Engineered natural killer cells with enhanced tumor killing performance

Abstract

The invention relates to an engineered natural killer cell, in particular to a natural killer cell with enhanced tumor killing performance, a polynucleotide for coding CAR19 and a polynucleotide for coding IL-24 are integrated in a genome of the natural killer cell, and the engineered natural killer cell simultaneously expresses CAR19 and IL-24.

Description

Technical Field

[0001] The present invention relates to an engineered natural killer cell, in particular to a natural killer cell with enhanced tumor killing performance, a pharmaceutical composition containing the cell and application thereof. Background Art

[0002] In recent years, with the rise of CAR-T immune cells, more and more researchers have gradually paid attention to the field of immune cell therapy, and the use of immune cells for tumor treatment has also made breakthrough progress. Among them, chimeric antigen receptors have undoubtedly become the focus of many studies. Chimeric antigen receptors, also known as CAR (Chimeric Antigen Receptor), are cell surface receptors that can recognize specific proteins and are expressed on the cell surface. Structurally, chimeric antigen receptors generally include extracellular domains, transmembrane regions, and intracellular signal transduction regions. The extracellular domain contains an antigen binding site for recognizing specific antigens or proteins, usually an antibody-derived scFv molecule, which is connected to the transmembrane region through a hinge region; the transmembrane region is used to fix CAR on the cell membrane and stabilize the CAR molecule; the intracellular signal transduction region usually contains signal transduction structures and co-stimulatory structures, and the intracellular signal transduction region is responsible for signal transmission and stimulation and activation of cells.

[0003] CAR19 is a chimeric antigen receptor targeting CD19 antigen, which is used to target cells expressing CD19 molecules, such as B cell malignancies. NK cells, or natural killer cells, are NK cells that express chimeric antigen receptors targeting CD19 antigens on their surfaces. There are significant differences between CAR-NK cells and CAR-T cells. CAR-T cells often have more serious adverse reactions during treatment, such as cytokine storms, the production of a large number of inflammatory factors (including IL-6, etc.), damage to the nervous system, neurotoxicity, and graft-versus-host disease. More seriously, there are occasional deaths caused by CAR-T cell therapy; while CAR-NK cells are relatively safer, usually do not cause graft-versus-host disease, do not produce cytokine storms, and only secrete a small amount of IFN-γ, etc., their lifespan is short, potential unknown risks are low, and CAR-NK cells do not require antigen presentation, can play a role quickly, and have a broader spectrum of anti-tumor effects. Therefore, CAR-NK cells have better application prospects and are expected to become the main force of the second-generation cell immunotherapy.

[0004] In the prior art, CAR-T cells are often prepared by viral transduction. For example, the prior art document CN109735558A uses a lentiviral transduction system to prepare CAR-T cells. However, although lentiviral transduction is one of the common methods for intracellular gene modification and delivery, viral transduction has immune rejection reactions, which can easily cause unexpected rejection problems. At the same time, the virus can cause random integration of the genome, poor stability, and high risk. In addition, for NK cells, they are resistant to lentiviruses, which makes lentiviral transduction-based CAR-NK cells have a low transduction efficiency and rely on chemical reagents that promote lentiviral transduction efficiency. The chemical reagents used are often quite toxic to NK cells, which is not conducive to the preparation of CAR-NK cells.

[0005] IL-24, or interleukin 24, belongs to the IL-10 interleukin family. IL-24 can activate the p38MAPK signaling pathway to promote apoptosis of melanoma tumor cells. It is also used in CAR-T cells to enhance the proliferation and activation of T cells, which can enhance the therapeutic potential of CAR-T products. However, due to the many differences in the mechanism of action of NK cells and T cells on tumor cells, the principles of their ability to increase proliferation are also different. There is currently no evidence or report that IL-24 can be applied to CAR-NK cells to enhance the killing effect and proliferation ability of NK.

[0006] Therefore, how to overcome the adverse effects of lentivirus and improve the anti-tumor ability of CAR19-NK cells is one of the problems that technicians in this field need to solve. Summary of the invention

[0007] In order to overcome the problems of the lentiviral transduction system and improve the anti-tumor ability of CAR19-NK cells, the inventors of the present invention further introduced the gene encoding IL-24 into the genome of CAR19-NK cells by site-directed integration of non-viral vector transduction. After a large number of experiments, the inventors of the present invention obtained an engineered natural killer cell that simultaneously expresses CAR19 and IL-24, and unexpectedly found that the engineered natural killer cell has significantly enhanced tumor killing performance.

[0008] In a first aspect, the present invention provides an engineered natural killer cell, wherein a polynucleotide encoding CAR19 and a polynucleotide encoding IL-24 are integrated into the genome of the engineered natural killer cell, and the engineered natural killer cell simultaneously expresses CAR19 and IL-24.

[0009] In some embodiments of the present invention, the polynucleotide is site-specifically integrated into the genome of the natural killer cell, and the site-specific integration site is located in the ribosomal RNA transcription region (rDNA region) of the genome, such as the transcription region of 5S rRNA, 5.8S rRNA, 18S rRNA or 28S rRNA, preferably, the site-specific integration site is located in the transcription region of 18S rRNA, and more preferably, the site-specific integration site is located at position 5468 of the 18S rRNA transcription region.

