Monascus purpurogenous fungus with high yield of monascusin and / or monascus yellow and application thereof

Abstract

The present application relates to the field of microbial technology, and specifically to a Monascus fungus with high yield of monascusin and / or monascusflavin and its application, a new strain of Monascus with a deposit number of CGMCC NO.41335 and its application in the production of high-content monascusin and / or monascusflavin and its related products. The strain is Monascus purpurogenus ZYXQ‑2206, which can produce high-yield, potent and non-toxic monascusin and / or monascusflavin, without producing harmful and toxic ingredients such as lovastatin and citrinin. Therefore, the red yeast rice products produced by the strain can effectively avoid safety risks and have extremely high application prospects and market potential. The present application provides a high-yield, non-toxic and highly functional red yeast rice by screening and optimizing the fermentation process, which has important application value in the development of lipid-lowering functional foods and nutritional health products.

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and in particular to a Monascus fungus producing monascusin and / or monascusflavin and an application thereof. Background Art

[0002] Monascus is a fungus of the genus Monascus of the family Aspergillus that is parasitic on rice and other grains. Since French scholars established the classification in 1884, 36 species have been identified, among which M.purpureus, M.anka, M.pilosus, and M.ruber are widely used in industrial fermentation and food fermentation. The only species that can be used in medicines, health foods, and foods in my country are M.purpureus and M.red. Traditional records of Monascus: sweet, slightly warm, and enter the spleen, large intestine, and liver meridians; it has the effects of digesting food, activating blood circulation, and strengthening the spleen and stomach. It is used for abdominal pain caused by stagnation, diarrhea, injuries, and postpartum bleeding. "Yinshi Zhengyao" records: "Monascus tastes sweet, flat, and non-toxic. It strengthens the spleen, replenishes qi, and warms the middle." "Compendium of Materia Medica" records: "Red yeast rice is sweet and warm in nature, non-toxic. It is good for women with blood and qi pain and postpartum lochia. Red yeast rice is also often used in combination with other Chinese medicines to treat digestive system diseases, metabolic diseases and cardiovascular diseases. Modern research shows that red yeast rice has multiple activities such as antioxidant, antibacterial, anti-atherosclerotic, anti-obesity, hypolipidemic, hypoglycemic, and anti-tumor activities.

[0003] In 1979, scholars first extracted a functional active substance that can significantly inhibit cholesterol synthesis from the culture fluid of some strains of Monascus rubrum, Monascus rubrum and Monascus purpurogenum, and named it Monacolin K. Subsequent studies confirmed that Monacolin K is Lovastatin (LOV). Although LOV has good lipid-lowering activity by strongly inhibiting cholesterol synthesis and was approved as a lipid-lowering drug by the US FDA in 1987, with the popularization of its application, its serious liver and kidney damage and rhabdomyolysis and other side effects have also attracted more and more attention. Many countries in the European Union and the United States have successively issued restrictions on LOV in related products containing red yeast rice.

[0004] Current literature has confirmed that Mon and Ank are the effective / functional ingredients of red yeast rice for lowering blood lipids, blood sugar and blood pressure. LOV and CIT are internationally recognized limited toxic ingredients. Therefore, it is urgent to find a new red yeast rice strain that produces high levels of Mon and Ank and does not contain LOV and CIT. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present application screens out a stable strain under the M. purpureus species and provides a Monascus strain that can produce high levels of Mon and / or Ank. The Monascus provided in the present application is classified and named as: Monascus purpureus, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on June 14, 2024. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, Deposit Number CGMCC NO.41335.

[0006] Specifically, this application adopts the following technical solutions:

[0007] 1. A Monascus purpureus, characterized in that the deposit number of the Monascus purpureus is: CGMCC NO.41335.

[0008] 2. The Monascus according to item 1, characterized in that the DNA sequence of the Monascus is shown in SEQ ID NO: 1.

[0009] 3. A culture containing the Monascus purpurogenous bacteria described in item 1.

[0010] 4. Use of the Monascus described in item 1 or the culture of item 3 in culturing monascin and / or ankaflavin.

[0011] 5. A method for culturing monascusin and / or monascus yellow, characterized in that it comprises culturing monascusin and / or monascus yellow using the Monascus fungus described in item 1.

