Use of transcription factor NR2F1 in regulating tyrosine hydroxylase synthesis
By identifying the transcription factor NR2F1 binding to the TH promoter region of the tyrosine hydroxylase gene and regulating its expression, the problem of tyrosine hydroxylase synthesis is solved, providing a new target for the treatment of diseases such as Parkinson's disease and improving the synthesis of tyrosine hydroxylase.
Patent Information
- Application Number
- CN202411736247.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2044-11-29
AI Technical Summary
In the prior art, the transcription factors synthesized by tyrosine hydroxylase are not fully understood, which makes it difficult to effectively regulate the expression and synthesis of tyrosine hydroxylase, affecting the therapeutic effect of diseases such as Parkinson's disease.
By identifying that the transcription factor NR2F1 can specifically bind to the TH promoter region of the tyrosine hydroxylase encoding gene and regulate its expression, the NR2F1 regulator is used to regulate its activity and expression, thereby affecting the synthesis of tyrosine hydroxylase.
New methods to regulate tyrosine hydroxylase synthesis are provided, and the transcriptional regulation mechanism of NR2F1-TH is explored, providing a potential target for the treatment of diseases such as Parkinson's disease and improving the synthesis of tyrosine hydroxylase.
Smart Images

Figure CN119386164B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to the use of a transcription factor NR2F1 in regulating the synthesis of tyrosine hydroxylase. Background Art
[0002] Tyrosine hydroxylase (TH), also known as tyrosine 3-monooxygenase, is highly abundant in the substantia nigra of the brain. It is an iron-containing multifunctional monooxygenase, and its function mainly relies on molecular oxygen and coenzyme tetrahydrobiopterin. Tyrosine hydroxylase has a tetrameric structure and is highly specific. TH is the first step in the catalytic synthesis of catecholamine neurotransmitters and is the rate-limiting enzyme for dopamine synthesis. TH functions through the coordinated action of its catalytic and regulatory subdomains to synthesize catecholamine neurotransmitters. The study of TH is of great significance for the research of myocardial infarction, hypertension, mental diseases, and Parkinson's disease.
[0003] The expression of the TH gene is regulated by multiple factors. Currently, the transcription factors that intervene in the expression of tyrosine hydroxylase are not fully understood. The specific target sequences bound by the transcription factors and their mechanisms of action are unknown, which is not conducive to regulating the synthesis of tyrosine hydroxylase in various ways. Therefore, in-depth analysis of the molecular mechanism of tyrosine hydroxylase synthesis, including transcriptional regulatory mechanisms, provides new targets and ideas for the clinical treatment of diseases such as Parkinson's disease. Summary of the Invention
[0004] In view of the deficiencies of the prior art, the present invention elucidates the use of the transcription factor NR2F1 in regulating the synthesis of tyrosine hydroxylase.
[0005] In a first aspect, the present invention provides the application of the transcription factor NR2F1 in the preparation of a reagent for regulating the expression of the tyrosine hydroxylase-encoding gene TH.
[0006] Preferably, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase-encoding TH gene.
[0007] Preferably, the promoter of the gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5’-AGGTCA(N)[[ID=?]] n GGTCA-3’, where N is A, T, C, or G, and n is an integer from 0 to 100.
[0008] Preferably, the promoter of the gene TH that can be recognized and activated by NR2F1 contains the following sequence: 5’-AGGTCACCCCAGGGTCA-3’.
[0009] It should be noted that there seems to be an error in the original text where the tag [[ID=?]] is used instead of . The above translation has been adjusted accordingly.In a second aspect, the present invention provides the use of regulating the activity and / or expression of transcription factor NR2F1 in the preparation of a reagent for increasing the synthesis of tyrosine hydroxylase.
[0010] Preferably, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase-encoding TH gene.
[0011] Preferably, the promoter of the gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5’-AGGTCA(N) n GGTCA-3’, where N is A, T, C or G, and n is an integer from 0 to 100.
[0012] Preferably, the gene TH promoter that can be recognized and activated by NR2F1 contains the following sequence: 5’-AGGTCACCCCAGGGTCA-3’.
[0013] In a third aspect, the present invention provides a method for increasing the synthesis of tyrosine hydroxylase, the method comprising regulating the activity and / or expression of transcription factor NR2F1 in a cell, or editing the transcription factor NR2F1 gene.
[0014] In a fourth aspect, the present invention provides the use of a transcription factor NR2F1 regulator in the preparation of a medicament for treating diseases related to tyrosine hydroxylase imbalance.
