector, Sendai virus (SeV) was used. Regarding Sendai virus, a plasmid mixture was introduced into F gene-expressing cells and recovered from the culture supernatant 3 days later. The plasmid mixture contained pSeV-EmGFP carrying the Sendai virus genome operably connected to the T7 promoter. In the Sendai virus genome, a gene encoding EmGFP was carried in order to be able to detect the proliferation of the genome by fluorescence. The Sendai virus genome has a F gene deletion.

[0244] (1) F gene-expressing cells were prepared as follows.

[0245] pCAGGS-F-neo was constructed by carrying the F gene of SeV (kozak sequence added, optimized for human codons) in pCAGGS-neo. The obtained plasmid was transfected into Vero cells or LLC-MK2 cells using ViaFect (Promega), and selected using 1-2 mg / mL G418 disulfate solution (Nacalai Test) to obtain F gene-expressing cells. The obtained cells were recorded as Vero-F and LLC-MK2-F.

[0246] (2) F gene-deficient SeV was prepared as follows.

[0247] Based on the sequence information of SeV-Z strain with accession number: AB855655 and the information of pSeV in J. General Virology (1997), 78, 2813-2820., pSeV / dF, which transcribes the F gene-deficient SeV genome through the T7 promoter, was constructed. In order to minimize the cell damage of SeV-Z strain, the following amino acid mutations were introduced into pSeV / dF: P protein: 511F, M protein: 69E, 116A and 183S, HN protein: 262T, 264R and 461E, and L protein: 1197S and 1796E (for example, refer to WO2003 / 025570). The obtained plasmid was set to pSeV / TSdF. In order to evaluate the reconstruction of SeV, the mutant EmGFP of GFP was used as the target gene (GOI). The gene expression level decreases in the order of the GOI loading position before the N gene (hereinafter referred to as "+"), between the P gene and the M gene (hereinafter referred to as "PM"), between the M gene and the HN gene (hereinafter referred to as "MHN"), and between the HN gene and the L gene (hereinafter referred to as "HNL"). The EmGFP gene loading position is set before the N gene of SeV, and pSeV+EmGFP / TSdF is mainly used.

[0248] (3) The plasmid for SeV reconstruction was prepared as follows.

[0249] With reference to WO2005 / 071092, pCAGGS-NP, pCAGGS-P4C(-), pCAGGS-L, pCAGGS-F5R, and pCAGGS-T7 were constructed, and this combination was denoted as "CAG". In addition, a kozak sequence was added and optimized to human codons, and a plasmid group for reconstruction having a promoter different from the above was constructed: pCAGGS-NPco, pCAGGS-P4C(-)co, pCAGGS-Lco, pCAGGS-F5Rco, pCAGGS-T7co, pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pEF1-F5Rco, and pEF1-T7co. Furthermore, for T7, 430P, 849I, and 880Y mutations were introduced with reference to P2001-54387A, and 644Y and 667Y mutations were introduced with reference to P2003-61683A, and pCAGGS-T7mco and pEF1-T7mco carrying the obtained T7m sequence were constructed. The combination of pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco was recorded as "EFnpL". The combination of pEF1-NPco, pCAGGS-P4C(-)co, pCAGGS-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco was recorded as EFnCAGpL. The combination of pCAGGS-NPco, pCAGGS-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco was designated as CAGnpEFL.

[0250] (4) A plasmid containing a PKR inhibitory factor was prepared as follows.

[0251] The sequence for non-coding RNA evaluation was loaded onto a pT7 plasmid having a T7 promoter and a T7 terminator to construct pT7-VAI (180 bp; sequence number 17), pT7-VAI74a (180 bp; V=A in sequence number 18), pT7-VAI74c (180 bp; V=C in sequence number 18), pT7-VAI74a (330 bp; M=A in sequence number 26), pT7-VAI-VAII (478 bp; sequence number 21), pT7-nc886 (108 bp; sequence number 13), and pT7-nc886 (272 bp; sequence number 14). In order to disrupt the BamHI recognition sequence located in the apical stem (ApicalStem) of VAI (Figure 1), a sequence having a base substitution (T74A, T74C) at the 74th base of VAI was constructed. Similarly, in order to destroy the NheI recognition sequence located on the 3' side of VAI, a sequence with a base substitution (G191C) at the 191st base was constructed (M=A in sequence number 26). These base substitutions were designed to not affect the secondary structure of RNA and the function of VAI. A pT7 plasmid carrying nc886 (108 bp) as another PKR inhibitor was constructed. In order to extend the sequence, nc886 (272 bp) (sequence numbers 13 and 14) was constructed, which further had the front and back sequences of VAI. As a control plasmid, pT7-IRES with an IRES sequence under the T7 promoter was constructed.

[0252] (5) A plasmid containing a PKR inhibitory factor was prepared as follows.

[0253] For the sequence to be translated, the Kozak sequence was added and the human codon was optimized. pCAGGS-E3L, pCAGGS-K3L, pCAGGS-Y3, pCAGGS-E3K3, pCAGGS-E3Y3, pCAGGS-NS1, pCAGGS-σ3, and pCAGGS-Us11 were constructed. E3L (sequence number 7) and K3L (sequence number 10) are sequences of vaccinia virus, Y3 (sequence number 27) is a 106 amino acid sequence on the C-terminal side of SeV C protein, NS1 (sequence number 28) is a sequence of influenza virus, σ3 (sequence number 8) is a sequence of reovirus, Us11 (sequence number 29) is a sequence of HSV-1, E3K3 (sequence number 30) is a fusion sequence of the 107 amino acid sequence on the C-terminal side of E3L and K3L, and E3Y3 (sequence number 31) is a fusion sequence of the 107 amino acid sequence on the C-terminal side of E3L and Y3.

[0254] (6) SeV reconstitution in the presence or absence of PKR inhibitors

[0255] The ratio of plasmid to transfection reagent for SeV reconstruction was based on WO2005 / 071092. Specifically, the following weights of plasmid and transfection reagent (TransIT-LT1 reagent or ViaFect) were mixed to obtain a plasmid mixture.

[0256] Conditions without PKR inhibitor:

[0257] NP, P4C(-), F5R, T7: 0.5 μg each

[0258] L: 2μg

[0259] pSeV: 5 μg

[0260] Total amount of plasmid: 9 μg

[0261] TransIT-LT1 reagent or ViaFect: 15 μL

[0262] Conditions containing PKR inhibitors:

[0263] NP, P4C(-), F5R, T7: 0.5 μg each

[0264] L: 2μg

[0265] pSeV: 5 μg

[0266] Plasmid with PKR inhibitor: 1 μg

[0267] Total amount of plasmid: 10 μg

[0268] TransIT-LT1 reagent or ViaFect: 16.5 μL

[0269] Hereinafter, unless otherwise stated, the weight of the plasmid and the volume of the transfection reagent were mixed in a ratio of 9:15.

[0270] The plasmid and transfection reagent were mixed in 225 μL of OptiMEM, and the F gene-expressing cells in the 12-well plate in culture were transfected in 500 μL of culture medium (10% FBS / E-MEM), and cultured at 37°C. Culture was carried out at 32°C from the day after transfection. The culture medium was exchanged every day with a serum-free culture medium (ITS-X / NEAA / E-MEM) supplemented with 2.5 μg / mL trypsin. As an indicator of successful SeV reconstruction, EmGFP-positive cells were observed from the day after transfection (an increase in the number of EmGFP-positive cells indicates an increase in SeV reconstruction efficiency), and the fluorescence intensity of the microplate was measured using the fluorescence microscope system ECLIPSE Ti2-E (Nikon) on the third day of transfection. The culture supernatant on the third day of transfection was recovered, diluted 10-fold to 100,000-fold, and infected with Vero cells seeded in 96-well plates. The number of GFP-positive cells after infection for 3 days was measured using ECLIPSE Ti2-E to calculate the infection titer. The infection titer was measured using a single layer of Vero cells without F.

[0271] (7) SeV reconstruction in the presence of VAI

[0272] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F was used. CAGnpEFL was used as the plasmid for SeV reconstruction. pSeV+EmGFP / TSdF was used for pSeV. VAI was used as a PKR inhibitor. Regarding VAI, pT7-VAI (180bp) and pT7-VAI-VAII (478bp) were used as wild-type (wt) sequences, and pT7-VAI74a (180bp), pT7-VAI74c (180bp), and pT7-VAI74a (330bp) were used as base replacement sequences. pT7-IRES was used as a control (Ctrl) plasmid for VAI. For cells in combination with VAI, unlike the control, EmGFP fluorescence-positive cells were observed from the day after transfection. When the fluorescence intensity of EmGFP from cells on day 3 was compared, it was 18 times that of the control in the presence of VAI(180bp)wt, 34 times that of the control in the presence of VAI(180bp)74a, 53 times that of the control in the presence of VAI(180bp)74c, 63 times that of the control in the presence of VAI-VAII, and 146 times that of the control in the presence of VAI(330bp)74a. The combined use of VAI significantly increased the number of EmGFP-positive cells ( Figure 2). The infection titer of the culture supernatant on the third day after SeV reconstruction was 68 times that of the control in the presence of VAI (180 bp) wt, 139 times that of the control in the presence of VAI (180 bp) 74a, 282 times that of the control in the presence of VAI (180 bp) 74c, 476 times that of the control in the presence of VAI-VAII, and 1962 times that of the control in the presence of VAI (330 bp) 74a ( Figure 3 ). It can be seen that VAI significantly improved the efficiency of SeV reconstruction.

[0273] According to WO2005 / 071092, the recovery efficiency of SeV vectors in LLC-MK2 cells was very low, and even when the recovered cells were inoculated into eggs, no HA activity of SeV was confirmed in cells derived from LLC-MK2. In SeV reconstruction using 293T cells, the culture supernatant on the third day after reconstruction showed 10 2 CIU / mL infection titer (see Beaty, SM. et al., mSphere. 2, e00376-16 (2017)). In contrast, in this example, 2×10 7 CIU / mL, the infection titer increased significantly.

[0274] (8) SeV reconstruction in the presence of nc886

[0275] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP / TSdF was used as pSeV. As plasmids containing PKR inhibitors, pT7-nc886 (108 bp), pT7-nc886 (272 bp), and pT7-VAI74a (330 bp) were used.

[0276] When the fluorescence intensity of EmGFP from cells on day 3 after reconstitution was compared, it was 17 times that of the control in the presence of nc886 (108 bp), 52 times that of the control in the presence of nc886 (272 bp), and 381 times that of the control in the presence of VAI (330 bp) 74a ( Figure 4 ).