[0010] In some embodiments of the present invention, the polynucleotide encoding CAR19 and the polynucleotide encoding IL-24 are located on the same polynucleotide chain.

[0011] In some embodiments of the present invention, there are other polynucleotide fragments between the polynucleotide encoding CAR19 and the polynucleotide encoding IL-24, for example, there is a polynucleotide encoding a 2A peptide between the polynucleotide encoding CAR19 and the polynucleotide encoding IL-24, preferably, the 2A peptide is selected from P2A, T2A, E2A and F2A, more preferably, the 2A peptide is T2A, and its amino acid sequence is shown in SEQ ID NO: 1. Other sequences known in the prior art that can cause the simultaneous production of CAR19 and IL-24 can also be applied to the present invention, such as IRES sequences. In some embodiments, CAR19 and IL-24 exist and are expressed in a polycistronic form in an expression frame, or expressed in an independent expression frame. Both can be in one vector or in different vectors.

[0012] In some embodiments of the present invention, the CAR19 is a chimeric antigen receptor targeting the CD19 antigen, and preferably, the amino acid sequence of the CAR19 is as shown in SEQ ID NO:4.

[0013] In some embodiments of the present invention, the IL24 is a modified or unmodified IL24. Preferably, the amino acid sequence of the IL-24 is as shown in SEQ ID NO:2.

[0014] In some embodiments of the present invention, the nucleotide fragment site-specifically integrated into the genome of natural killer cells encodes: the antigen binding portion of an antibody that specifically recognizes the tumor antigen CD19 located in the extracellular region, the transmembrane region and the CD28 cytoplasmic functional region and CD3zeta cytoplasmic functional region located in the intracellular region, and IL-24 that can be secreted. Preferably, the sequence of the nucleotide fragment is as shown in SEQ ID NO: 6.

[0015] In some embodiments of the present invention, the natural killer cells are obtained by engineering natural killer cells isolated from peripheral blood, or are engineered and differentiated from progenitor cells derived from bone marrow, cord blood or peripheral blood, or are engineered and differentiated from pluripotent stem cells. Preferably, the natural killer cells are engineered and differentiated from pluripotent stem cells. More preferably, the natural killer cells are engineered and differentiated from induced pluripotent stem cells.

[0016] In a second aspect, the present invention provides a method for constructing an engineered natural killer cell as described in the first aspect, comprising integrating a polynucleotide encoding CAR19 and a polynucleotide encoding IL-24 into the genome of the cell, wherein the integration is performed by a gene editing system without using viruses.

[0017] In some embodiments of the present invention, the gene editing system is selected from the Cre-lox system, Zinc FingerNucleases (ZFNs), CRISPR-Cas9 or Transcription Activator-Like Effector Nucleases (TALENs), preferably CRISPR-Cas9 or TALENs.

[0018] In some embodiments of the present invention, the cell is a natural killer cell or a pluripotent stem cell, preferably a pluripotent stem cell, and more preferably an induced pluripotent stem cell.

[0019] In a third aspect, the present invention provides a method for directing differentiation of pluripotent stem cells into natural killer cells, comprising:

[0020] 1) Differentiating pluripotent stem cells into hematopoietic stem cells, adding Chroman 1, Emricasan and Trans-ISRIB molecules during the differentiation process; and

[0021] 2) Inducing the hematopoietic stem cells obtained in step 1) to differentiate into natural killer cells.

[0022] In some embodiments of the present invention, the volume molar concentration ratio of Chroman 1, Emricasan and Trans-ISRIB molecules is 1:80-120:10-15, preferably 1:100:14.

[0023] The pluripotent stem cells obtained in the second aspect of the present invention can be directed to differentiate into natural killer cells using the method of the third aspect.

[0024] In a fourth aspect, the present invention provides a pharmaceutical composition comprising the engineered natural killer cells described in the first aspect or the engineered natural killer cells constructed by the method described in the second aspect, and a pharmaceutically acceptable carrier.

[0025] The present invention also provides use of the engineered natural killer cells described in the first aspect, the engineered natural killer cells constructed by the method described in the second aspect, or the pharmaceutical composition described in the fourth aspect in preparing a drug for treating tumors or autoimmune diseases.

[0026] In some embodiments of the invention, the tumor is selected from advanced or refractory hepatocellular carcinoma, colorectal cancer, non-small cell lung cancer, triple-negative breast cancer, gastric cancer, gastroesophageal junction adenocarcinoma, bile duct cancer, urothelial carcinoma and esophageal square cell carcinoma, brain tumors, lung cancer, breast cancer, ovarian cancer, fallopian tube cancer, prostate cancer, cervical cancer, thyroid cancer, nasopharyngeal carcinoma, glioblastoma, colorectal adenocarcinoma, pituitary tumor, pituitary adenoma, pituitary macroadenoma, gestational trophoblastic tumor, choriocarcinoma, placental site trophoblastic tumor, epithelioid trophoblastic tumor, renal cell carcinoma, melanoma, myeloma, lymphoma, lung adenocarcinoma and gliosarcoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The diagram shows the construction of the rDNA region donor vector and pHrneo-CAR19 and pHrneo-CAR19-IL-24. The CAR19 or CAR19-IL-24 fragments were inserted into the pHrneo-PspX1-Xba1 backbone to obtain the rDNA region targeting vectors pHrneo-CAR19 and pHrneo-CAR19-IL-24.