[0015] Preferably, the diseases related to tyrosine hydroxylase imbalance include Parkinson's disease.
[0016] The beneficial effects of the present invention are as follows:
[0017] The present invention has for the first time identified that the transcription factor NR2F1 can bind to the promoter region of the tyrosine hydroxylase-encoding gene TH and regulate its expression, thereby affecting the synthesis of tyrosine hydroxylase, and further exploring and developing new potential therapeutic targets for Parkinson's disease from the NR2F1-TH transcriptional regulatory mechanism. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 It is a schematic diagram of the binding of NR2F1 to the NR2F1 binding site in the TH promoter region.
[0019] Figure 2 It is an agarose gel electrophoresis diagram of chromatin immunoprecipitation analysis in Example 2. Among them, lane 1 is 100bp DNA ladder, and lanes 2-5 are pcDNA4-hNR2F1 transfected SH-SY5Y cells. The results shown are input (lane 2), histone H3 antibody IP positive control (lane 3), IgG negative control (lane 4), and NR2F1 antibody IP product (lane 5) in sequence.
[0020] Figure 3 Schematic diagram of NR2F1 regulating the promoter activity of TH in Example 3, where pGL3-Basic is the empty vector control; pGL3-hTH is the luciferase reporter gene plasmid pGL3-hTH promoter of the TH promoter region; pGL3-hTH pcDNA4 is the co-transfection of the luciferase reporter gene plasmid pGL3-hTH of the TH promoter region and the vector control plasmid pcDNA4-Vector; pGL3-hTH pcDNA4-NR2F1 is the co-transfection of the luciferase reporter gene plasmid pGL3-hTH of the TH promoter region and the NR2F1 overexpression plasmid pcDNA4-NR2F1. Detailed implementation manners
[0021] To make the technical solutions and beneficial effects of the present invention more obvious and understandable, the following provides a detailed description by listing specific examples. Among them, the drawings are not necessarily drawn to scale, and local features can be enlarged or reduced to more clearly show the details of the local features; unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.
[0022] Tyrosine hydroxylase (TH) is the rate-limiting enzyme for dopamine synthesis in the brain, and its proximal promoter (upstream of the transcription start site <1 kb) is very important for transcriptional regulation. The inventors conducted a large number of in-depth analyses on this promoter sequence and found that there is a potential core binding site of NR2F1 of AGGTCA-GGTCA at -911 to -895 bp upstream of its transcription start site (the transcription start site is +1).
[0023] In this application, a luciferase expression plasmid in the TH promoter region was constructed. The luciferase assay results indicated that overexpression of NR2F1 could significantly increase the TH promoter activity. Further ChIP results confirmed that NR2F1 could bind to the above-mentioned site in the TH promoter region, thereby regulating the transcriptional activity of the TH promoter.
[0024] In the first aspect, the present invention provides the application of the transcription factor NR2F1 in the preparation of a reagent for regulating the expression of the tyrosine hydroxylase-encoding gene TH.
[0025] In some embodiments, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase-encoding gene TH.
[0026] In some embodiments, the promoter of the gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5’-AGGTCA(N) nGGTCA-3', where N is A, T, C, or G, and n is an integer from 0 to 100.
[0027] In certain embodiments, the gene TH promoter that can be recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.
[0028] In a second aspect, the present invention provides the use of regulating the activity and / or expression of transcription factor NR2F1 in the preparation of a reagent for increasing tyrosine hydroxylase synthesis.
[0029] In certain embodiments, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase-encoding gene TH.
[0030] In certain embodiments, the promoter of gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5'-AGGTCA(N) n GGTCA-3', where N is A, T, C, or G, and n is an integer from 0 to 100.
[0031] In certain embodiments, the gene TH promoter that can be recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.
[0032] In the present application, the gene TH promoter sequence that can be recognized and activated by NR2F1 is as shown in SEQ ID NO:1.
[0033] SEQ ID NO:1
[0034] GGGGTTGTCCTCAAGGGAGTTCTC AGGTCA CCCCAG GGTCA CCCTCAACCCGGGGCCTGG
[0035] In a third aspect, the present invention provides a method for increasing tyrosine hydroxylase synthesis, the method comprising regulating and editing the transcription factor NR2F1 gene.
[0036] In a fourth aspect, the present invention provides the use of a transcription factor NR2F1 regulator in the preparation of a medicament for treating diseases related to tyrosine hydroxylase imbalance.
[0037] In certain embodiments, the diseases related to tyrosine hydroxylase imbalance include Parkinson's disease.