[0012] 6. The method according to item 5, further comprising the steps of:

[0013] activating the Monascus strain and inoculating it into a seed culture medium to obtain a strain seed solution;

[0014] inoculating the strain seed liquid into a fermentation medium for fermentation culture;

[0015] The Monascus strain is activated before being inoculated into the seed culture medium.

[0016] 7. The method according to item 6 is characterized in that the fermentation culture conditions are aerobic culture, the fermentation temperature is 25-50°C, the fermentation culture time is 2-20 days, and the fermentation culture method is solid fermentation or liquid fermentation.

[0017] 8. The method according to item 6 is characterized in that the contents of the components of the seed culture medium are: glucose 10-50 g / L, peptone 5-30 g / L, yeast powder 5-30 g / L, soybean powder 2-20 g / L, glycerol 20-80 mL / L, magnesium sulfate 0.2-2 g / L, sodium nitrate 0.5-5 g / L, zinc sulfate 0.5-5 g / L, potassium dihydrogen phosphate 0.2-2 g / L, maltodextrin 10-50 g / L; and / or

[0018] The raw materials of the fermentation medium are selected from one or more of rice, soybean, corn or yam.

[0019] 9. The method according to item 6 is characterized in that the inoculation amount of the strain seeds inoculated into the fermentation medium is 5-15% (V / V).

[0020] 10. The method according to item 6 is characterized in that the plate culture is carried out at 25-50°C for 2-20 days.

[0021] Beneficial effects: Compared with the prior art, this application has the following advantages:

[0022] The present application provides a novel Monascus strain, namely Monascus purpureus ZYXQ-2206, which has significant advantages and can efficiently produce Mon and Ank during the fermentation process without producing LOV and CIT. This breakthrough strain overcomes the problem of high production of LOV, CIT and other toxic components in traditional Monascus strains.

[0023] Through solid-state fermentation or liquid fermentation process, the ZYXQ-2206 strain in the present application can greatly increase the production of Mon and Ank. Compared with the comparison strain 1 in the prior art, the Mon content of the ZYXQ-2206 strain in the present application is as high as 5.86%, and the Ank content is as high as 1.87%, which are 8.4 times and 8.1 times that of the comparison strain 1 (Mon 0.70%, Ank 0.23%), respectively. It significantly increases the content of functional components of red yeast rice and solves the problem of insufficient Mon and Ank production in traditional red yeast rice fermentation.

[0024] In addition, since LOV and CIT are recognized as toxic ingredients, they are strictly limited internationally. The strain of the present application can avoid the generation of LOV and CIT, making the fermentation product have great advantages in safety and meeting the strict international and domestic quality standards for functional ingredients and toxic ingredients. This feature makes the red yeast rice product provided by the present application a safer and more effective natural dietary ingredient additive, reducing the risk of liver and kidney damage, rhabdomyolysis, etc. caused by exposure to LOV and CIT for consumers, and has broad application prospects in the development of drugs and functional foods.

[0025] Compared with traditional technologies, the red yeast rice product provided in this application is not only more functional, but also contains no toxic ingredients, which greatly improves the safety and market competitiveness of the product, and represents a major breakthrough in red yeast rice fermentation technology and product quality control. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings are used to better understand the content of this application, but do not constitute an improper limitation on this application. The specific contents are as follows:

[0027] Figure 1 The colony morphology of Monascus purpureus 7-3 and ZYXQ-2206;

[0028] Figure 2 It is the microscopic characteristic morphology of Monascus purpureus ZYXQ-2206;

[0029] Figure 3 A is the chromatogram of the reference substance determined by HPLC, where 1: citrinin (CIT); 2: lovastatin (LOV); 3: Monascin; 4: Ankaflavin;

[0030] Figure 3 B is the chromatogram of ZYXQ-2206 determined by HPLC, where 3: Monascin; 4: Ankaflavin;

[0031] Figure 3 C is the chromatogram of sample 7 determined by HPLC, wherein: 2: lovastatin (LOV); 3: Monascin; 4: Ankaflavin. DETAILED DESCRIPTION

[0032] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0033] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the functional differences of components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is based on the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be determined by the attached claims.

[0034] The technical terms mentioned in this specification have the same meanings as those generally understood by those skilled in the art. In case of any conflict, the definitions in this specification shall prevail.

[0035] In the present application, "Monascin" refers to red yeast rice, also known as red yeast pigment, CAS: 21516-68-7, which can be extracted from red yeast rice.