[0277] (9) SeV reconstruction in the presence of PKR-inhibiting viral factors

[0278] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F or cells containing only Vero-F was used. As a plasmid for SeV reconstruction, CAGnpEFL was used. As pSeV, pSeV+EmGFP / TSdF was used. As a PKR inhibition plasmid, any one of pT7-VAI74a (330 bp), pCAGGS-E3L, pCAGGS-K3L, pCAGGS-NS1, pCAGGS-σ3, pCAGGS-Us11, and pCAGGS-Y3 was used. The fluorescence intensity derived from EmGFP in cells on the third day after reconstruction was measured. Figure 5 As shown in the figure, the fluorescence intensity of EmGFP from cells increased in all experimental groups compared with the control. VAI, E3L, σ3, and Us11( Figure 5 ). In addition, Figure 6 As shown in Figure 2, the infection titers in all experimental groups were increased compared to the control. In the titer determination, VAI, E3L, σ3, and Us11 ( Figure 6 ).

[0279] (10) SeV reconstruction in the presence of fusion sequences

[0280] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F or cells containing only Vero-F was used. As a plasmid for SeV reconstruction, CAGnpEFL was used. As pSeV, pSeV+EmGFP / TSdF was used. As a PKR inhibitory plasmid, any of pCAGGS-E3L, pCAGGS-K3L, pCAGGS-E3K3, pCAGGS-E3Y3, and pCAGGS-Y3 was used. The fluorescence intensity derived from EmGFP in cells on day 3 after reconstruction was measured. Thus, Figure 7 As shown in the figure, the fluorescence intensity of EmGFP from cells increased in all experimental groups compared with the control. In addition, E3Y3 improved the efficiency of SeV reconstruction compared with E3K3 ( Figure 7 ). In addition, when EFnpL was used as a plasmid for SeV reconstruction, when the SeV reconstruction efficiency was compared on the third day after infection, it was found that in the case of LLC-MK2-F cells, E3Y3 was observed to be 3.5 times higher than E3L, and in the case of Vero-F cells, E3Y3 was observed to be 6.8 times higher than E3L.

[0281] (11) SeV reconstruction using cells stably expressing PKR inhibitors

[0282] Vero-F cells were transfected with pCAGGS-E3L-Hyg or pCAGGS-E3Y3-Hyg, and the cells were selected using 500 μg / mL hygromycin B (NAKALI TESQUE) to obtain stable strains of Vero-F-E3L and Vero-F-E3Y3 cells that stably express E3L and E3Y3, respectively. For these cells, a combination of SeV reconstruction plasmids pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco (EFnpL) and pSeV+EmGFP / TSdF were used. The fluorescence intensity derived from EmGFP in cells on the third day after reconstruction was measured. In Vero-F-E3Y3 cells, a 2-fold increase in SeV reconstruction efficiency was observed.

[0283] (12) Comparison of expression promoters

[0284] In order to compare with the prior art, the combination of CAG promoter and EF1 promoter was studied. LLC-MK2-F and Vero-F were used as cells. As pSeV, pSeV+EmGFP / TSdF was used. As a PKR inhibitor, E3Y3 was used. The effect of promoter differences on SeV reconstruction efficiency was investigated by the following combinations: CAG, in which N, P, and L are all driven by the CAG promoter; EFnpL, in which N, P, and L are all driven by the EF1α promoter; EFnCAGpL, in which N is driven by the EF1α promoter, and P and L are driven by the CAG promoter; and CAGnpEFL, in which N and P are driven by the CAG promoter, and L is driven by the EF1α promoter. The fluorescence intensity of EmGFP from cells on day 3 after reconstruction was measured.

[0285] As a result, in LLC-MK2 cells, Figure 8 As shown, in the case of codon optimization of the plasmid used for SeV reconstruction alone, sufficient SeV reconstruction efficiency could not be obtained (refer to CAG in the absence of PKR inhibitor E3Y3). In contrast, SeV reconstruction with sufficient efficiency was confirmed by driving with any promoter in the presence of E3Y3. In the system in which N and P were expressed using the CAG promoter and L was expressed using the EF1a promoter in the presence of the PKR inhibitor E3Y3, the SeV reconstruction efficiency was improved by 271 times compared with CAG (conventional plasmid).

[0286] In addition, in the case of Vero cells, Fig. 9As shown, in the presence of the PKR inhibitor E3Y3, the reconstruction efficiency was improved under any promoter, but by expressing N, P, and L using the EF1 promoter, the SeV reconstruction efficiency was increased to 48 times compared with CAG (conventional plasmid).

[0287] (13) SeV reconstruction in the presence of a combination of PKR inhibitors

[0288] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F or a cell population containing only Vero-F was used. As pSeV, pSeV+EmGFP / TSdF was used. As PKR inhibitors, VAI and E3Y3 were used. As plasmids for SeV reconstruction, CAGnpEFL was used for LLC-MK2-F, and CAGnpEFL and EFnpL were used for Vero-F. As a result, Fig.10 As shown, by combining with a PKR inhibitor, the SeV reconstitution efficiency was increased to more than 1000-fold compared to the control without the PKR inhibitor.

[0289] In addition, if Fig.11 As shown, compared with the control without PKR inhibitor, the infection titer of the culture supernatant on the third day from the start of SeV reconstruction in the LLC-MK2-F cell reconstruction system was increased to 16857 times, and the infection titer of the culture supernatant on the third day from the start of SeV reconstruction in the VERO-F cell reconstruction system was increased to 7460 times.

[0290] (14) Reconstruction of SeV carrying PKR inhibitory factor

[0291] The SeV reconstruction efficiency was evaluated for SeV carrying a gene encoding a PKR inhibitor. A cell population containing only LLC-MK2-F was used as a cell. CAGnpEFL was used as a plasmid for SeV reconstruction. As pSeV, pSeV(PM)EmGFP / TSdF, pSeV(PM)EmGFP-VAI74a / TSdF (carrying VAI(180bp)74a), and pSeV(PM)EmGFP-VAI74aL / TSdF (carrying VAI(330bp)74a) were used. EmGFP-VAI74a has the sequence shown in sequence number 32. EmGFP-VAI74aL has the sequence shown in sequence number 33.

[0292] The results are as follows Fig.12 and 13 As shown. Fig.12As shown in Figure 2, compared with the reconstruction efficiency of the control (EmGFP), the reconstruction efficiency of SeV carrying VAI (180 bp) 74a was increased by 3 times, and the reconstruction efficiency of SeV carrying VAI (330 bp) 74a was increased by 16 times. Fig.13 As shown, the infection titer of the culture supernatant on the third day from the start of SeV reconstruction was 3 times that of the control (EmGFP) for SeV carrying VAI(180bp)74a and 66 times that for SeV carrying VAI(330bp)74a.

[0293] (14-2) Effect of adding a 5' sequence or a 3' sequence to the sequence of VAI (180 bp) 74c

[0294] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP / TSdF was used for pSeV. As plasmids containing PKR inhibitors, pT7-VAI(180bp)74c, pT7-VAI(264bp)74c3p, pT7-VAI(246bp)74c5p, and pT7-VAI(330bp)74c were used. VAI(264bp)74c3p (sequence number 34) is an 84mer with the 3' side of VAI added to the 3' side of VAI(180bp)74c. In addition, VAI(246bp)74c5p (sequence number 35) is an 86mer with the 5' side of VAI added to the 5' side of VAI(180bp)74c.

[0295] If the fluorescence intensity of EmGFP-derived cells from day 3 after reconstitution is compared with that in the presence of pT7-VAI(180bp)74c, then Fig.14 As shown, pT7-VAI (264 bp) 74c3p was 2.1 times, pT7-VAI (246 bp) 74c5p was 6.8 times, and pT7-VAI (330 bp) 74c was 15.7 times. This suggests that the 5' side sequence of VAI is very helpful in improving the reconstruction efficiency.

[0296] (15) Effect of EBER1 integration on viral proliferation

[0297] As cells for SeV reconstruction, a cell group containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP / TSdF was used for pSeV. As a plasmid containing a PKR inhibitor, pT7-EBER (337 bp) was used. In this plasmid, the sequences before and after VAI were introduced before and after EBER1, respectively. If the fluorescence intensity of the EmGFP source from cells on the third day after reconstruction was compared, it was 3.8 times that of the control in the presence of EBER1 (337 bp).

[0298] (16) Effect of NS5A148 integration on viral proliferation

[0299] As cells for SeV reconstruction, a cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP / TSdF was used for pSeV. As a plasmid containing a PKR inhibitor, pCAGGS-NS5A148 was used. This plasmid produces NS5A148 having the amino acid sequence recorded in sequence number 16. If the fluorescence intensity derived from EmGFP from cells on the third day after reconstruction is compared, it is 7.3 times that of the control in the presence of NS5A148.

[0300] (17) Introduction of hammerhead ribozyme sequences

[0301] As cells for SeV reconstruction, a cell population containing only Vero-F or a cell population containing only cloned Vero-F-E3Y3 was used. CAGnpEFL was used as the plasmid for SeV reconstruction. pSeV used was pSeV+EmGFP / TSdF or pSeV+EmGFP / TSdF(Hh) having a hammerhead ribozyme sequence (sequence number 36) under the T7 promoter sequence. When the fluorescence intensity of the EmGFP source from cells on the third day after reconstruction was compared, no EmGFP-positive cells were observed in Vero-F cells using pSeV+EmGFP / TSdF (control: Ctrl), whereas EmGFP-positive cells were observed in Vero-F-E3Y3 cells. Fig.15 As shown, the fluorescence intensity of EmGFP in Vero-F-E3Y3 cells using pSeV+EmGFP / TSdF(Hh) was 37.7 times higher than that in Vero-F cells.

[0302] The experiment was further conducted. A vector (pSeV / TSdF(Hh)) was prepared in which a hammerhead ribozyme (Hh-Rbz) sequence was configured between the T7 promoter of the plasmid to be transcribed into the SeV genome and the region encoding the SeV genome. As Hh-Rbz, Hh-Rbz having the sequence recorded in sequence number 36 was used. A vector (pSeV / TSdF(Hv)) was further prepared in which an HDV ribozyme (HDV-Rbz) sequence was configured immediately downstream of the region encoding the SeV genome, and VAI (330bp) 74c was further configured downstream thereof. As HDV-Rbz, HDV-Rbz having the sequence recorded in sequence number 37 was used. A T7 terminator (sequence number 38) was configured downstream of VAI (330bp) 74c. Thus, when the SeV genome is transcribed, only the SeV genome portion is cut out by the action of the hammerhead ribozyme and the HDV ribozyme, and other factors such as VAI are removed from the SeV genome. A cell population containing only LLC-MK2-F was used. The plasmid used for SeV reconstruction was CAGnpEFL. The plasmids used for pSeV were pSeV+EmGFP / TSdF (control), pSeV+EmGFP / TSdF (Hh), and pSeV+EmGFP / TSdF (Hv). When the fluorescence intensity derived from EmGFP in cells on day 3 after reconstruction was compared, the results were as follows: Fig.16 As shown, the expression of pSeV+EmGFP / TSdF(Hh) was 52.5 times that of the control, and that of pSeV+EmGFP / TSdF(Hv) was 506.7 times that of the control.