[0038] The following definitions and explanations are interpretations of the terms used in the present invention; when describing the present invention, unless otherwise specified, the technical and scientific terms used herein shall have the same meaning as commonly understood by those skilled in the technical field to which the present invention pertains, and the disclosures and documents mentioned herein are incorporated herein by reference.
[0039] As used herein, the term "comprising" or "including" means that the method, structure, or composition includes any example steps / operations, components, constituent parts, etc. of the volume, but does not exclude any other steps / operations, components, constituent parts.
[0040] In the context of the present invention, when referring to a numerical range, it should be understood that the upper and lower limits of the range, as well as each intermediate value therebetween, and any other specified value or intermediate value within the range are included in the present invention. The upper and lower limits of these smaller ranges that can be independently included within the range are also included in the present invention, subject to any explicit exclusions within the specified range. When the specified range includes one or both of the limit values, the range excluding either of the two limit values including the limit values is also within the present invention.
[0041] As used herein, "transcription factor NR2F1", whose full name is Nuclear Receptor Subfamily 2 Group F Member 1, is a protein encoded by the NR2F1 gene in the human genome. It belongs to a member of the nuclear receptor superfamily and is involved in regulating gene expression and transcription processes.
[0042] As used herein, the term "TH gene" is located at 11p15.5 on the short arm of human chromosome 11. The cDNA of the coding region is 1827 bp long, contains 13 exons, and encodes tyrosine hydroxylase. Mutations in the TH gene may lead to a deficiency or impaired function of tyrosine hydroxylase, and are related to some nervous system-related diseases such as Parkinson's disease, autism, attention deficit hyperactivity disorder, and schizophrenia. In this application, the gene TH sequence (NM_000360) is about 7887 bp long.
[0043] The present invention will be further described below through specific examples. Unless otherwise specified herein, "%" represents mass percentage. The materials and reagents in the following examples, unless otherwise specified, are commonly used materials or reagents in the art, and can all be obtained commercially or synthesized by known methods. The experimental methods without specified conditions in the following implementation cases are usually carried out according to conventional experimental conditions or the conditions recommended by the manufacturers of relevant reagents (kits).
[0044] Example 1
[0045] The whole-genome methylation and hydroxymethylation modifications of the substantia nigra brain tissue of PD patients were detected by methylated DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq) and chemical labeling and affinity purification method combined with high-throughput sequencing (hMe-Seal), respectively. The findMotifsGenome.pl module in Homer software (v4.10) was used to identify the potential transcription factors of the differentially hydroxymethylated regions in the promoter region. This command was compared with randomly selected background genomic regions (enrichment threshold: q-value (Benjamini) < 0.05) to determine the motifs enriched in specific regions. The results suggested the enrichment of potential binding motifs of transcription factors such as NR2F1 in the differentially hydroxymethylated modification regions.
[0046] Example 2
[0047] Analysis of the TH gene promoter sequence revealed the presence of a potential core binding site of NR2F1, AGGTCA-GGTCA, from -911 to -895 bp upstream of the TH transcription start site (see Figure 1 ). Chromatin immunoprecipitation assay (ChIP) was used to confirm the binding of NR2F1 to the NR2F1 binding site in the TH promoter region.
[0048] Using Enzymatic Chromatin IP Kit (Magnetic Beads), the brief steps are as follows:
[0049] SHSY5Y cells were transfected with pcDNA4-hNR2F1. After 24 hours, 270 μl of 37% formaldehyde was added, and after standing for 10 min, 10× Glycine Solution was added to terminate the cross-linking reaction. The cells were washed with pre-cooled 1× PBS, and then pre-cooled PBS and protease inhibitor were added. The cells were scraped with a cell brush and transferred to an EP tube, centrifuged at 2000 rpm at 4°C for 5 min. Cell lysis and sonication were performed according to the kit instructions. The sonicated lysate was centrifuged, and the supernatant was transferred to prepare for immunoprecipitation; the antibodies were incubated in groups, and IgG, NR2F1 antibody (Invitrogen, PA5-30190) in the kit, and histone H3 antibody in the kit were added as negative control, experimental group, and positive control, respectively. The chromatin was eluted with magnetic beads and purified by DNA column, and then PCR detection was performed. PCR amplification was performed using T6 SuperPCR Mix(1.1×) Gold Mix (Green) Kit. The reaction system contains 40 μl of Gold Mix, 2 μl each of forward and reverse primers, 6 μl of template DNA. The target fragment of the NR2F1 ChIP-PCR product is 159 bp. The primers are specific primers for the TH promoter region, with the forward primer sequence: 5’-GACATGGAACTTGGGGGAGG-3’ (SEQ ID NO:2), and the reverse primer sequence: 5’-TTGGAGAGACCTTTGCAGTTTC-3’ (SEQ ID NO:3). The histone H3 ChIP-PCR primers are provided by the kit (target fragment 160 bp). The obtained PCR products are subjected to agarose gel electrophoresis (see Figure 2 ). Among them, lane 1 is 100 bp DNA ladder, and lanes 2 - 5 are pcDNA4-hNR2F1 transfected SH-SY5Y cells. The results shown are input (lane 2), histone H3 antibody IP positive control (lane 3), IgG negative control (lane 4), and NR2F1 antibody IP product (lane 5) in sequence. The results show that the NR2F1 antibody can immunoprecipitate the TH promoter, indicating that NR2F1 binds to the NR2F1 binding site in the TH promoter region.