[0036] In the present application specification, "Ankaflavin" refers to red yeast rice, also known as ankaflavin, CAS: 50980-32-0, which can be extracted from red yeast rice.

[0037] The Monascus provided in this application is classified and named as: Monascus purpureus, which was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on June 14, 2024. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, and the deposit number is CGMCCNO.41335.

[0038] The DNA sequence of Monascus provided in the present application is shown in SEQ ID NO: 1:

[0039] ATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTG TCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA TTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGC GTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

[0040] In a specific embodiment of the present application, the screening method of Monascus comprises the following steps:

[0041] Take 1 portion of red yeast rice sample made according to the ancient method and dissolve it in 5-20 times sterilized pure water, place it in a constant temperature environment of 25-50℃, and culture it at 120-150 rpm / min for 0.5-2 h. Take the supernatant after culture and dilute it with distilled water in multiple ratios, take appropriate amount of original solution, 10 -1 , 10 -2 , 10 -3 The diluted solution was spread on a PDA plate and placed in a constant temperature incubator at 25-50°C for culture. The colony morphology was observed to be uniform, and larger colonies with reddish color were streaked and purified to obtain the Monascus purpurogenus strain.

[0042] Inoculate Monascus purpureus on the slant PDA medium, scrape a small amount of mycelium and add it to an appropriate amount of sterilized distilled water, and gently blow to mix. Take out an appropriate amount of bacterial solution and add 0.5 to 2 times of distilled water, 40 cm below the UV lamp, irradiate for 1 to 5 minutes, place the ultraviolet irradiated bacterial solution in a 4 ℃ refrigerator for 1 to 3 hours, take out an appropriate amount of bacterial solution and spread it on the PDA plate, make 3 parallels, wrap it with tin foil and place it in a constant temperature incubator at 25 to 50 ℃ for 5 days to 7 days. Observe the growth of the colony. Pick the strain with larger colonies or larger morphological differences on the fresh PDA plate to obtain Monascus purpureus ZYXQ-2206.

[0043] The present application also provides a culture containing the above-mentioned Monascus purpureus ZYXQ-2206. In the present application, the culture of Monascus purpureus ZYXQ-2206 refers to a substance obtained by culturing the Monascus purpureus ZYXQ-2206 of the present application, more specifically, a mixture of Monascus purpureus ZYXQ-2206 cells, a culture medium for culturing Monascus purpureus ZYXQ-2206, and substances produced by the cultured Monascus purpureus ZYXQ-2206.

[0044] The present application also provides the use of the above-mentioned Monascus purpurogenus ZYXQ-2206 or its culture in the cultivation of monascusin and monascus yellow.

[0045] The present application also provides a culture method for producing monascusin and monascusflavin by solid-state fermentation or liquid fermentation, which utilizes the above-mentioned Monascus purpurogenus ZYXQ-2206 or a culture containing the strain to culture monascusin and monascusflavin, and lovastatin and citrinin are not produced in the process.

[0046] In a specific embodiment of the present application, the Monascus purpurogenum ZYXQ-2206 is placed on a plate culture medium, preferably a potato glucose culture medium, the carbon source is 6-18 g / L potato extract powder, 10-30 g / L glucose, 6-25 g / L agar powder, the pH value is 5.6 ± 0.2, and the rest is water.

[0047] In a specific embodiment of the present application, the plate culture medium inoculated with Monascus has a Monascus culture temperature of 25-50°C, preferably 25-30°C, for example, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C.

[0048] In a specific embodiment of the present application, the plate culture medium inoculated with Monascus has a Monascus culture time of 2 to 20 days, preferably 5 to 15 days.

[0049] In a specific embodiment of the present application, the plate culture medium is selected from one or more of potato dextrose medium (PDA), potato dextrose water medium (PD), Chaparral yeast extract sucrose agar medium (CYA) or malt extract agar medium (MEA).

[0050] In a specific embodiment of the present application, the Monascus is activated and inoculated into a seed culture medium, which contains: 10-50 g / L of glucose, 5-30 g / L of peptone, 5-30 g / L of yeast powder, 2-20 g / L of soybean powder, 20-80 mL / L of glycerol, 0.2-2 g / L of magnesium sulfate, 0.5-5 g / L of sodium nitrate, 0.5-5 g / L of zinc sulfate, 0.2-2 g / L of potassium dihydrogen phosphate, 10-50 g / L of maltodextrin, and is sterilized at 121°C for use.