[0303] The following primer set for amplifying the L gene of the SeV genome (L primer) and primer set for amplifying VAI (330 bp) 74c (Hv primer) were used to investigate whether VAI (330 bp) 74c was integrated into the obtained SeV genome.

[0304] Forward primer for L gene amplification: TGGGTCATTCCCTGACCAGA (SEQ ID NO: 39)

[0305] Reverse primer for L gene amplification: CAGCTTCGATCGTTCTGCAC (SEQ ID NO: 40)

[0306] Forward primer for VAI amplification: ATCGAGCCTTATGACAGC (SEQ ID NO: 41)

[0307] Reverse primer for VAI amplification: GATACCCTTGCGAATTTATCCACC (SEQ ID NO: 42)

[0308] The SeV genome transcribed in the above manner was recovered from Vero cells and cDNA was synthesized. KOD OnePCR Master Mix -Blue- (Toyobo) was used as the PCR enzyme. Fig.17 As shown, the primer set for amplifying the L gene (L primer) amplified a portion of the L gene in the plasmid (pSeV) carrying the gene encoding SeV as expected, and also amplified a portion of the L gene in the SeV genome as expected. In contrast, the Hv primer did not amplify VAI (330 bp) 74c in the SeV genome. This suggests that after the SeV genome was transcribed from the plasmid, the HDV ribozyme cut off and lost VAI (330 bp) 74c from the SeV genome. Fig.16 As shown, the SeV reconstruction efficiency was improved even in this case.

[0309] (18) Introduction of VAI (330 bp) 74c into SeV reconstruction plasmid

[0310] The above (17) describes the introduction of VAI (330 bp) 74c into a plasmid carrying a gene encoding the SeV genome. In this example, VAI (330 bp) 74c was introduced into a plasmid expressing constituent elements of SeV particles for reconstructing SeV. Specifically, the reconstruction experiment was carried out as follows.

[0311] VAI (330 bp) 74c was added to reconstruction plasmids such as pCAGGS and pEF1 that express NP, P, L, T7, and F5R, respectively, to obtain reconstruction plasmids carrying VAI (330 bp) 74c (respectively denoted as "pCAGGSv" and "pEFv"). pCAGGSv-NPco, pCAGGSv-P4C(-)co, pEFv-Lco, pCAGGSv-T7mco and pCAGGSv-F5Rco, and the combination were denoted as vCAGnpEFL. As cells for reconstruction, a cell population containing only LLC-MK2-F was used. As a plasmid for SeV reconstruction, vCAGnpEFL was used. As a control, CAG was used. As pSeV, pSeV+EmGFP / TSdF was used. If the fluorescence intensity of the EmGFP source from cells on the third day after reconstruction is compared, as shown in FIG. Fig.18 As shown, vCAGnpEFL-mix was 43 times that of the control.

[0312] (19) Introduction of VAI (330 bp)74c into SeV reconstruction plasmid

[0313] Regarding the above (18), the experiment was conducted under the condition that E3Y3 was further introduced. As pSeV, pSeV+EmGFP / TSdF (control) and pSeV+EmGFP / TSdF (Hv) were used. When the fluorescence intensity derived from EmGFP in cells on day 3 after reconstruction was compared, the results were as follows: Fig.19 As shown in Figure 2, Hv+vCAGnpEFL-mix+E3Y3 is 2836 times that of the control. Fig. 20 As shown, Hv+vCAGnpEFL-mix+E3Y3 was 29925 times that of the control. It should be noted that SeV can be reconstructed even without using F5R and E3Y3 during reconstruction.

[0314] (20) Regarding other carrier compositions

[0315] SeV genome plasmids that operate through CAG promoter or EF1 promoter in addition to T7 promoter were constructed (refer to Fig.21A ). The SeV genomic plasmid with CAG promoter was recorded as pCAGGS-SeV, and the SeV genomic plasmid with EF1 promoter was recorded as pEF1-SeV. As cells for reconstruction, a cell population containing only LLC-MK2-F was used. As a plasmid for SeV reconstruction, CAGnpEFL was used. As SeV genomic plasmids, pSeV+EmGFP / TSdF(Hv), pCAG-SeV+EmGFP / TSdF(Hv), or pEF1-SeV+EmGFP / TSdF(Hv) were used. If the fluorescence intensity of the EmGFP-derived cells from the cells on the third day after reconstruction was compared, as shown in FIG. Fig. 21B As shown, pCAG-SeV was 1.44 times that of the control (pSeV), and pEF1-SeV was 1.6 times that of the control (pSeV).

[0316] (21) Reconstruction of paramyxoviruses other than SeV (MuV)

[0317] As cells for reconstruction of mumps virus (MuV; genus Parvovirus, family Paramyxoviridae), a cell population containing only LLC-MK2 was used. As a plasmid for reconstruction of MuV, MuV-mix was used. MuV-mix contains the following plasmids: pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L, pCAGGS-T7mco. As pMuV, pMuV+EmGFP / mini was used. As a plasmid containing a PKR inhibitor, pT7-VAI (330bp) 74c was used. The reference sequence of the MuV genome is the sequence registered with accession number: KY295913. The MuV minigenome is produced by removing all the sequences between the leader sequence and the trailing sequence from the above reference sequence.

[0318] In summary, the following plasmids were used in the reconstruction of MuV.

[0319] pMuV+EmGFP / mini

[0320] pCAGGS-MuV-N

[0321] pCAGGS-MuV-P

[0322] pCAGGS-MuV-L

[0323] pCAGGS-T7mco

[0324] If the fluorescence intensity of the MuV-reconstituted EmGFP-derived cells from day 3 post-reconstitution is compared to the control, as shown in Fig. 22 As shown, it was 184 times in the presence of VAI (330 bp) 74c.

[0325] (22) Reconstruction of paramyxoviruses other than SeV (MeV)

[0326] As cells for reconstruction of measles virus (MeV; Morbillivirus, Paramyxoviridae), a cell population containing only LLC-MK2 was used. As a plasmid for MeV reconstruction, MeV-mix was used. MeV-mix contains the following plasmids: pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L, pCAGGS-T7mco. As pMeV, pMeV+EmGFP / mini was used. As a plasmid containing a PKR inhibitor, pT7-VAI (330bp) 74c was used. The reference sequence of MeV is the sequence registered with accession number: KY295921. The mini-genome of MeV is produced by removing all the sequences between the leader sequence and the trailing sequence from the above-mentioned reference sequence.

[0327] In summary, the following plasmids were used in the reconstruction of MeV.

[0328] pMeV+EmGFP / mini

[0329] pCAGGS-MeV-N

[0330] pCAGGS-MeV-P

[0331] pCAGGS-MeV-L

[0332] pCAGGS-T7mco

[0333] pT7-VAI(330)74c

[0334] If the fluorescence intensity of the EmGFP-derived MeV reconstituted from cells at day 3 after reconstitution is compared to the control, as shown in Fig.23 As shown, the reconstitution efficiency of MeV in the presence of VAI(330bp)74c was 120 times that of the control.

[0335] (23) Reconstruction of paramyxoviruses other than SeV (VSV)

[0336] As cells for reconstruction of vesicular stomatitis virus (VSV; Rhabdoviridae, genus Vesicular virus), a cell population containing only LLC-MK2 was used. In the reconstruction of VSV, VSV-mix (containing pCAGGS-VSV-N, pCAGGS-VSV-P, pCAGGS-VSV-L and pCAGGS-T7mco) was used. As a VSV genome plasmid, pVSV-ΔG-GFP-2.6 (Kerafast) was used. As a PKR inhibitor, pCAGGS-E3Y3 was used.

[0337] If the fluorescence intensity of EGFP-derived cells from day 7 after reconstitution is compared, then Fig.24 As shown, the fluorescence intensity was 5-fold higher when E3Y3 was used.

[0338] (24) Reconstruction of SeV, MeV, and MuV using heterologous RNA polymerases

[0339] Hereinafter, a plasmid mixture for SeV reconstruction containing pCAGGS-NPco(SeV), pCAGGS-P4C(-)co(SeV), pEF1-Lco(SeV), and pCAGGS-T7mco will be referred to as "SeV-mix". In addition, a plasmid mixture for MeV reconstruction containing pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L, and pCAGGS-T7mco will be referred to as "MeV-mix". Furthermore, a plasmid mixture for MuV reconstruction containing pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L, and pCAGGS-T7mco will be referred to as "MuV-mix".

[0340] The MeV genome plasmid used was pMeV+EmGFP / mini, which is a MeV minigenome that does not express MeV constituent proteins (N, P, M, F, H, L) and carries EmGFP. The MuV genome plasmid used was pMuV+EmGFP / mini, which is a MuV minigenome that does not express MuV constituent proteins (N, P, M, F, SH, HN, L) and carries EmGFP. The SeV genome plasmid used was pSeV+EmGFP / TSdF(Hv). As these reconstruction cells, a cell population containing only LLC-MK2-F was used.

[0341] If the fluorescence intensity of EmGFP-derived cells from day 3 after reconstitution is compared, then Fig.25 As shown, the SeV genome can be reconstructed not only by SeV-mix, but also by heterologous polymerases such as MeV-mix and MuV-mix. Similarly, the MeV genome and MuV genome can be reconstructed by heterologous polymerases. When the fluorescence intensity of the SeV genome reconstructed using SeV-mix was set to 1 for comparison, the fluorescence intensity was 0.68 when MeV-mix was used, and the fluorescence intensity was 0.65 when MuV-mix was used (refer to Figure 27). When the fluorescence intensity of the MeV genome reconstructed using MeV-mix was set to 1 for comparison, the fluorescence intensity was 0.31 when SeV-mix was used, and the fluorescence intensity was 0.71 when MuV-mix was used (refer to Fig.25 ). When the fluorescence intensity of the MuV genome reconstructed using MuV-mix was set to 1 for comparison, the fluorescence intensity was 1.22 when SeV-mix was used and 0.86 when MeV-mix was used (refer to Fig.25 ).

[0342] (25) VSV construction using heterologous RNA polymerase

[0343] As cells for VSV reconstruction, a cell population containing only LLC-MK2 was used. SeV-mix was used for VSV reconstruction. As a VSV genome plasmid, pVSV-ΔG-GFP-2.6 (Kerafast) was used. As a PKR inhibitor, pCAGGS-E3Y3 was used.