[0028] Figure 2 Schematic diagram of gene targeting of iPSCs using donor vector plasmid.

[0029] Figure 3 Figure 2 shows a schematic diagram of pHrneo-CAR19-IL-24 combined with TALENickases targeting iPSCs. The top is a schematic diagram of the 5468 site in the rDNA region that is not targeted; the middle is a schematic diagram of the structure of the targeting vector pHrneo-CAR19-IL-24; the bottom is a schematic diagram of the gene structure after successful targeting. The F1+R1 and F2+R2 primer combinations span the 5' and 3' homology arms, respectively, and are used for PCR screening of site-specific integrated clones.

[0030] Figure 4 The figure shows PCR identification of iPSCs with site-specific integration of CAR19-IL-24, where lane M is a DNA molecular weight marker, and N or NC represents non-targeted iPSC sample templates.

[0031] Figure 5The Southern Blot test results are shown. NC represents the non-targeted iPSC sample template. A band of about 5.7 Kb can be detected in the positive CAR19-IL-24 targeting candidate clone, and a band of about 4.9 Kb can be detected in the positive CAR19 targeting candidate clone.

[0032] Figure 6 The figures show the percentage of hematopoietic stem cell (HSC) yield, where (A) shows the percentage of CD34+ cells under two conditions, and (B) shows the ratio of the number of CD34+ cells that can be harvested compared to the input starting iPSC cells.

[0033] Figure 7 Shows the expression levels of CAR gene in different cells.

[0034] Figure 8 The phenotypic detection results of four types of iNK cells are shown, wherein (A) shows the representative flow cytometry detection results of NK markers CD56 and CD16, and (B) shows the statistical results.

[0035] Fig. 9 The results showed that CAR19-IL-24-iNK highly expressed CD57, CD158 and TRAIL.

[0036] Fig.10 The killing efficiency of various cells in killing tumor cells in vitro is shown.

[0037] Fig.11 The expansion effects of the four types of iNK cells in vitro are shown.

[0038] Fig.12 Figure 2 shows the fluorescence detection of mouse bioluminescence.

[0039] Fig.13 The fluorescence signal statistics are shown in Figure 2. Fig.13 A shows the bioluminescent signal statistics of mice at different time points. Fig.13 B shows the bioluminescent signal statistics of mice on Day 28. DETAILED DESCRIPTION

[0040] the term

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as understood by one of ordinary skill in the art.

[0042] Although the numerical ranges and parameter approximations shown in the broad scope of the present invention, the numerical values ​​shown in the specific embodiments are recorded as accurately as possible. However, any numerical value is bound to contain a certain error, which is caused by the standard deviation in their respective measurements. In addition, all ranges disclosed herein should be understood to cover any and all sub-ranges contained therein. For example, the range of "1 to 10" recorded should be considered to include any and all sub-ranges between the minimum value 1 and the maximum value 10 (including the endpoints); that is, all sub-ranges starting with a minimum value of 1 or greater, such as 1 to 6.1, and sub-ranges ending with a maximum value of 10 or less, such as 5.5 to 10. In addition, any reference referred to as "incorporated herein" should be understood to be incorporated in its entirety.

[0043] It should also be noted that, as used in this specification, singular forms include plural forms of their referents unless clearly and unambiguously limited to one referent. The term "or" can be used interchangeably with the term "and / or" unless the context clearly indicates otherwise.

[0044] iPSCs or iPSCs (Induced pluripotent stem cells), refers to induced pluripotent stem cells, and can be used interchangeably in this article.

[0045] Natural killer cells (NK) are important immune cells in the body. They are not only related to anti-tumor, anti-viral infection and immune regulation, but also participate in the occurrence of hypersensitivity reactions and autoimmune diseases in some cases. They can recognize target cells and killing mediators. iNK refers to NK cells formed after induced differentiation using pluripotent stem cells (such as induced pluripotent stem cells) as starting cells. NK cells can be separated from peripheral blood, differentiated from progenitor cells derived from bone marrow, umbilical cord blood or peripheral blood, or induced and differentiated from pluripotent stem cells.

[0046] During cell differentiation, hematopoietic stem cells are referred to as CD34+ cells, and the two are used interchangeably in this article. CD34+ is a hematopoietic stem cell marker.

[0047] 2A peptides are short peptides (about 18-25 amino acids) derived from viruses. They are often called "self-cleaving" peptides, which can produce multiple proteins from one transcription product. There are currently four commonly used 2A peptides, namely P2A, T2A, E2A and F2A, which are derived from four different viruses.

[0048] The term "gene editing" refers to the editing (directed modification) of target genes and their transcription products to achieve the addition or deletion of specific DNA fragments, the deletion or replacement of specific DNA bases, etc., in order to change the sequence, expression level or function of the target gene or regulatory element.