[0051] In a specific embodiment of the present application, the plate washing liquid or the strain seed liquid is inoculated into the fermentation medium for solid-state fermentation or liquid-state fermentation.

[0052] In a specific embodiment of the present application, the inoculation amount of the seed culture medium into the fermentation medium is 5% to 15%, for example, it can be 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, or 15%.

[0053] In a specific embodiment of the present application, in the fermentation medium, the raw material is commercially available rice sterilized at 121° C. for 30 minutes.

[0054] In a specific embodiment of the present application, in the fermentation medium, the raw materials are selected from one or more of rice, soybeans, corn or yam, and further, the rice, soybeans, corn or yam are ground into powder.

[0055] Example

[0056] In the following examples, the seed culture medium used is glucose 10-50 g / L, peptone 5-30 g / L, yeast powder 5-30 g / L, soybean powder 2-20 g / L, glycerol 20-80 mL / L, magnesium sulfate 0.2-2 g / L, sodium nitrate 0.5-5 g / L, zinc sulfate 0.5-5 g / L, potassium dihydrogen phosphate 0.2-2 g / L, maltodextrin 10-50 g / L, and is sterilized at 121°C and set aside.

[0057] Example 1 Isolation, screening and identification of Monascus purpurogenus ZYXQ-2206

[0058] Take 10-20g of red yeast rice made according to the ancient method and dissolve it in 100-150mL of sterilized pure water. Place it in a constant temperature shaker at 25-50℃ and culture it at 120-150 rpm / min for 0.5-2 hours. Take the supernatant after culture and dilute it with distilled water in multiple proportions. Take 200 µL of the original solution, 10 -1 , 10 -2 , 10 -3 The dilution was spread on the PDA plate and placed in a constant temperature incubator at 20-50 ℃ for 2-20 days. The morphology of the colonies was observed to be uniform, and the purple Aspergillus strain 7-3 was obtained. Inoculate the purple Aspergillus 7-3 on the slant PDA medium, scrape a small amount of mycelium and add it to 0.5-2 times sterilized distilled water, and gently blow to mix. Take out 500 µL of the bacterial solution and add 500 µL of distilled water, and take 5 tubes in total. Irradiate 40 cm below the UV lamp for 1-5 minutes. After the ultraviolet-irradiated bacterial solution is placed in a 4 ℃ refrigerator for 1-3 hours, take out 200 µL of the bacterial solution and spread it on the PDA plate, make 3 parallels, wrap it with tin foil and place it in a constant temperature incubator at 25-50 ℃ for 2-20 days. Observe the growth of the colonies. Pick strains with larger colonies or larger morphological differences and place them on fresh PDA plates. The obtained strain was named Monascus purpureus ZYXQ-2206. The colony morphology of Monascus purpureus strains 7-3 and ZYXQ-2206 is as follows: Figure 1 shown.

[0059] Scrape 0.2-0.5 mg of ZYXQ-2206 hyphae and place in a 2.0 mL centrifuge tube; add 2 glass beads with a diameter of 3-4 mm and 100 µL of CTAB lysis buffer, grind twice on a Retsch M400 homogenizer, 2 min each time; add 400 µL of CTAB lysis buffer preheated in a 65°C water bath, invert to mix, and then place in a 65°C water bath for 0.5-1 h; add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert to mix 50 times; centrifuge at 12000 rpm at room temperature for 5 min, and take the supernatant to a new centrifuge tube; add 1.5 times the volume of binding solution to the supernatant, mix well, and transfer to the adsorption column, centrifuge at 12000 rpm at room temperature for 30 sec, and discard the waste liquid; add 500 µL of inhibitor removal solution, centrifuge at 12000 rpm at room temperature for 30 sec, and discard the waste liquid; add 600 µL of rinsing solution, centrifuge at 12000 rpm at room temperature for 15 min, and discard the waste liquid. Centrifuge at 12,000 rpm for 30 sec at room temperature and discard the waste liquid; put the adsorption column back into the empty collection tube and centrifuge at 12,000 rpm for 2 min at room temperature; transfer the adsorption column to a sterilized 1.5 mL centrifuge tube and dry it at room temperature for 5 min; add 50-100 µL elution buffer, leave it at room temperature for 3-5 min, centrifuge at 12,000 rpm for 30 sec to collect the genomic DNA solution, and use it immediately or store it at 20°C for later use.