[0050] Example 3
[0051] The HEK293 cell line was co-transfected with the NR2F1 overexpression plasmid pcDNA4-NR2F1 and the luciferase reporter gene plasmid pGL3-hTH promoter in the TH promoter region to detect the TH promoter activity and explore whether NR2F1 can up-regulate the TH promoter activity.
[0052] The luciferase reporter gene plasmid pGL3-hTH promoter in the TH promoter region and pRL-TK (internal standard) were co-transfected with the NR2F1 overexpression plasmid pcDNA4-NR2F1 or the vector control plasmid pcDNA4-Vector into HEK293 cells. After 24 hours of co-transfection, the Dual-luciferase reporter assay system (Promega) was used to detect the promoter activity. The results are shown in Figure 3, pGL3-Basic is the empty vector control; pGL3-hTH is the luciferase reporter gene plasmid pGL3-hTH in the TH promoter region; pGL3-hTH pcDNA4 is the co-transfection of the luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and the vector control plasmid pcDNA4-Vector; pGL3-hTH pcDNA4-NR2F1 is the co-transfection of the luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and the NR2F1 overexpression plasmid pcDNA4-NR2F1. The results showed that the overexpression plasmid pcDNA4-NR2F1 significantly increased the promoter activity of the luciferase reporter gene plasmid pGL3-hTH in the TH promoter region, indicating that NR2F1 can up-regulate the promoter activity of TH and promote the synthesis of tyrosine hydroxylase.
[0053] Tyrosine hydroxylase is the rate-limiting enzyme for dopamine synthesis in the brain, and its proximal promoter (upstream of the transcription start site <1 kb) is very important for transcriptional regulation. In this application, it was identified that the transcription factor NR2F1 interacts through the promoter region of the tyrosine hydroxylase gene TH to regulate the synthesis of tyrosine hydroxylase.
[0054] It should be understood that the above embodiments are all exemplary and do not cover all possible implementation manners included in the claims. Without departing from the scope of the present disclosure, various modifications and changes can be made based on the above embodiments. Similarly, any combination of the technical features of the above embodiments can be made to form additional embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments only represent several implementation manners of the present invention and do not limit the protection scope of the present invention patent.
Claims
1. Use of transcription factor NR2F1 in the preparation of a reagent for regulating the gene encoding tyrosine hydroxylase TH wherein the transcription factor NR2F1 specifically binds to the promoter region of the gene encoding tyrosine hydroxylase TH ; Gene TH The promoter of which contains a sequence that can be recognized by the transcription factor NR2F1, and the gene that can be recognized and activated by NR2F1 TH The promoter contains the following sequence: 5’-AGGTCACCCCAGGGTCA-3’.
2. Use of modulating the activity and / or expression of transcription factor NR2F1 in the preparation of a reagent for enhancing tyrosine hydroxylase synthesis, wherein the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase-encoding gene TH ; Gene TH The promoter of which contains a sequence that can be recognized by the transcription factor NR2F1, and the gene that can be recognized and activated by NR2F1 TH The promoter contains the following sequence: 5’-AGGTCACCCCAGGGTCA-3’.
3. Use of a transcriptional factor NR2F1 regulator in the preparation of a drug for treating a disease related to tyrosine hydroxylase imbalance, wherein the transcriptional factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase encoding gene TH ; Gene TH The promoter of which contains a sequence that can be recognized by the transcription factor NR2F1, and the gene that can be recognized and activated by NR2F1 TH The promoter contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.
4. The application according to claim 3, characterized in that, The tyrosine hydroxylase imbalance-related diseases include Parkinson's disease.