[0344] If the fluorescence intensity of EGFP-derived cells from day 3 after reconstitution is compared, then Fig.26 As shown, when it was confirmed that the VSV genome was reconstructed with SeV-mix and E3Y3 was additionally introduced into the cells, the fluorescence intensity was 47.5 times higher than that in the absence of E3Y3.

[0345] A plasmid (p3vLPNP) expressing NP, P and L was constructed (refer to Fig.27A ). pSeV was driven by the CAG promoter (pCAG-SeV) or the EF1 promoter (pEF1-SeV), thereby avoiding the use of T7 polymerase. SeV was reconstituted in a cell population containing only LLC-MK2 in the same manner as above. Fig.27B As shown. Fig.27B As shown, 7 days after reconstruction, fluorescence of EmGFP was observed in both pCAG-SeV and pEF1-SeV, confirming that SeV was reconstructed. However, when T7 polymerase was further supplied from the pCAGGS-T7mco plasmid, the reconstruction efficiency was greatly improved.

[0346] (26) Carrying of T7 polymerase sequence

[0347] Furthermore, a plasmid (p3vLPT7NP) expressing NP, P, L and T7 polymerase was constructed (refer to Fig.28A ), a plasmid expressing the SeV genome and T7 polymerase (pEF-T7-SeV) (refer to Fig.28B ). SeV was reconstructed using cell populations containing only LLC-MK2-F or only Vero-F in the same manner as above. Fig.28C As shown. Fig.28C As shown in Figure 2, fluorescence of EmGFP was observed in both LLC-MK2 and Vero. The infection titer was evaluated using the culture supernatant 8 days after reconstruction. The reconstruction efficiency was greatly improved by using a plasmid carrying T7 polymerase (refer to Fig.28C In theory, it is possible to integrate all factors used for SeV reconstruction into one vector and to recover SeV from packaging cells using only one vector. In particular, it is considered that the factors on the viral genome can be supplied to packaging cells by being operably linked to a promoter that sufficiently drives the expression of genes encoding each factor in packaging cells, which can contribute to minimizing the vector size.

[0348] (27) Preparation of packaging cells using delivery vectors of F and PKR inhibitory factors

[0349] The gene encoding F and the gene encoding the PKR inhibitory factor are carried in a vector and introduced into packaging cells to obtain packaging cells expressing the gene encoding F and the gene encoding the PKR inhibitory factor in the form of a stable strain. As the PKR inhibitory factor, VAI (330 bp) 74c (see sequence number 23) was used. The insertion position of VAI is not particularly limited, but in this embodiment, the sequence encoding VAI is introduced downstream of the gene encoding F (see Fig.29A ). These carrier genes can be driven by any promoter, but in this embodiment, they are driven by the CAG promoter (see Fig.29A). Among them, the vector is constructed in the following manner: there is a region sandwiched by two site-specific recombination sequences (here loxP) between the CAG promoter and the gene encoding F, and the region sandwiched by loxP is removed using Cre recombinase or the like, thereby strongly driving the gene encoding F through the CAG promoter. A gene encoding a fusion protein formed by connecting iCaspase9 and NeoR (neomycin resistance gene) with a 2A sequence is carried between loxP. As a result, clones (including clones with a large number of introduced copies) whose expression level of NeoR is high enough to survive in the presence of a certain concentration of drugs such as G418 can be selected. Based on this design concept, the pCALiNdLv-F vector (JOURNAL OFVIROLOGY, Feb. 1998, p. 1115-1121) was constructed from the pCALNdL vector ( Fig.29A ). In SeV-Cre, a gene encoding Cre recombinase is carried at the + position, and mEmerald, a fluorescent protein, is carried at the MHN position. Thus, viral proliferation can be confirmed by the fluorescence of mEmerald. SeV-Cre can also be set as: a genome showing temperature sensitivity that is removed from cells in a temperature-dependent manner.

[0350] After the pCALiNdLv-F vector was introduced into LLC-MK2 cells and Vero cells, drug selection using G418 was performed at 37°C. SeV-Cre was introduced into the obtained clones. As a result, Fig.29BAs shown, SeV-Cre proliferated well in both LLC-MK2 cells and Vero cells. In the first (1st) infected cell, the loxP was removed and the expression of F was induced. As a result, the production of SeV-Cre was observed, and when the supernatant was further used to infect the second (2nd) cell, the second cell was infected, indicating that SeV with infectious ability was produced. It should be noted that the same is true when the gene encoding F is driven by the EF1α promoter in the above-mentioned plasmid. More specifically, it is suggested that high-expressing clones of F and PKR inhibitors can be selected by drug selection using G418 in LLC-MK2 cells and Vero cells (for LLC-MK2 cells, 1.3 to 2.5 mg / mL of G418 is used, and for Vero cells, 0.9 to 1.5 mg / mL of G418 is used), and that the sequence between loxP is removed by the action of the Cre recombinase carried by SeV, and F is highly expressed. As a result, the production of SeV was confirmed in the first cell, and the second cell was also infected, thereby clarifying that a virus with infection ability was produced in the first cell. This suggests that the above-mentioned plasmid becomes a useful tool for making packaging cells from the first cell (usually LLC-MK2 cells and Vero cells). It is believed that when using this system, SeV-Cre remains in the first cell. Therefore, by removing SeV-Cre in the first cell afterwards, the obtained cells can be effectively used as packaging cells for SeV reconstruction. The removal of SeV-Cre can also be carried out by simple cell passage, but in order to improve the removal efficiency, various methods such as the use of temperature-sensitive strains and the effective use of microRNA are known, and it can be appropriately removed. By expressing F, LLC-MK2 cells and Vero cells can be used as packaging cells, but it is understood that F can be supplied from the cell side, can be supplied by plasmids, and can also be supplied by the Sendai virus genome. The supply of factors of the present invention is also the same.

[0351] Description of the sequence listing

[0352] SEQ ID NO: 1: Example of EF1α promoter sequence

[0353] SEQ ID NO: 2: Example of a CAG promoter sequence

[0354] SEQ ID NO: 3: Example of a sequence of a gene encoding EmGFP

[0355] Sequence number 4: Sequence of EBER of Epstein-Barr virus

[0356] Sequence number 5: Sequence of HIV TAR

[0357] Sequence number 6: 2A of poliovirus pro

[0358] Sequence number 7: E3L of vaccinia virus

[0359] Sequence number 8: Reovirus σ3

[0360] Serial number 9: Human p58 IPK

[0361] Sequence number 10: Vaccinia virus K3L

[0362] Sequence number 11: HIV Tat

[0363] Sequence number 12: ICP34.5 of herpes simplex virus

[0364] Serial number 13: nc866

[0365] Serial No. 14: Extended version of nc866

[0366] Serial No. 15: NS5A

[0367] SEQ ID NO: 16: NS5A (1-148)

[0368] SEQ ID NO: 17: VAI (180mer)

[0369] Serial No. 18: VAI (c.74U>V)

[0370] SEQ ID NO: 19: VAI (330mer)

[0371] SEQ ID NO: 20: VAI (330mer; c.74U>V)

[0372] Serial No. 21: VAI-VAII

[0373] SEQ ID NO: 22: VAI (180mer: c.74U>M)

[0374] SEQ ID NO: 23: VAI (330mer: c.74U>M)

[0375] SEQ ID NO: 24: VAI (330mer; c.191C>D)

[0376] SEQ ID NO: 25: VAI (330mer; c.74U>V, c.191C>D)

[0377] SEQ ID NO: 26: VAI (330mer; c.74U>M, c.191C>G)

[0378] SEQ ID NO: 27: C-terminal 106 amino acids of Sendai virus C protein

[0379] Sequence number 28: NS1 of influenza virus

[0380] Sequence number 29: Herpes simplex virus Us11

[0381] SEQ ID NO: 30: Fusion protein E3K3

[0382] SEQ ID NO: 31: Fusion protein E3Y3

[0383] SEQ ID NO: 32: EmGFP-VAI (74U>A)

[0384] SEQ ID NO: 33: EmGFP-VAI74aL (74U>A)

[0385] SEQ ID NO: 34: VAI (264 bp) 74c3p

[0386] SEQ ID NO: 35: VAI (246 bp) 74c5p

[0387] SEQ ID NO: 36: An example of a sequence of Hh-Rbz

[0388] Sequence No. 37: An example of a sequence of HDV-Rbz

[0389] SEQ ID NO: 38: An example of a T7 terminator sequence

[0390] SEQ ID NO: 39: Forward primer for L gene amplification

[0391] SEQ ID NO: 40: Reverse primer for L gene amplification

[0392] SEQ ID NO: 41: Forward primer for VAI amplification

[0393] SEQ ID NO: 42: Reverse primer for VAI amplification

[0394] 3-1 Sequence

[0395] 3-1-1 Serial number [ID] 1

[0396] 3-1-2 Molecular Type DNA

[0397] 3-1-3 Length 1179

[0398] 3-1-4-1 Feature location / qualifier misc_feature 1..1179

[0399] note=EF1alpha

[0400] 3-1-4-2 Feature location / qualifier source 1..1179

[0401] mol_type = Other DNA

[0402] Organism = Synthetic Construct

[0403] 3-1-5 residue

[0404] ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60

[0405] ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120

[0406] gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180

[0407] gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtaagtgcc 240

[0408] gtgtgtggtt cccgcgggcc tggcctcttt acgggttatg gcccttgcgt gccttgaatt 300

[0409] acttccacct ggctgcagta cgtgattctt gatcccgagc ttcgggttgg aagtgggtgg 360

[0410] gagagttcga ggccttgcgc ttaaggagcc ccttcgcctc gtgcttgagt tgaggcctgg 420

[0411] cctgggcgct ggggccgccg cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct 480