[0060] After template extraction, PCR was amplified with ITS primers. The PCR reaction system (50 µL) was as follows: 2 μL of fungal genomic DNA, 25 μL of 2×Easy Taq PCR Mix, 2 μL of upstream and downstream primers, and then 19 μL of sterilized pure water was added. PCR conditions: 95°C pre-denaturation for 3 min, 94°C melting for 1 min, 54°C renaturation for 40 s, 72°C extension for 1 min, 35 cycles of amplification; 72°C repair extension for 10 min, 4°C termination of the reaction, and the product was stored at 4°C after completion. The PCR product was directly sent to the sequencing company for sequencing, and the product required conventional purification in the sequencing instructions. The sequencing results were compared with the NCBI database, and the strain ZYXQ-2206 was identified as Monasus purpureus at the molecular level. The DNA sequence of ZYXQ-2206 is shown in SEQ ID NO:1:

[0061] ATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTG TCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA TTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGC GTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

[0062] The microscopic characteristics of the above-mentioned Monascus purpurogenus ZYXQ-2206 strain are as follows Figure 2 As shown in the figure, the colony characteristics are as follows: it grows faster on malt extract medium (MEA), and the colony diameter is 20-25 mm in 5 days under dark conditions at 25 ℃. The aerial hyphae are lush, white in the early stage and light orange in the later stage; the back of the colony is dark orange, reddish brown in the middle, and there is no soluble pigment. The microscopic characteristics of the hyphae are that the vegetative hyphae are without septa, multi-branched, and 2.0-4.0 μm wide. Conidia are produced in large quantities, and the conidiophores are not obviously specialized, straight or slightly curved. The conidia are spherical, colorless, with slightly rough walls, truncated at the base, and in series, 4.5-12.8 μm. The primordium of the sub-walled fruit is spherical, with a diameter of up to 25 μm, light to brown, immature, and no ascospores are seen. On CYA, the colonies of ZYXQ-2206 were 15 to 18 mm in diameter, flat, sparse, and usually curly in texture, with occasional small amounts of aerial hyphae. The mycelium was white or light red with small, clear exudates, secreting orange or pink pigments, and the back was light to pink or orange-red.

[0063] Example 2 Fermentation process and color scale determination

[0064] Soak the rice in an acetic acid solution with a pH of 5.5 for 20 to 24 hours, drain the water, and sterilize at 121 °C for 30 minutes to obtain a solid rice fermentation medium. Inoculate the Monascus purpurogenum strain ZYXQ-2206 on the PDA slant medium and culture for 4 to 5 days. When the mycelium covers the slant and the back of the test tube is bright red, wash the spores on the slant with sterile water and inoculate at a concentration of 10 5 ~10 6 Spores / g (dry weight of rice) were inoculated into the cooled rice fermentation medium.

[0065] The culture was carried out by solid-state fermentation. The seed culture medium was added at a ratio of 5% to 15%, and poured into the rice fermentation culture medium and stirred evenly. The inoculated culture medium was placed in an artificial climate incubator (constant temperature and humidity) at 25 to 50 °C and a relative humidity of 60% to 80% for 3 days. It was turned over every 24 hours and 5% to 8% of sterile water was added. On the 4th day, the temperature was 25 to 35 °C and the relative humidity was 50% to 60%. It was turned over every 24 hours and continued to be replenished with water (at a ratio of 5% to 8%) until the 10th day. The fermentation time was 15 to 20 days until the heart of the rice turned red. The obtained red yeast was dried and stored at 55 to 60 °C. Using the above solid-state fermentation method, two batches of drying and storage were repeated for standby.

[0066] Red yeast rice flour is prepared by liquid fermentation method. The raw materials (fermentation medium, such as rice flour) are added with water, stirred and dissolved, and then pumped into the fermentation tank. The liquid volume is 45% to 55% of the volume of the fermentation tank, and steam is passed for high-temperature sterilization. Sterilization conditions: 120-130℃, 30-60min; cool to 40-45℃ for standby use. The amplified seed culture medium is transferred to the fermentation tank at a volume fraction of 5% to 30%. The initial fermentation conditions are set, the stirring speed is 100-450 r / min, the ventilation rate is 1.5-5 L / min, the temperature is controlled at 25-35℃, the tank pressure is 0.04-0.08MPa, the initial pH value is 4.5-5.5, and the fermentation is 10-15 days. After the fermentation is completed, the reduced pressure concentration is carried out, the temperature is 35-55℃, and the vacuum degree is -0.08--0.095MPa. The concentrated liquid is then spray-dried, the air inlet temperature of the drying tower is 165-200° C., and the air outlet temperature is 60-90° C. The liquid material is spray-dried to obtain red yeast rice flour.