[0049] In some embodiments of the present invention, the integration is performed by gene editing, and the gene editing techniques known in the prior art can be adopted by the present invention, as long as the site-specific integration of the target polynucleotide can be achieved, such as the Cre-Lox system, Zinc Finger Nucleases (ZFN), CRISPR or TALEN, preferably CRISPR or TALEN, and more preferably TALEN / TALENickase-mediated gene editing. The Cre-Lox system is a recombinase system found in the P1 phage. By utilizing the mechanism of the recombinase Cre to specifically recognize the LoxP recombination site, gene editing functions such as gene knockout, inversion and translocation can be achieved in target cells and target tissues. ZFNs (zinc-finger nucleases) are composed of a zinc finger protein domain that determines its specificity and a Fok I nuclease domain that cuts DNA, and are an artificial nuclease. The CRISPR system is mainly composed of Cas9 protein and single-stranded guide RNA (sgRNA), in which Cas9 protein plays the role of cutting double-stranded DNA, and sgRNA plays the role of guide. Under the guidance of sgRNA, through the principle of base complementary pairing, Cas9 protein can cut different target sites to achieve double-strand breaks of DNA. In addition to CRISPR / Cas9, the CRISPR system also has other Cas proteins, such as Cas12, Cas13, and Cas14. The core of TALENs (transcription activator-like effector nucleases) technology is TALE protein. The main structure of TALE protein is divided into three parts, including: tandem repeat sequence (Repeat domain) of the central domain, nuclear localization signal and acidic transcription activation domain, among which the tandem repeat sequence of the central domain is the region where TALENs technology specifically recognizes DNA sequence.

[0050] The term "ribosomal RNA transcription region" refers to the region in the genome that can be transcribed into ribosomal RNA (rRNA). The ribosomal RNA transcription region is multiple copies in the genome. Among the four rRNA genes in the human genome, the 18S, 5.8S and 28S rRNA genes are connected in series, and each gene is separated by a spacer region, with hundreds of copies; the 5S rRNA gene is on another chromosome, with about 500 copies, arranged in series on the chromosome.

[0051] Since the ribosomal RNA transcription region has multiple copies, selecting the ribosomal RNA transcription region as the integration site, i.e., the site of gene editing, greatly improves the efficiency of gene editing and can quickly obtain a large number of candidate cells carrying the target gene. In addition, since the ribosomal RNA transcription region has multiple copies, the presence of integrated target genes in some copies will not affect the normal transcription level of the ribosomal RNA. In addition, the ribosomal RNA transcription region does not encode proteins or regulate gene expression, and integration in some copies will not affect the original protein expression and function of the cell.

[0052] In some embodiments of the present invention, the integration occurs at a specific site, which may be a different position in the ribosomal RNA transcription region. Preferably, the integration occurs at the 5468 site in the 18S rRNA transcription region. The "5468 site in the 18S rRNA transcription region" or "5468 site" described herein have the same meaning and can be used interchangeably. The "5468 site" refers to the +5468 site of the 18S rRNA gene.

[0053] The compositions of the present invention can be administered by a variety of methods known in the art. It will be appreciated by those skilled in the art that the route of administration and / or mode will vary depending on the desired results. In order to administer the compounds of the present invention by a particular route of administration, it may be necessary to cover the compounds with materials that prevent their inactivation, or to administer the compounds together with the materials. For example, the compounds may be administered to a subject in a suitable carrier, such as a liposome or a diluent. Pharmaceutically acceptable diluents include saline solutions and aqueous buffers. Pharmaceutical carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is known in the art.

[0054] Compositions of the present invention may also include adjuvants, such as preservatives, wetting agents, emulsifiers and dispersants. The presence of microorganisms can be avoided by the sterilization procedure above and by including multiple antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. It may also be desirable to include isotonic agents, such as sugar, sodium chloride, etc. in the composition. In addition, the extended absorption of injectable drug forms can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin.

[0055] The technical solution provided by the present invention has at least one of the following advantages:

[0056] 1. On the one hand, the present invention does not involve viruses, especially lentiviruses, in the entire process flow, and uses non-viral vectors to prepare NK cells in a site-specific integration manner, thereby avoiding resistance to NK cells, reducing immune rejection reactions, and circumventing problems such as random integration of the genome, poor stability, and high risks.

[0057] 2. On the other hand, the present invention uses iPSC-stage cells as seed cells for producing NK cells, thereby improving the stability and uniformity of NK cells.

[0058] 3. In a specific embodiment of the present invention, a non-viral vector is used to simultaneously integrate the genes encoding CAR19 and IL-24 at the 5468 site of the rDNA region of the iPSCs cell genome by means of site-specific integration. The results unexpectedly showed that iNK cells that integrated the CAR19 and IL-24 genes by means of non-viral vector site-specific integration rather than viral methods had a higher content of CD56+CD16+ double-positive cells, and the expression of NKG2D, CD57, CD158 and TRAIL was also significantly higher than that of other types of cells. For NK cells, the tumor killing ability of NK cells themselves was significantly improved by site-specific integration of the CAR19-IL-24 gene.

[0059] 4. In a specific embodiment of the present invention, during the differentiation of iPSCs cells into iNK cells, a combination of Chroman 1, Emricasan and Trans-ISRIB molecules is specifically added to significantly increase the yield of CD34+ cells. Preferably, Chroman 1, Emricasan and Trans-ISRIB molecules are added during the differentiation stage of iPSCs cells into hematopoietic stem cells. More preferably, the volume molar concentration ratio of Chroman 1, Emricasan and Trans-ISRIB is 1:80-120:10-15, which can significantly increase the yield of CD34+ cells.