[0412] ttcgataagt ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg 540

[0413] caagatagtc ttgtaaatgc gggccaagat ctgcacactg gtatttcggt ttttggggcc 600

[0414] gcgggcggcg acggggcccg tgcgtcccag cgcacatgtt cggcgaggcg gggcctgcga 660

[0415] gcgcggccac cgagaatcgg acgggggtag tctcaagctg gccggcctgc tctggtgcct 720

[0416] ggcctcgcgc cgccgtgtat cgccccgccc tgggcggcaa ggctggcccg gtcggcacca 780

[0417] gttgcgtgag cggaaagatg gccgcttccc ggccctgctg cagggagctc aaaatggagg 840

[0418] acgcggcgct cgggagagcg ggcgggtgag tcacccacac aaaggaaaag ggcctttccg 900

[0419] tcctcagccg tcgcttcatg tgactccacg gagtaccggg cgccgtccag gcacctcgat 960

[0420] tagttctcga gcttttggag tacgtcgtct ttaggttggg gggaggggtt ttatgcgatg 1020

[0421] gagtttcccc acactgagtg ggtggagact gaagttaggc cagcttggca cttgatgtaa 1080

[0422] ttctccttgg aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca 1140

[0423] gtggttcaaa gtttttttct tccatttcag gtgtcgtga 1179

[0424] 3-2 Sequence

[0425] 3-2-1 Serial number [ID]2

[0426] 3-2-2 Molecular Type DNA

[0427] 3-2-3 Length 1676

[0428] 3-2-4-1 Feature location / qualifier misc_feature 1..1676

[0429] note= CAG promoter

[0430] 3-2-4-2 Feature location / qualifier source 1..1676

[0431] mol_type = Other DNA

[0432] Organism = Synthetic Construct

[0433] 3-2-5 residues

[0434] gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60

[0435] catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120

[0436] acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180

[0437] ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240

[0438] aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300

[0439] ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360

[0440] tagtcatcgc tattaccatg gtcgaggtga gccccacgtt ctgcttcact ctccccatct 420

[0441] cccccccctc cccaccccca attttgtatt tatttatttt ttaattattt tgtgcagcga 480

[0442] tgggggcggg gggggggggg gggcgcgcgc caggcggggc ggggcggggc gaggggcggg 540

[0443] gcggggcgag gcggagaggt gcggcggcag ccaatcagag cggcgcgctc cgaaagtttc 600

[0444] cttttatggc gaggcggcgg cggcggcggc cctataaaaa gcgaagcgcg cggcgggcgg 660

[0445] gagtcgctgc gcgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc 720

[0446] cccggctctg actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc 780

[0447] cgggctgtaa ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa 840

[0448] gccttgaggg gctccgggag ggccctttgt gcggggggag cggctcgggg ggtgcgtgcg 900

[0449] tgtgtgtgtg cgtggggagc gccgcgtgcg gctccgcgct gcccggcggc tgtgagcgct 960

[0450] gcgggcgcgg cgcggggctt tgtgcgctcc gcagtgtgcg cgaggggagc gcggccgggg1020

[0451] gcggtgcccc gcggtgcggg gggggctgcg aggggaacaa aggctgcgtg cggggtgtgt1080

[0452] gcgtgggggg gtgagcaggg ggtgtgggcg cgtcggtcgg gctgcaaccc cccctgcacc1140

[0453] cccctccccg agttgctgag cacggcccgg cttcgggtgc ggggctccgt acggggcgtg1200

[0454] gcgcggggct cgccgtgccg ggcggggggt ggcggcaggt gggggtgccg ggcggggcgg1260

[0455] ggccgcctcg ggccggggag ggctcggggg aggggcgcgg cggcccccgg agcgccggcg1320

[0456] gctgtcgagg cgcggcgagc cgcagccatt gccttttatg gtaatcgtgc gagagggcgc1380

[0457] agggacttcc tttgtcccaa atctgtgcgg agccgaaatc tgggaggcgc cgccgcaccc1440

[0458] cctctagcgg gcgcggggcg aagcggtgcg gcgccggcag gaaggaaatg ggcggggagg1500

[0459] gccttcgtgc gtcgccgcgc cgccgtcccc ttctccctct ccagcctcgg ggctgtccgc1560

[0460] ggggggacgg ctgccttcgg gggggacggg gcagggcggg gttcggcttc tggcgtgtga1620

[0461] ccggcggctc tagagcctct gctaaccatg ttcatgcctt cttctttttc ctacag 1676

[0462] 3-3 Sequence

[0463] 3-3-1 Serial number [ID] 3

[0464] 3-3-2 Molecular Type DNA

[0465] 3-3-3 Length 732

[0466] 3-3-4-1 Feature location / qualifier misc_feature 1..732

[0467] note=EmGFP

[0468] 3-3-4-2 Feature location / qualifier source 1..732

[0469] mol_type = Other DNA

[0470] Organism = Synthetic Construct

[0471] 3-3-5 residues

[0472] atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

[0473] ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

[0474] ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

[0475] ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240

[0476] cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

[0477] ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

[0478] gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

[0479] aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480

[0480] ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540

[0481] gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

[0482] tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

[0483] ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

[0484] tgataaccct ga 732

[0485] 3-4 Sequence

[0486] 3-4-1 Serial number [ID] 4

[0487] 3-4-2 Molecular Type RNA

[0488] 3-4-3 Length 708

[0489] 3-4-4-1 Feature location / qualifier misc_feature 1..708

[0490] note = EBV EBER

[0491] 3-4-4-2 Feature location / qualifier source 1..708

[0492] mol_type = other RNA

[0493] organism = synthetic construct

[0494] 3 - 4 - 5 residues

[0495] ccataaagcc tagggtgtaa aacaccgacc gcgccaccag atggcacacg tgggggaaat 60

[0496] gagggttagc ataggcaacc cccgcctaca caccaactat agcaaacccc gccccgtcac 120

[0497] ggtgacgtag tctgtcttga ggagatgtag acttgtagac actgcaaaac ctcaggacct 180

[0498] acgctgccct agaggttttg ctagggagga gacgtgtgtg gctgtagcca cccgtcccgg 240

[0499] gtacaagtcc cgggtggtga ggacggtgtc tgtggttgtc ttcccagact ctgctttctg 300

[0500] ccgtcttcgg tcaagtacca gctggtggtc cgcatgtttt gatccaaact tttgttttag 360

[0501] gatttatgca tccattatcc cgcagttcca cctaaacggg gcttaacgtt gcatcccaga 420

[0502] agatgcacgc ttaaccccgc ctacaaccgt gacgtagctg tttaccagca tgtatagagt 480

[0503] tacggttcgc tacatcaaac aggacagccg ttgccctagt ggtttcggac acaccgccaa 540

[0504] cgctcagtgc ggtgctaccg acccgaggtc aagtcccggg ggaggagaag agaggcttcc 600

[0505] cgcctagagc atttgcaagt caggattctc taatccctct gggagaaggg tattcggctt 660

[0506] gtccgctatttttttgtggc tagttttgca cccacaacat gtaaaggg 708

[0507] 3-5 Sequence

[0508] 3-5-1 Serial number [ID] 5

[0509] 3-5-2 Molecular Type RNA

[0510] 3-5-3 Length 57

[0511] 3-5-4-1 Feature location / qualifier misc_feature 1..57

[0512] note= HIV TAR

[0513] 3-5-4-2 Feature location / qualifier source 1..57

[0514] mol_type = Other RNA

[0515] Organism = Synthetic Construct

[0516] 3-5-5 residues

[0517] ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacc 57

[0518] 3-6 Sequence

[0519] 3-6-1 Serial number [ID] 6

[0520] 3-6-2 Molecular Type AA

[0521] 3-6-3 Length 149

[0522] 3-6-4-1 Feature Location / Qualifier REGION 1..149

[0523] note= Polio virus 2Apro

[0524] 3-6-4-2 Feature Position / Qualifier source 1..149

[0525] mol_type = protein

[0526] Organism = Synthetic Construct

[0527] 3-6-5 residues

[0528] GFGHQNKAVY TAGYKICNYH LATQDDLQNA VNVMWSRDLL VTESRAQGTD SIARCNCNAG 60

[0529] VYYCESRRKY YPVSFVGPTF QYMEANNYYP ARYQSHMLIG HGFASPGDCG GILRCHHGVI 120

[0530] GIITAGGEGL VAFSDIRDLY AYEEEAMEQ 149

[0531] 3-7 Sequence

[0532] 3-7-1 Serial number [ID] 7

[0533] 3-7-2 Molecular Type AA

[0534] 3-7-3 Length 190

[0535] 3-7-4-1 Feature Location / Qualifier REGION 1..190

[0536] note= Vaccinia virus E3L

[0537] 3-7-4-2 Feature location / qualifier source 1..190

[0538] mol_type = protein

[0539] Organism = Synthetic Construct

[0540] 3-7-5 residues

[0541] MSKIYIDERS NAEIVCEAIK TIGIEGATAA QLTRQLNMEK REVNKALYDL QRSAMVYSSD 60

[0542] DIPPRWFMTT EADEADAM SDVIIDDVSR EKSMREDHKS FDDVIPAKKI IDWKGANPVT 120

[0543] VINEYCQITR RDWSFRIESV GPSNSPTFYA CVDIDGRVFD KADGKSKRDA KNNAAKLAVD 180

[0544] KLLGYVIIRF 190

[0545] 3-8 Sequence

[0546] 3-8-1 Serial number [ID] 8

[0547] 3-8-2 Molecular Type AA

[0548] 3-8-3 length 365

[0549] 3-8-4-1 Feature Location / Qualifier REGION 1..365

[0550] note= Reovirus sigma 3

[0551] 3-8-4-2 Feature Position / Qualifier source 1..365

[0552] mol_type = protein

[0553] Organism = Synthetic Construct

[0554] 3-8-5 residues

[0555] MEVCLPNGHQ VVDLINNAFE GRVSIYSAQE GWDKTISAQP DMMVCGGAVV CMHCLGVVGS 60

[0556] LQRKLKHLPH HRCNQQIRHQ DYVDVQFADR VTAHWKRGML SFVAQMHEMM NDVSPDDLDR 120

[0557] VRTEGGSLVE LNWLQVDPNS MFRSIHSSWT DPLQVVDDLD TKLDQYWTAL NLMIDSSDLI 180

[0558] PNFMMRDPSH AFNGVKLGGD ARQTQFSRTF DSRSSLEWGV MVYDYSELEH DPSKGRAYRK 240