[0067] The color value determination method of the above-mentioned red yeast rice is as follows: the color value content determination method of red yeast rice refers to "GB 1886.19-2015 National Food Safety Standard Food Additive Red Yeast Rice", the red yeast rice sample is crushed with a grinder, passed through a No. 7 mesh sieve, 0.2 g of the crushed and mixed sample is accurately weighed, dissolved with 70% ethanol solution, and transferred into a 100 mL volumetric flask, fixed to the scale, placed in a 60 ℃ water bath, accurately soaked for 1 h, taken out and cooled to room temperature, 70% ethanol solution is added to the scale, mixed, filtered with filter paper, and the filtrate is collected in a stoppered colorimetric dish for standby use. Accurately pipette 2.0 mL to 5.0 mL of the above solution into a 50 mL volumetric flask (so that the final dilution absorbance falls within the range of 0.2 to 0.8), dilute to 50 mL with 70% ethanol solution, shake well, use a 10 mm cuvette and 70% ethanol solution as a reference, and measure the absorbance A of the sample immersed in the dilution solution at wavelengths of 420 nm, 470 nm and 505 nm, which represent the contents of the three major types of pigments, yellow, orange and red, respectively.

[0068] Color value X1 (U / g) is calculated according to the following formula:

[0069] X1=A×100 / m×50 / V

[0070] Where A = absorbance of the sample immersed in diluent;

[0071] m = the mass of the sample weighed, in grams;

[0072] 100, 50 = conversion factor;

[0073] V = volume of ethanol soaking solution absorbed, in mL;

[0074] The test results shall be based on the arithmetic mean of the parallel measurement results. The absolute difference between two independent measurement results obtained under repeatability conditions shall not exceed 2%.

[0075] The purple Monascus strain ZYXQ-2206 has a strong ability to produce pigments. The color value of yellow pigment in solid fermentation is 3070.15±1.85 U / g; the color value of orange pigment is 2221.23±1.41 U / g, and the color value of red pigment is 3115.08±2.66 U / g. The color value of yellow pigment in liquid fermentation is 2807.16±1.76 U / g; the color value of orange pigment is 2943.82±1.45 U / g, and the color value of red pigment is 2019.61±2.02 U / g. Therefore, the color value of red yeast rice fermented by the purple Monascus strain ZYXQ-2206 is higher than the color value of commercially available red yeast rice, as shown in Table 1.

[0076] Table 1 Determination of color value and content of red yeast rice (U / g)

[0077]

[0078] Example 3 Determination of the contents of four components in fermentation products

[0079] The ZYXQ-2206 strain obtained by three batches of solid-state fermentation in Example 2, the ZYXQ-2206 strain obtained by liquid fermentation in Example 2, and other samples were used, and rice was used as a substrate to measure the contents of monascin, ankaflavin, lovastatin (LOV), and citrinin (CIT) in the fermentation substrate.

[0080] The determination method of Monascin, Ankaflavin, LOV and CIT of the above fermentation product red yeast rice is as follows:

[0081] HPLC detection conditions are: Column: C 18 (4.6 mm×250 mm), injection volume: 20 μL, wavelength: 390 nm, flow rate: 1 mL / min, column temperature: 35 ℃; the mobile phase was acetonitrile (A) and 0.1% phosphoric acid aqueous solution (B), and the gradient elution conditions were 50% A from 0 to 10 min, 50 to 63% A from 10 to 25 min, 63% A from 25 to 35 min, 63% A from 35 to 40 min, 72% to 75% A from 40 to 50 min.

[0082] Preparation of test solution: grind the red yeast rice fermentation product into powder and pass it through a No. 7 sieve. Weigh 0.5 g of the sieved sample, accurately weigh to 0.001 g, put it into a 50 mL conical flask, add 10 mL of 95% methanol, ultrasonicate at 50 Hz for 30 min, filter it through a 0.22 µm membrane, centrifuge at 12000 rpm / min for 5 min, and take 0.2 mL of the supernatant for HPLC detection.