[0060] All publications, patents, and patent applications cited in this specification are herein incorporated by reference, as if each individual publication, patent, or patent application were specifically set forth in its entirety and were individually incorporated herein by reference.

[0061] The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The methods and steps not specifically described in the following examples are all methods and steps known to those skilled in the art, or are operated according to the instructions of the commercially available products. The various experimental reagents used in the examples are all commercially available products, and the same products used in different processes or experimental steps are from the same source. Example

[0062] The following is a further description of some preferred embodiments and aspects of the present invention in conjunction with specific examples, which should not be construed as limiting the scope thereof. pHrneo-CAR19, also abbreviated as pCAR19; pHrneo-CAR19-IL-24, also abbreviated as pCAR19-IL-24, in the examples can be used interchangeably. Example 1: Construction of iPSC cells with site-specific integration of CAR19 gene or CAR19-IL-24 gene

[0063] 1.1 Construction of donor targeting plasmids pHrneo-CAR19 and pHrneo-CAR19-IL-24

[0064] In Example 1 of the present invention, the donor targeting plasmids pHrneo-CAR19 and pHrneo-CAR19-IL-24 are constructed to insert the CAR19 gene or CAR19-IL-24 gene into the rDNA region 5468 site of the iPSC genome. CAR19 in the specific embodiment of the present invention is derived from the prior art ("Construction and Preclinical Evaluation of an Anti-CD19 Chimeric Antigen Receptor. Journal of Immunotherapy", James N. Kochenderfer et al., J Immunother, 2009, 32 (7), pp. 689-702, Synthetic construct FMC63-28Z receptor protein gene, complete cds), and the specific enzyme cutting method adopts the enzyme cutting method known to those skilled in the art. Specifically, the disclosed pHrneo-IL-24 vector (see the prior art "Enhanced tumor growth inhibition by mesenchymal stem cells derived from iPSCs with targeted integration of interleukin24 into rDNA loci", Bo Liu et al., Oncotarget, Vol. 8, No. 25, pp. 40791-40803, March 28, 2017) was used and double digested with restriction endonucleases PspX1 and Xba1 as the backbone (pHrneo-PspX1-Xba1).Using pLV-CAR19-IL-24 (see prior art - "IL-24armored CAR19-T cells show enhanced antitumor activity and persistence", HuQ et al., Signal Transduct Target Ther. 2021 Jan 14, 6 (1): 14) and pHrneo-IL-24 as templates, PCR was used to amplify the CAR19 (its nucleotide sequence is shown in SEQ ID NO: 5) and CAR19-IL-24 (its nucleotide sequence is shown in SEQ ID NO: 6) genes, respectively, so that both ends had PspX1 and Xba1 enzyme recognition sequences. The product was double-digested with PspX1 and Xba1 as an insert and connected to the pHrneo-PspX1-Xba1 backbone to obtain rDNA region targeting vectors pHrneo-CAR19 (its nucleotide sequence is shown in SEQ ID NO: 7) and pHrneo-CAR19-IL-24 (its nucleotide sequence is shown in SEQ ID NO: 8), respectively. The vectors were sequenced and confirmed to be consistent with the design (targeting vector structure as shown). Figure 1 shown).

[0065] 1.2 Co-transfection of TALENickase plasmid and donor targeting plasmid into iPSCs

[0066] In order to generate iPSC cells with site-specific integration of CAR19 gene or CAR19-IL-24 gene, specifically, LONZA Amaxa Human Stem Cell Nucleofector Kit (Lonza, Catalog No. VPH-5022) nuclear transfer kit is used, combined with TALENickases (constructed according to prior art literature, see prior art literature, Y.Wu, T.Gao, X.Wang, et al., TALE nickase mediates high efficiency targeted transgene integration at the human multi-copy ribosomal DNA locus [J], BiochemBiophys Res Commun, 446 (2014) 261-266) and donor vector plasmids to perform gene targeting on iPSCs, such as Figure 2 shown.

[0067] iPSCs were single-celled using TrypLE Select (purchased from Thermo Fisher, catalog number: 12563029) and counted. Approximately 3 × 106 Cells (prepare 2 6-well plates with cells for backup). Nuclear transfection was performed according to the instructions of the nuclear transfection kit (using Amaxa Human Stem Cell Nucleofector Kit from LONZA). The specific nuclear transfection steps are as follows:

[0068] Prepare 100 μL of nuclear transfer solution (82 μL Solution 2 + 18 μL Supplement 1, both Solution 2 and Supplement 1 are components of the Amaxa Human Stem Cell Nucleofector Kit from LONZA), resuspend 3×10 6 iPSCs. Add 4 μg of the targeting vector pHrneo-CAR19 or pHrneo-CAR19-IL-24 and 4 μg of TALENickases expression plasmid (left arm + right arm) and mix well. Control the volume of the added plasmid to not exceed 6 μL.

[0069] Nucleofection was performed using the B-016 Nucleofection program.