[0559] ELVTPARDFG HFGLSHYSRA TTPILGKMPA VFSGMLTGNC KMYPFIKGTA KLKTVRKLVE 300

[0560] AVNHAWGVEK IRYALGPGGM TGWYNRTMQQ APIVLTPAAL TMFPDTIKFG DLNYPVMIGD 360

[0561] PMILG 365

[0562] 3-9 Sequence

[0563] 3-9-1Serial number [ID] 9

[0564] 3-9-2 Molecular Type AA

[0565] 3-9-3 Length 504

[0566] 3-9-4-1 Feature Location / Qualifier REGION 1..504

[0567] note=Human p58_IPK

[0568] 3-9-4-2 Feature location / qualifier source 1..504

[0569] mol_type = protein

[0570] Organism = Synthetic Construct

[0571] 3-9-5 residues

[0572] MVAPGSVTSR LGSVFPFLLV LVDLQYEGAE CGVNADVEKH LELGKKLLAA GQLADALSQF 60

[0573] HAAVDGDPDN YIAYYRRATV FLAMGKSKAA LPDLTKVIQL KMDFTAARLQ RGHLLLKQGK 120

[0574] LDEAEDDFKK VLKSNPSENE EKEAQSQLIK SDEMQRLRSQ ALNAFGSGDY TAAIAFLDKI 180

[0575] LEVCVWDAEL RELRAECFIK EGEPRKAISD LKAASKLKND NTEAFYKIST LYYQLGDHEL 240

[0576] SLSEVRECLK LDQDHKRCFA HYKQVKKLNK LIESAEELIR DGRYTDATSK YESVMKTEPS 300

[0577] IAEYTVRSKE RICHCFSKDE KPVEAIRVCS EVLQMEPDNV NALKDRAEAY LIEEMYDEAI 360

[0578] QDYETAQEHN ENDQQIREGL EKAQRLLKQS QKRDYYKILG VKRNAKKQEI IKAYRKLALQ 420

[0579] WHPDNFQNEE KKKAEKKFI DIAAAKEVLS DPEMRKKFDD GEDPLDAESQ QGGGGNPFHR 480

[0580] SWNSWQGFNP FSSGGPFRFK FHFN 504

[0581] 3-10 Sequence

[0582] 3-10-1Serial number [ID] 10

[0583] 3-10-2 Molecular Type AA

[0584] 3-10-3 Length 88

[0585] 3-10-4-1 Feature Location / Qualifier REGION 1..88

[0586] note= Vaccinia virus K3L

[0587] 3-10-4-2 Feature location / qualifier source 1..88

[0588] mol_type = protein

[0589] Organism = Synthetic Construct

[0590] 3-10-5 residues

[0591] MLAFCYSLPN AGDVIKGRVY EKDYALYIYL FDYPHSEAIL AESVKMHMDR YVEYRDKLVG 60

[0592] KTVKVKVIRV DYTKGYIDVN YKRMCRHQ 88

[0593] 3-11 Sequence

[0594] 3-11-1Serial number [ID] 11

[0595] 3-11-2 Molecular Type AA

[0596] 3-11-3 Length 86

[0597] 3-11-4-1 Feature Location / Qualifier REGION 1..86

[0598] note= HIV Tat

[0599] 3-11-4-2 Feature location / qualifier source 1..86

[0600] mol_type = protein

[0601] Organism = Synthetic Construct

[0602] 3-11-5 residues

[0603] MEPVDPRLEP WKHPGSQPKT ACTNCYCKKC CFHCQVCFIT KALGISYGRK KRRQRRRPPQ 60

[0604] GSQTHQVSLS KQPTSQPRGD PTGPKE 86

[0605] 3-12 Sequence

[0606] 3-12-1Serial number [ID] 12

[0607] 3-12-2 Molecular Type AA

[0608] 3-12-3 Length 248

[0609] 3-12-4-1 Feature Location / Qualifier REGION 1..248

[0610] note=HSV ICP34.5

[0611] 3-12-4-2 Feature location / qualifier source 1..248

[0612] mol_type = protein

[0613] Organism = Synthetic Construct

[0614] 3-12-5 residues

[0615] MARRRRHRGP RRPRPPGPTG AVPTAQSQVT STPNSEPAVR SAPAAAPPPP PAGGPPPSCS 60

[0616] LLLRQWLHVP ESASDDDDDDWPDSPPPEP APEARPTAAA PRPRPPPPGV GPGGGGADPSH 120

[0617] PPSRPFRLPP RLALRLRVTA EHLALRRLRR AGGEGAPEPP ATPATPATPA TPATPARVRF 180

[0618] SPHVRVRHLV VWASAARLAR RGSWARERAD RARFRRRVAE AEAVIGPCLG PEARARALAR 240

[0619] GAGPANSV 248

[0620] 3-13 Sequence

[0621] 3-13-1Serial number [ID] 13

[0622] 3-13-2 Molecular Type RNA

[0623] 3-13-3 Length 108

[0624] 3-13-4-1 Feature location / qualifier misc_feature 1..108

[0625] note=nc866

[0626] 3-13-4-2 Feature location / qualifier source 1..108

[0627] mol_type = Other RNA

[0628] Organism = Synthetic Construct

[0629] 3-13-5 residues

[0630] cgggtcggag ttagctcaag cggttacctc ctcatgccgg actttctatc tgtccatctc 60

[0631] tgtgctgggg ttcgagaccc gcgggtgctt actgaccctt ttatgcaa 108

[0632] 3-14 Sequence

[0633] 3-14-1Serial number [ID] 14

[0634] 3-14-2 Molecular Type RNA

[0635] 3-14-3 Length 272

[0636] 3-14-4-1 Feature location / qualifier misc_feature 1..272

[0637] note = Long nc886

[0638] 3-14-4-2 Feature location / qualifier source 1..272

[0639] mol_type = Other RNA

[0640] Organism = Synthetic Construct

[0641] 3-14-5 residues

[0642] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0643] gagagcctgt aagccgggtc ggagttagct caagcggtta cctcctcatg ccggactttc 120

[0644] tatctgtcca tctctgtgct ggggttcgag acccgcgggt gcttactgac ccttttatgc 180

[0645] aacttccagg cgcggcggct gctgcggtag cttttttggc cactggccgc gcgcggcgta 240

[0646] agcggttagg ctggaaagcg aaagcattaa gt 272

[0647] 3-15 Sequence

[0648] 3-15-1Serial number [ID] 15

[0649] 3-15-2 Molecular Type AA

[0650] 3-15-3 Length 447

[0651] 3-15-4-1 Feature Location / Qualifier REGION 1..447

[0652] note=NS5A

[0653] 3-15-4-2 Feature location / qualifier source 1..447

[0654] mol_type = protein

[0655] Organism = Synthetic Construct

[0656] 3-15-5 residues

[0657] SGSWLRDVWD WICTVLADFK TWLQSKLLPR LPGVPFFSCQ RGYKGVWRGD GIMYTTCPCG 60

[0658] AQITGHVKNG SMRIVGPRTC SNTWHGTFPI NAYTTGPCTP SPAPNYSRAL WRVAAEEYVE 120

[0659] VTRVGDFHYV TGMTTDNVKC PCQVPAPEFF TELDGVRLHR YAPACKPLLR DEVTFQVGLN 180

[0660] QYTVGSQLPC EPEPDVTVVT SMLTDPSHIT AEAARRRLAR GSPPSLASSS ASQLSALSLK 240

[0661] ATCTTHHGAP DTDLIEANLL WRQEMGGNIT RVESENKIVI LDSFEPLRAE EDEREVSVAA 300

[0662] EILRKTRKFP AAMPVWARPD YNPPLLESWK NPDYVPPVVH GCPLPPTKAP PIPPPRRKRT 360

[0663] VVLTESTVS ALAELATKTF GSSGSSAVDS GTATGPPDQA SAEGDAGSDA ESYSSMPPLE 420

[0664] GEPGDPDLSDGSWSTVSEEA SEDVVCC 447

[0665] 3-16 Sequence

[0666] 3-16-1Serial number [ID] 16

[0667] 3-16-2 Molecular Type AA

[0668] 3-16-3 Length 148

[0669] 3-16-4-1 Feature Location / Qualifier REGION 1..148

[0670] note= NS5A (1-148)

[0671] 3-16-4-2 Feature location / qualifier source 1..148

[0672] mol_type = protein

[0673] Organism = Synthetic Construct

[0674] 3-16-5 residues

[0675] SGSWLRDVWD WICTVLADFK TWLQSKLLPR LPGVPFFSCQ RGYKGVWRGD GIMYTTCPCG 60

[0676] AQITGHVKNG SMRIVGPRTC SNTWHGTFPI NAYTTGPCTP SPAPNYSRAL WRVAAEEYVE 120

[0677] VTRVGDFHYV TGMTTDNVKC PCQVPAPE 148

[0678] 3-17 Sequence

[0679] 3-17-1Serial number [ID] 17

[0680] 3-17-2 Molecular Type RNA

[0681] 3-17-3 Length 172

[0682] 3-17-4-1 Feature location / qualifier misc_feature 1..172

[0683] note= VAI RNA

[0684] 3-17-4-2 Feature location / qualifier source 1..172

[0685] mol_type = Other RNA

[0686] Organism = Synthetic Construct

[0687] Residue 3-17-5

[0688] gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgg acgaccgggg 60

[0689] ttcgaacccc ggatccggcc gtccgccgtg atccatgcgg ttaccgcccg cgtgtcgaac 120

[0690] ccaggtgtgc gacgtcagac aacggggggag cgctcctttt ggcttccttc ca 172

[0691] 3-18 Sequence

[0692] 3-18-1Serial number [ID] 18

[0693] 3-18-2 Molecular Type RNA

[0694] 3-18-3 Length 172

[0695] 3-18-4-1 Feature location / qualifier misc_feature 1..172

[0696] note= VAI (c.74U>V)

[0697] 3-18-4-2 Feature location / qualifier source 1..172

[0698] mol_type = Other RNA

[0699] Organism = Synthetic Construct

[0700] 3-18-5 residues

[0701] gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgg acgaccgggg 60

[0702] ttcgaacccc ggavccggcc gtccgccgtg atccatgcgg ttaccgcccg cgtgtcgaac 120

[0703] ccaggtgtgc gacgtcagac aacggggggag cgctcctttt ggcttccttc ca 172

[0704] 3-19 Sequence

[0705] 3-19-1Serial number [ID] 19

[0706] 3-19-2 Molecular Type RNA

[0707] 3-19-3 Length 330

[0708] 3-19-4-1 Feature location / qualifier misc_feature 1..330

[0709] note= VAI long

[0710] 3-19-4-2 Feature location / qualifier source 1..330

[0711] mol_type = Other RNA

[0712] Organism = Synthetic Construct

[0713] Residue 3-19-5

[0714] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0715] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0716] gcggacgacc ggggttcgaa ccccggatcc ggccgtccgc cgtgatccat gcggttaccg 180

[0717] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0718] cttccaggcg cggcggctgc tgcgctagct tttttggcca ctggccgcgc gcggcgtaag 300

[0719] cggttaggct ggaaagcgaa agcattaagt 330

[0720] 3-20 Sequence

[0721] 3-20-1Serial Number [ID] 20

[0722] 3-20-2 Molecular Type RNA

[0723] 3-20-3 Length 330

[0724] 3-20-4-1 Feature location / qualifier misc_feature 1..330

[0725] note= VAI long (c.74>V)

[0726] 3-20-4-2 Feature location / qualifier source 1..330

[0727] mol_type = Other RNA

[0728] Organism = Synthetic Construct

[0729] 3-20-5 residues

[0730] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0731] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0732] gcggacgacc ggggttcgaa ccccggavcc ggccgtccgc cgtgatccat gcggttaccg 180

[0733] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0734] cttccaggcg cggcggctgc tgcgctagct tttttggcca ctggccgcgc gcggcgtaag 300