[0083] Preparation of standard solution: Accurately weigh appropriate amount of Monascin, Ankaflavin, LOV, CIT standard, add chromatographic grade methanol to dissolve, and prepare a mother solution of 1.000 mg / mL for use. Use the multiple dilution method to prepare standard concentrations of 20 µg / mL, 40 µg / mL, 80 µg / mL, 120 µg / mL, 160 µg / mL, and 200 µg / mL. Determine a series of prepared standard reference solutions under HPLC conditions, and draw a standard curve with the concentration of the standard as the horizontal axis (X) and the peak area as the vertical axis (Y).

[0084] Regression equation of Monascin: Y=0.8132X+2.4375(R 2 =0.9992);

[0085] The regression equation of Ankaflavin is: Y=0.428X+4.6344(R 2 =0.9992);

[0086] The regression equation of LOV is: Y=0.0999X+0.3861(R 2 =0.9993);

[0087] The regression equation of CIT is: Y=0.2096X-0.692 (R 2 =0.9991).

[0088] The concentrations of monascin and ankaflavin in the samples were calculated according to the standard curve regression equation, among which the amounts of LOV and CIT were lower than the limit of quantification, as shown in Table 2.

[0089] The solid-state fermentation of the purple Monascus strain ZYXQ-2206 produces 58.643 mg / g of monascin and 18.695 mg / g of ankaflavin, and the liquid fermentation produces 52.438 mg / g of monascin and 17.776 mg / g of ankaflavin, which are higher than the original Monascus strain 7-3 produced by the ancient method, and higher than the monascin and ankaflavin contained in the commercially available red yeast rice, as shown in Table 2. At the same time, unlike the prior art, no citrinin and lovastatin were detected in the fermentation product red yeast of the 7-3 strain and the ZYXQ-2206 strain, and the HPLC determination results of the reference substance, ZYXQ-2206 and the red yeast sample 7 are as follows: Figure 3 shown.

[0090] Table 2 Chemical content of red yeast rice (mg / g)

[0091]

[0092] nd: Not detected.

Claims

1. A Monascus purpurogenum, wherein: The Monascus purpurogenum ( Monascus purpureus )’s accession number is: CGMCCNO.41335.

2. The Monascus according to claim 1, wherein The nucleotide ITS sequence of the Monascus purpurogenous is shown in SEQ ID NO:

1.

3. A culture containing the Monascus purpurogenous bacteria according to claim 1.

4. Use of the Monascus purpurogenum according to claim 1 or the culture according to claim 3 in culturing monascusin and / or monascus yellow.

5. A method for culturing monascusin and / or monascus yellow, wherein: The method comprises culturing monascusin and / or monascus yellow by using the monascus fungus described in claim 1.

6. The method according to claim 5, wherein: Also includes the steps: activating the Monascus strain and inoculating it into a seed culture medium to obtain a strain seed solution; inoculating the strain seed liquid into a fermentation medium for fermentation culture; The Monascus strain is activated before being inoculated into the seed culture medium.

7. The method according to claim 6, wherein: The fermentation culture conditions are aerobic culture, the fermentation temperature is 25-50° C., the fermentation culture time is 2-20 days, and the fermentation culture method is solid fermentation or liquid fermentation.

8. The method according to claim 6, wherein: The contents of the components of the seed culture medium are as follows: 10-50 g / L of glucose, 5-30 g / L of peptone, 5-30 g / L of yeast powder, 2-20 g / L of soybean powder, 20-80 mL / L of glycerol, 0.2-2 g / L of magnesium sulfate, 0.5-5 g / L of sodium nitrate, 0.5-5 g / L of zinc sulfate, 0.2-2 g / L of potassium dihydrogen phosphate, and 10-50 g / L of maltodextrin.

9. The method according to claim 6, wherein: The raw materials of the fermentation medium are selected from one or more of rice, soybean, corn or yam.

10. The method according to claim 6, wherein: The inoculation amount of the strain seeds inoculated into the fermentation medium is 5-15% (V / V).

11. The method according to claim 6, wherein: The plate culture conditions are culturing at 25-50°C for 2-20 days.

Images