[0070] The iPSCs were inoculated into a 10 cm culture dish pre-seeded with G418-resistant MEF feeder cells (available from Millipore, catalog number PMEF-NL), ESCs culture medium was used, and 10 μM Y-27632 (available from STEMCELL, catalog number: #72304) was added. After shaking, the dish was cultured in a 37°C, 5% CO2 cell culture incubator.

[0071] After 24 hours of nuclear transfection, fresh ESCs culture medium was replaced and the cell adhesion was observed under a microscope. Subsequently, fresh culture medium was replaced every day, and the morphology and density of cell clones were observed. After a certain period of time, monoclonal screening of targeted cells was performed, cultured to an appropriate size, and single clones were mechanically picked out for identification of monoclonal cells to confirm that the target gene was efficiently site-specifically integrated into the 5468 site of the rDNA region. The specific schematic diagram of targeted iPSC is shown in the figure. Figure 3 shown.

[0072] 1.3 Identification of iPSC clones with site-specific integration

[0073] This step is to identify the iPSCs clones with site-specific integration of the CAR19 gene or CAR19-IL-24 gene. Specifically, after the selected monoclonal cells are amplified, digested and passaged to two wells of a 24-well plate, the ratio of the cell volume in the two wells is 1:9. The smaller portion is used for seed culture, and the larger portion can be used for site-specific integration PCR identification after 2 to 3 days of passage. Cross-homologous arm PCR identifies whether homologous recombination has occurred in the selected clones, which can be detected by amplifying fragments across the 5′ and 3′ homologous arms, respectively.

[0074] After extracting gDNA, this example uses (TaKaRa) enzyme for cross-homologous arm PCR detection. The reaction system is as follows:

[0075]

[0076] The reaction procedure is as follows:

[0077]

[0078] The products were analyzed by agarose gel electrophoresis. The sequence length of the 5' homologous recombination PCR product 70F1+71R1 of the positive clone was 1817 bp, the 3' homologous recombination PCR product 72F2+73R2 of the positive clone was 1589 bp, and 74F3+73R2 was 1483 bp. The negative cells without targeting had no bands. Figure 4 shown.

[0079] For the detection of CAR19 targeting clones, since the terminal sequence of CAR19 is different from that of CAR19-IL-24, the detection primer combination 74F3+73R2 across the 3' homology arm was designed. For the clones with successful site-directed integration of CAR19, 70F1+71R1 and 74F3+73R2 can amplify products of approximately 1.8Kb and 1.5Kb, respectively. The product was sequenced to confirm its sequence, confirming the targeting of the CAR19 gene.

[0080] The specific sequences of the primers involved in PCR detection are as follows:

[0081] 70Screen-F1 CCTGAGAAACGGCTACCACATCC(SEQ ID NO:9)

[0082] 71Screen-R1 TTTCCACAACTATCCAACTCACAACG(SEQ ID NO:10)

[0083] 72Screen-F2 GAGCATTCAAACAGTTGGACG(SEQ ID NO:11)

[0084] 73Screen-R2 GATCCACCGCTAAGAGTCGTAC(SEQ ID NO:12)

[0085] 74Screen-F3GCACGATGGCCTTTACCAGG(SEQ ID NO:13)

[0086] Further Southern Blot analysis confirmed the expected integration bands. Figure 5 As shown. Thus, it was determined that iPSC clones with site-specific integration of CAR19 gene or CAR19-IL-24 gene were obtained. Example 2: Construction of iPSC cells with random integration of CAR19 gene using lentivirus (site-specific integration in non-rDNA region)

[0087] In this example, iPSCs were directly transduced by lentivirus, and then GFP+ single clones were selected to establish iPSCs with random integration of the CAR19 gene ( LV CAR-iPSCs), LV The preparation method of CAR-iPSCs is as follows:

[0088] 1. Preparation of CAR 19 lentivirus (i.e. LV CAR)

[0089] This embodiment adopts the disclosed method steps and processes to prepare CAR 19 lentivirus. For details, please refer to paragraphs

[0035] -

[0089] of the specific implementation method section of the prior art document CN109735558A specification.

[0090] 2. Preparation LV CAR-iPSCs

[0091] 5e5 iPSCs were inoculated, and the prepared virus was added after 18 hours and incubated for 6 hours, and then replaced with iPSC medium. After 72 hours, the cells were subcultured to a 10 cm dish. Then, the cells were observed under a microscope and the positions of GFP-positive clones were marked. When the clones grew to a diameter of about 500 μM, they were picked up and cultured in separate culture wells for expansion.

[0092] Random integration of lentivirus LV Three groups of CAR-iPSCs were cloned as rDNA Subsequent study control of CAR-iPSCs (rDNA region), and LV CAR-iPSCs are tagged with GFP for subsequent tracking and detection.

[0093] The present invention uses the Trizol method to extract total cell RNA in the embodiment, and confirms the rDNACAR-iPSCs (i.e. iPSCs with the CAR19 gene integrated at site 5468 in the rDNA region) and LV Like CAR-iPSCs, both have obvious CAR19 gene expression.