[0735] cggttaggct ggaaagcgaa agcattaagt 330

[0736] 3-21 Sequence

[0737] 3-21-1Serial number [ID] 21

[0738] 3-21-2 Molecular Type RNA

[0739] 3-21-3 Length 478

[0740] 3-21-4-1 Feature location / qualifier misc_feature 1..478

[0741] note= VAI-VAII

[0742] 3-21-4-2 Feature location / qualifier source 1..478

[0743] mol_type = Other RNA

[0744] Organism = Synthetic Construct

[0745] 3-21-5 residues

[0746] gcgcagtcgt tgacgctcta gaccgtgcaa aaggagagcc tgtaagcggg cactcttccg 60

[0747] tggtctggtg gataaattcg caagggtatc atggcggacg accggggttc gaaccccgga 120

[0748] tccggccgtc cgccgtgatc catgcggtta ccgcccgcgt gtcgaaccca ggtgtgcgac 180

[0749] gtcagacaac gggggagcgc tccttttggc ttccttccag gcgcggcggc tgctgcgcta 240

[0750] gcttttttgg ccactggccg cgcgcggcgt aagcggttag gctggaaagc gaaagcatta 300

[0751] agtggctcgc tccctgtagc cggagggtta ttttccaagg gttgagtcgc aggacccccg 360

[0752] gttcgagtct cgggccggcc ggactgcggc gaacgggggt ttgcctcccc gtcatgcaag 420

[0753] accccgcttg caaattcctc cggaaacagg gacgagcccc ttttttgctt ttcccaga 478

[0754] 3-22 Sequence

[0755] 3-22-1Serial number [ID] 22

[0756] 3-22-2 Molecular Type RNA

[0757] 3-22-3 Length 172

[0758] 3-22-4-1 Feature location / qualifier misc_feature 1..172

[0759] note= VAI (c.74U>M)

[0760] 3-22-4-2 Feature location / qualifier source 1..172

[0761] mol_type = Other RNA

[0762] Organism = Synthetic Construct

[0763] Residue 3-22-5

[0764] gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgg acgaccgggg 60

[0765] ttcgaacccc ggamccggcc gtccgccgtg atccatgcgg ttaccgcccg cgtgtcgaac 120

[0766] ccaggtgtgc gacgtcagac aacggggggag cgctcctttt ggcttccttc ca 172

[0767] 3-23 Sequence

[0768] 3-23-1Serial number [ID] 23

[0769] 3-23-2 Molecular Type RNA

[0770] 3-23-3 Length 330

[0771] 3-23-4-1 Feature location / qualifier misc_feature 1..330

[0772] note= VAI long (c.74U>M)

[0773] 3-23-4-2 Feature location / qualifier source 1..330

[0774] mol_type = Other RNA

[0775] Organism = Synthetic Construct

[0776] Residue 3-23-5

[0777] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0778] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0779] gcggacgacc ggggttcgaa ccccggamcc ggccgtccgc cgtgatccat gcggttaccg 180

[0780] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0781] cttccaggcg cggcggctgc tgcgctagct tttttggcca ctggccgcgc gcggcgtaag 300

[0782] cggttaggct ggaaagcgaa agcattaagt 330

[0783] 3-24 Sequence

[0784] 3-24-1Serial number [ID] 24

[0785] 3-24-2 Molecular Type RNA

[0786] 3-24-3 Length 330

[0787] 3-24-4-1 Feature location / qualifier misc_feature 1..330

[0788] note= VAI long (c.191C>D)

[0789] 3-24-4-2 Feature location / qualifier source 1..330

[0790] mol_type = Other RNA

[0791] Organism = Synthetic Construct

[0792] 3-24-5 residues

[0793] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0794] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0795] gcggacgacc ggggttcgaa ccccggatcc ggccgtccgc cgtgatccat gcggttaccg 180

[0796] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0797] cttccaggcg cggcggctgc tgcgdtagct tttttggcca ctggccgcgc gcggcgtaag 300

[0798] cggttaggct ggaaagcgaa agcattaagt 330

[0799] 3-25 Sequence

[0800] 3-25-1Serial number [ID] 25

[0801] 3-25-2 Molecular Type RNA

[0802] 3-25-3 Length 330

[0803] 3-25-4-1 Feature location / qualifier misc_feature 1..330

[0804] note= VAI long (c.74U>V, c.191C>D)

[0805] 3-25-4-2 Feature location / qualifier source 1..330

[0806] mol_type = Other RNA

[0807] Organism = Synthetic Construct

[0808] 3-25-5 residues

[0809] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0810] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0811] gcggacgacc ggggttcgaa ccccggavcc ggccgtccgc cgtgatccat gcggttaccg 180

[0812] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0813] cttccaggcg cggcggctgc tgcgdtagct tttttggcca ctggccgcgc gcggcgtaag 300

[0814] cggttaggct ggaaagcgaa agcattaagt 330

[0815] 3-26 Sequence

[0816] 3-26-1Serial number [ID] 26

[0817] 3-26-2 Molecular Type RNA

[0818] 3-26-3 Length 330

[0819] 3-26-4-1 Feature location / qualifier misc_feature 1..330

[0820] note= VAI long (c.74U>M, c.191C>G)

[0821] 3-26-4-2 Feature location / qualifier source 1..330

[0822] mol_type = Other RNA

[0823] Organism = Synthetic Construct

[0824] Residue 3-26-5

[0825] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0826] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0827] gcggacgacc ggggttcgaa ccccggamcc ggccgtccgc cgtgatccat gcggttaccg 180

[0828] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0829] cttccaggcg cggcggctgc tgcggtagct tttttggcca ctggccgcgc gcggcgtaag 300

[0830] cggttaggct ggaaagcgaa agcattaagt 330

[0831] 3-27 Sequence

[0832] 3-27-1Serial number [ID] 27

[0833] 3-27-2 Molecular Type AA

[0834] 3-27-3 Length 106

[0835] 3-27-4-1 Feature Location / Qualifier REGION 1..106

[0836] note= SeV 106 aa of the C-terminal of C protein

[0837] 3-27-4-2 Feature location / qualifier source 1..106

[0838] mol_type = protein

[0839] Organism = Synthetic Construct

[0840] Residue 3-27-5

[0841] MLETLINKIY TGPLGEELVQ TLYLRIWAME ETPESLKILQ MREDIRDQVL KMKTERWLRT 60

[0842] LIRGEKTKLK DFQKRYEEVH PYLMKEKVEQ VIMEEAWSLA AHIVQE 106

[0843] 3-28 Sequence

[0844] 3-28-1Serial number [ID] 28

[0845] 3-28-2 Molecular Type AA

[0846] 3-28-3 Length 230

[0847] 3-28-4-1 Feature Location / Qualifier REGION 1..230

[0848] note= Influenza virus NS1

[0849] 3-28-4-2 Feature location / qualifier source 1..230

[0850] mol_type = protein

[0851] Organism = Synthetic Construct

[0852] Residue 3-28-5

[0853] MDSNTVSSFQ VDCFLWHIRK QVVDQELSDA PFLDRLRRDQ RSLRGRGNTL GLDIKAATHV 60

[0854] GKQIVEKILK EESDEALKMT MASTPASRYI TDMTIEELSR NWFMLMPKQK VEGPLCIRMD 120

[0855] QAIMEKNIML KANFSVIFDR LETLVLLRAF TEEGAIVGEI SPLPSFPGHT IEDVKNAIGV 180

[0856] LIGGLEWNDN TVRVSKNLQR FAWRSSNENG GPPLTPKQKR KMARTARPKV 230

[0857] 3-29 Sequence

[0858] 3-29-1Serial number [ID] 29

[0859] 3-29-2 Molecular Type AA

[0860] 3-29-3 Length 149

[0861] 3-29-4-1 Feature Location / Qualifier REGION 1..149

[0862] note=HSV Us11

[0863] 3-29-4-2 Feature location / qualifier source 1..149

[0864] mol_type = protein

[0865] Organism = Synthetic Construct

[0866] Residue 3-29-5

[0867] MSQTQPPAPV GPGDPDVYLK GVPSAGMHPR GVHAPRGHPR MISGPPQRGD NDQAAGQCGD 60

[0868] SGLLRVGADT TISKPSEAVR PPTIPRTPRV PREPRVPRPP REPREPRVPR APRDPRVPRD 120

[0869] PRDPRQPRSP REPRTPRTPR EPRTARGSV 149

[0870] 3-30 Sequence

[0871] 3-30-1Serial number [ID] 30

[0872] 3-30-2 Molecular type AA

[0873] 3-30-3 Length 213

[0874] 3-30-4-1 Feature Location / Qualifier REGION 1..213

[0875] note= E3K3 fusion protein

[0876] 3-30-4-2 Feature location / qualifier source 1..213

[0877] mol_type = protein

[0878] Organism = Synthetic Construct

[0879] 3-30-5 residues

[0880] MIIDDVSREK SMREDHKSFD DVIPAKKIID WKDANPVTVI NEYCQITKRD WSFRIESVGP 60

[0881] SNSPTFYACV DIDGRVFDKA DGKSKRDAKN NAAKLAVDKL LGYVIIRFEG RGSLLTCGDV 120

[0882] EENPGPLAFC YSLPNAGDVI KGRVYENDYA LYIYLFDYPH SEAILAESVK MHMDRYVEYR 180

[0883] DKLVGKTVKV KVIRVDYTKG YIDVNYKRMC RHQ 213

[0884] 3-31 Sequence

[0885] 3-31-1Serial number [ID] 31

[0886] 3-31-2 Molecular Type AA

[0887] 3-31-3 Length 231

[0888] 3-31-4-1 Feature location / qualifier REGION 1..231

[0889] note= E3Y3 fusion protein

[0890] 3-31-4-2 Feature location / qualifier source 1..231

[0891] mol_type = protein

[0892] Organism = Synthetic Construct

[0893] Residue 3-31-5

[0894] MIIDDVSREK SMREDHKSFD DVIPAKKIID WKDANPVTVI NEYCQITKRD WSFRIESVGP 60

[0895] SNSPTFYACV DIDGRVFDKA DGKSKRDAKN NAAKLAVDKL LGYVIIRFEG RGSLLTCGDV 120

[0896] EENPGPLETL INKIYTGPLG EELVQTLYLR IWAMEETPES LKILQMREDI RDQVLKMKTE 180

[0897] RWLRTLIRGE KTKLKDFQKR YEEVHPYLMK EKVEQVIMEE AWSLAAHIVQ E 231

[0898] 3-32 Sequence

[0899] 3-32-1Serial number [ID] 32

[0900] 3-32-2 Molecular Type DNA

[0901] 3-32-3 Length 912

[0902] 3-32-4-1 Feature location / qualifier misc_feature 1..912

[0903] note = EmGFP-VAI (c.74U>A)