[0094] The specific sequences of the primers involved in the Q-PCR test are as follows:

[0095] Ribosomal 18S-F: AACCCGTTGAACCCCATT (SEQ ID NO:14)

[0096] Ribosomal 18S-R: CCATCCAATCGGTAGTAGCG (SEQ ID NO: 15)

[0097] FMC63-F4:GTGGCTGGGAGTAATATGGG(SEQ ID NO:16)

[0098] FMC63-R4:GGAGACGGTGACTGAGGTTC(SEQ ID NO:17)

[0099] IL24-F: CAGGCGGTTCTGCTATTC (SEQ ID NO:18)

[0100] IL24-R:GAATTTCTGCATCCAGGTCA(SEQ ID NO:19)

[0101] Clones with relatively excellent expression were selected for subsequent experiments. The original iPSCs without targeting continued to be recorded as iPSCs, the iPSC cells with random integration of the CAR19 gene by lentivirus were recorded as LV-CAR19-iPSCs, the iPSCs with site-specific integration of the CAR19 gene at the 5468 site of the rDNA region were recorded as CAR19-iPSCs, and the iPSC cells with site-specific integration of the CAR19-IL-24 gene at the 5468 site of the rDNA region were recorded as CAR19-IL24-iPSCs.

[0102] Through teratoma experiments, it was confirmed that iPSC, LV-CAR19-iPSC, CAR19-iPSC and CAR19-IL24-iPSC can all form teratomas and differentiate into three germ layer tissues. Example 3: Preparation of iNK cells with site-specific integration of CAR19 gene or CAR19-IL-24 gene

[0103] In this embodiment, the inventors induced the differentiation of iPSC, LV-CAR19-iPSC, CAR19-iPSC and CAR19-IL24-iPSC into NK cells in vitro. Specifically, the cells at the iPSC stage are first differentiated into hematopoietic stem cells, and then the hematopoietic stem cells are differentiated into NK cells. The following steps are included:

[0104] 3.1 Differentiation of iPSCs into hematopoietic stem cells

[0105] Prepare iPSC-stage cells: Culture iPSC-stage cells normally on Matrigel matrix gel and digest them when the confluence reaches about 70-80%. There are about 2 million cells in a well of a 6-well plate;

[0106] Prepare Aggrewell 800 (purchased from STEM CELL, catalog number 34825): add 2 ml Rinsing buffer (purchased from STEM CELL, catalog number 07010) / well (six-well plate), centrifuge at 1300 g for 5 min to remove micropore bubbles;

[0107] Spin EB formation: discard the culture medium from the original iPSC culture wells, wash once with 1 ml D-PBS, and incubate with TrypLE Select enzyme (purchased from Thermo Fisher, catalog number: 12563029) at 37°C, 1 ml / well for about 5 min;

[0108] Use 1ml DMEM / F12 + 10% fetal bovine serum to resuspend and dissociate, prepare a 50ml centrifuge tube and a 40μm cell sieve, sieve with 5ml DMEM / F12 + 10% fetal bovine serum mixed cell suspension, wash the cell sieve once with 5ml D-PBS, centrifuge at 1000rpm for 5min, discard the supernatant, wash the cells once with 5ml D-PBS, resuspend in 1ml Aggrewell EB formation medium (purchased from STEM CELL, catalog number 05893) and count;

[0109] Take out the incubated plate between counting, discard the Rinsing buffer, wash once with DMEM / F12, add 2 ml of Aggrewell EB formation medium (without cytokines) and put the plate into the cell culture incubator;

[0110] Count the cells, inoculate 7.5 to 9 million / well (six-well plate), and resuspend the cells in Aggrewell EB formation medium to a cell density of 3 ml / well. At this time, there is a total of 5 mL of medium in the well. Add cytokines at a volume of 5 ml / well. The above-mentioned cytokines and their final concentrations are SCF (Acro, Catalog No. SCF-H52H3) 40 ng / mL; BMP4 (Peprotch, Catalog No. 120-05ET) 20 ng / mL; VEGF (SinoBiological, Catalog No. 10008-HNAH) 20 ng / ml. The following small molecules can be optionally added and the final concentrations are UM729 (APExBIO, A8952) 1μM (i.e. 1μmol / L); ROCKi Y-27632 (STEM CELL, 72304) 10μM (i.e. 10μmol / L); Chroman 1 (MCE, HY-15392) 50nM (i.e. 50nmol / L), Emricasan (MCE, 10396) 5μM (i.e. 5μmol / L), Trans-ISRIB (Tocris) 0.7 μM (i.e. 0.7 μmol / L). Chroman 1 is a ROCK selective inhibitor; Emricasan (also known as IDN-6556 or PF-03491390) is an inhibitor of activated caspases; Trans-ISRIB is a highly selective PERK inhibitor.

[0111] In addition, in this step, a control group without adding Chroman 1, Emricasan and Trans-ISRIB molecular combination to cytokines was used (control group was recorded as +Y-27632 group), and an experimental group with adding Chroman 1, Emricasan and Trans-ISRIB molecular combination was recorded as +CET group.

[0112] Centrifuge the plate at 25°C, 100g for 3 minutes. Incubate at 37°C, 5% CO2 for 6 days. Change the medium every other day before day 4, and then change the medium every day as the medium consumption is obvious. Take samples after 6 days and detect the expression of hematopoietic stem cell marker CD34 by flow cytometry to evaluate the directional differentiation of hematopoietic stem cells. If more than 50% CD34+ cells can be detected, the cells at this stage will be subjected to the next differentiation operation.