[0904] Feature at position / qualifier source 1..912 of 3-32-4-2

[0905] mol_type = Other DNA

[0906] organism = Synthetic construct

[0907] Residues of 3-32-5

[0908] atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

[0909] ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

[0910] ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

[0911] ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240

[0912] cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

[0913] ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

[0914] gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

[0915] aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480

[0916] ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540

[0917] gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac

[0918] tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc

[0919] ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

[0920] tgataaccct gactgtaagc gggcactctt ccgtggtctg gtggataaat tcgcaagggt 780

[0921] atcatggcgg acgaccgggg ttcgaacccc ggaaccggcc gtccgccgtg atccatgcgg 840

[0922] ttaccgcccg cgtgtcgac ccaggtgtgc gacgtcagac aacgggggac cgctcctttt

[0923] ggcttccttc approx

[0924] 3-33 Configuration

[0925] 3-33-1Sheet[ID]33

[0926] 3-33-2 Intracellular DNA

[0927] 3-33-3 range1062

[0928] 3-33-4-1 enclosure / default misc_feature 1..1062

[0929] note= EmGFP-VAIL (c.74U>A)

[0930] 3-33-4-2 Feature Location / Qualifier source 1..1062

[0931] mol_type = other DNA

[0932] organism = synthetic construct

[0933] 3-33-5 Residues

[0934] atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

[0935] ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

[0936] ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

[0937] ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240

[0938] cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

[0939] ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

[0940] gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

[0941] aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480

[0942] ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540

[0943] gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac

[0944] tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc

[0945] ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

[0946] tgataaccct gagtcgggac gctctggccg gtgaggcgtg cgcagtcgtt gacgctctag 780

[0947] accgtgcaaa aggagagcct gtaagcgggc actcttccgt ggtctggtgg ataaattcgc 840

[0948] aagggtatca tggcggacga ccggggttcg aaccccgga ccggccgtcc gccgtgatcc

[0949] atgcggttac cgcccgcgtg tcgaacccag gtgtgcgacg tcagacaacg ggggagcgct 960.

[0950] cttttggct tccttccagg cgcggcggct gctgcggtag cttttttggc cactggccgc1020

[0951] gcgcggcgta agcggttagg ctggaaagcg aaagcattaa gt

[0952] 3-34 Configuration

[0953] 3-34-1Sheet[ID]34

[0954] 3-34-2Synthetic RNA

[0955] 3-34-3 range264

[0956] 3-34-4-1 Feature location / qualifier misc_feature 1..264

[0957] note= VAI (264bp) 74c3p

[0958] 3-34-4-2 Feature location / qualifier source 1..264

[0959] mol_type = Other RNA

[0960] Organism = synthetic construct

[0961] Residue 3-34-5

[0962] ctgtaagcgg gcactcttcc gtggtctggt ggataaattc gcaagggtat catggcggac 60

[0963] gaccggggtt cgaaccccgg acccggccgt ccgccgtgat ccatgcggtt accgcccgcg 120

[0964] tgtcgaaccc aggtgtgcga cgtcagacaa cgggggagcg ctccttttgg cttccttcca 180

[0965] ggcgcggcgg ctgctgcggt agcttttttg gccactggcc gcgcgcggcg taagcggtta 240

[0966] ggctggaaag cgaaagcatt aagt 264

[0967] 3-35 Sequence

[0968] 3-35-1Serial number [ID] 35

[0969] 3-35-2 Molecular type RNA

[0970] 3-35-3 Length 246

[0971] 3-35-4-1 Feature location / qualifier misc_feature 1..246

[0972] note= VAI (246bp) 74c5p

[0973] 3-35-4-2 Feature location / qualifier source 1..246

[0974] mol_type = Other RNA

[0975] Organism = Synthetic Construct

[0976] Residue 3-35-5

[0977] gtcgggacgc tctggccggt gaggcgtgcg cagtcgttga cgctctagac cgtgcaaaag 60

[0978] gagagcctgt aagcgggcac tcttccgtgg tctggtggat aaattcgcaa gggtatcatg 120

[0979] gcggacgacc ggggttcgaa ccccggaccc ggccgtccgc cgtgatccat gcggttaccg 180

[0980] cccgcgtgtc gaacccaggt gtgcgacgtc agacaacggg ggagcgctcc ttttggcttc 240

[0981] cttcca 246

[0982] 3-36 Sequence

[0983] 3-36-1Serial number [ID] 36

[0984] 3-36-2 Molecular type RNA

[0985] 3-36-3 Length 46

[0986] 3-36-4-1 Feature location / qualifier misc_feature 1..46

[0987] note = Hh-Rbz

[0988] 3-36-4-2 Feature location / qualifier source 1..46

[0989] mol_type = Other RNA

[0990] Organism = Synthetic Construct

[0991] Residue 3-36-5

[0992] ttggtctgat gagtccgtga ggacgaaacg gagtctagac tccgtc 46

[0993] 3-37 Sequence

[0994] 3-37-1Serial number [ID] 37

[0995] 3-37-2 Molecular type RNA

[0996] 3-37-3 Length 90

[0997] 3-37-4-1 Feature location / qualifier misc_feature 1..90

[0998] note= HDV-Rbz

[0999] 3-37-4-2 Feature location / qualifier source 1..90

[1000] mol_type = Other RNA

[1001] Organism = Synthetic Construct

[1002] Residue 3-37-5

[1003] gggtcggcat ggcatctcca cctcctcgcg gtccgacctg ggcatccgaa ggaggacgca 60

[1004] cgtccactcg gatggctaag ggagagccac 90

[1005] 3-38 Sequence

[1006] 3-38-1Serial number [ID] 38

[1007] 3-38-2 Molecular Type DNA

[1008] 3-38-3 Length 48

[1009] 3-38-4-1 Feature location / qualifier misc_feature 1..48

[1010] note= T7 terminator

[1011] 3-38-4-2 Feature location / qualifier source 1..48

[1012] mol_type = Other DNA

[1013] Organism = Synthetic Construct

[1014] Residue 3-38-5

[1015] ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttg 48

[1016] 3-39 Sequence

[1017] 3-39-1Serial number [ID] 39

[1018] 3-39-2 Molecular Type DNA

[1019] 3-39-3 Length 20

[1020] 3-39-4-1 Feature location / qualifier misc_feature 1..20

[1021] note= Forward primer for L gene amplification

[1022] 3-39-4-2 Feature location / qualifier source 1..20

[1023] mol_type = Other DNA

[1024] Organism = Synthetic Construct

[1025] Residue 3-39-5

[1026] tgggtcattc cctgaccaga 20

[1027] 3-40 Sequence

[1028] 3-40-1Serial number [ID] 40

[1029] 3-40-2 Molecular Type DNA

[1030] 3-40-3 Length 20

[1031] 3-40-4-1 Feature location / qualifier misc_feature 1..20

[1032] note= Reverse primer for L gene amplification

[1033] 3-40-4-2 Feature location / qualifier source 1..20

[1034] mol_type = Other DNA

[1035] Organism = Synthetic Construct

[1036] 3-40-5 residues

[1037] cagcttcgat cgttctgcac 20

[1038] 3-41 Sequence

[1039] 3-41-1Serial number [ID] 41

[1040] 3-41-2 Molecular Type DNA

[1041] 3-41-3 Length 18

[1042] 3-41-4-1 Feature location / qualifier misc_feature 1..18

[1043] note= Forward primer for VAI amplification

[1044] 3-41-4-2 Feature location / qualifier source 1..18

[1045] mol_type = Other DNA

[1046] Organism = Synthetic Construct

[1047] Residue 3-41-5

[1048] atcgagcctt atgacagc 18

[1049] 3-42 Sequence

[1050] 3-42-1Serial number [ID] 42

[1051] 3-42-2 Molecular Type DNA

[1052] 3-42-3 Length 24

[1053] 3-42-4-1 Feature location / qualifier misc_feature 1..24

[1054] note= Reverse primer for VAI amplification

[1055] 3-42-4-2 Feature location / qualifier source 1..24

[1056] mol_type = Other DNA

[1057] Organism = Synthetic Construct

[1058] Residue 3-42-5

[1059] gatacccttg cgaatttatc cacc 24

Claims

1. A method for producing a negative-strand RNA virus or a viral vector, comprising the following steps: expressing a protein kinase R (PKR) inhibitory factor from a gene encoding the factor operably linked to a control sequence and supplied to a packaging cell; Expressing the genomic RNA of the negative-strand RNA virus or viral vector in the packaging cell to form the negative-strand RNA virus or viral vector in the presence of the factor; and Recovering the formed negative-strand RNA virus or viral vector, The PKR inhibitory factor is a PKR inhibitory viral factor or nc886 or p58 IPK , The virus or viral vector is heterologous to the PKR inhibitory factor, and / or the control sequence is heterologous to the PKR inhibitory factor.

2. The method according to claim 1, wherein: The negative-strand RNA virus or viral vector is a Sendai virus vector.

3. The method according to claim 1 or 2, wherein: The PKR inhibitory factor is selected from the group consisting of VAIRNA of adenovirus, EBER of Epstein-Barr virus, TAR of HIV virus, 2A of polio virus, pro , E3L of vaccinia virus, δ3 of reovirus, NS1 of influenza virus, human p58 IPK , NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, human nc886, Us11 of herpes simplex virus and ICP34.5 of herpes simplex virus, and one or more of the group consisting of their orthologs.

4. The method according to any one of claims 1 to 3, wherein: Negative strand RNA viruses or viral vectors are produced in the absence of a helper virus.

5. The method according to any one of claims 1 to 4, wherein: The genomic RNA also has a gene encoding a PKR inhibitory factor operably linked to control sequences.

6. The method according to any one of claims 1 to 5, wherein: The packaging cell is provided with genomic DNA having a gene encoding a PKR inhibitory factor operably linked to control sequences.

7. The method according to any one of claims 1 to 6, wherein: The packaging cells are Vero cells or LLC-MK2 cells.

8. The method according to any one of claims 1 to 7, wherein: The packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and the cell population does not contain other cells.

9. An RNA genome of a negative-strand RNA virus or a viral vector, which expressibly contains any one or more genes encoding PKR inhibitory factors.

10. A negative-strand RNA virus or viral vector comprising the genome according to claim 9. The negative-strand RNA virus or viral vector according to claim 10 , further comprising a target gene.

12. A composition comprising the negative-strand RNA virus or viral vector according to claim 10 or 11.

13. A DNA encoding the RNA genome according to claim 9.

14. A gene expression vector comprising the DNA according to claim 13 operably linked to a control sequence.

15. A packaging cell for a negative-strand RNA virus or viral vector, which has a gene encoding a protein kinase R (PKR) inhibitory factor operably linked to a control sequence.

16. Use of a packaging cell having a gene encoding a protein kinase R (PKR) inhibitory factor operably linked to a control sequence for producing a negative-strand RNA virus or a viral vector.

Images