[0113] At the same time, flow cytometry was used to detect Figure 6As shown, the introduction of the combination of Chroman 1, Emricasan and Trans-ISRIB molecules during the hematopoietic differentiation stage of iPSC significantly increased the yield of CD34+ cells, while the control group without the addition of the combination of Chroman 1, Emricasan and Trans-ISRIB molecules had a lower CD34+ cell yield. In this embodiment, the volume molar concentration ratio of Chroman 1, Emricasan and Trans-ISRIB molecules is 1:100:14.

[0114] 3.2 Inducing differentiation of hematopoietic stem cells into NK cells

[0115] The EB cells obtained after incubation in 3.1 were dissociated and CD34+ cells were sorted using StemSpan TM NK Cell Generation Kit (STEMCELL, Cat#09960), the cells were differentiated into iNK cells according to the steps in its instructions, and the differentiation cycle was 28 days. In addition, the sorted CD34+ cells can also be differentiated into iNK cells using conventional methods in the art, and this step is not particularly limited in the specific embodiments of the present invention.

[0116] Phenotypic detection of the differentiated cells (iNK, LV-CAR19-iNK, CAR19-iNK, and CAR19-IL24-iNK) revealed that overexpression of the CAR gene could be detected in LV-CAR19-iNK, CAR19-iNK, and CAR19-IL24-iNK, and the expression levels of the CAR gene in the three cell types were basically equivalent. In CAR19-IL24-iNK, the introduction of IL24 did not affect the expression of the CAR gene. Figure 7 shown.

[0117] In addition, the inventors found that CAR19-IL-24-iNK has more excellent characteristics by detecting cell surface markers. It is generally believed that CD56+ and / or CD16+ are lineage-specific markers of NK cells, such as Figure 8As shown, the content of CD56+CD16+ double positive cells in CAR19-IL-24-iNK is the highest, the content of CD56+CD16- cells is the second, there are almost no CD56-CD16+ cells, and the proportion of CD56-CD16- double negative cells is also low. Therefore, the content of cells that can kill tumors in CAR19-IL-24-iNK is high, and the content of double positive cells is the highest; the content of CD56-CD16- double negative cells in CAR19-iNK is the highest, which means that the content of NK cells with killing effect in CAR19-iNK is the lowest, which is not conducive to the killing and inhibition of tumors; the content of CD56+CD16- cells in LV-CAR19-iNK is the highest, and the content of CD56+CD16+ double positive cells is not high; among the four types of cells, the content of CD56-CD16+ cells is the least. It can be seen from this that only through the site-specific integration of the CAR gene, more CD56-CD16- double-negative cells appeared in iNK cells, which is not conducive to tumor killing and inhibition. However, adding the IL-24 gene on the basis of the site-specific integration of the CAR gene significantly reduced the proportion of CD56-CD16- double-negative cells and greatly increased the content of CD56+CD16+ double-positive cells, which is beneficial to improving the cells' tumor killing effect. The addition of the IL-24 gene improved the phenotype of iNK cells themselves, increased the proportion of CD56+CD16+ double-positive cells, inhibited the generation of CD56-CD16- double-negative cells to a large extent, and increased the content of iNK cells with tumor-aggressiveness.

[0118] like Fig. 9 As shown in the figure, compared with iNK, LV-CAR19-iNK and CAR19-iNK, CAR19-IL-24-iNK significantly overexpresses CD57, CD158 and TRAIL, and the expression of NKG2D is also significantly better than that of the other three types of cells. CD57, also known as HNK-1 and Leu-7, is an important marker of NK cells. It can also be expressed in some T lymphocytes such as CTL. It is a marker of NK cell maturation and affects the toxicity of NK cells. CD158 is a diverse and polymorphic NK cell receptor subtype that participates in the regulation of NK cell activation and inhibition. TRAIL, also known as CD253 or TNFSF10, binds to death receptors DR4 (TRAIL-RI) and DR5 (TRAIL-RII) to kill tumor cells. NKG2D, also known as CD314, is a NK cell toxicity receptor that can recognize a variety of ligands to kill tumor cells. It can be seen that in the site-specific integration mode, the introduction of IL-24 significantly increased the expression of NKG2D, CD57, CD158 and TRAIL, and improved the tumor killing ability of iNK cells themselves. Example 4: Anti-tumor ability detection

[0119] The iNK, LV-CAR19-iNK, CAR19-iNK and CAR19-IL-24-iNK obtained in implementation three were tested for their killing ability, and it was found that CAR19-IL-24-iNK had enhanced anti-tumor ability.

[0120] 3.1 In vitro anti-tumor and proliferation ability detection

[0121] In this example, the above four types of cells were co-cultured with Nalm6 cells in vitro for 18 hours, and the killing efficiency was detected. The experimental results showed that compared with iNK, iNK cells carrying the CAR19 gene or the CAR19-IL-24 gene showed stronger killing ability. The killing ability of iNK cells with site-specific integration of rDNA region and random integration of lentivirus was similar. Surprisingly, iNK cells with site-specific integration of CAR19-IL-24 had stronger killing ability of CAR19-IL-24-iNK compared with iNK cells with only CAR19 gene integration. The specific killing efficiency results are shown in the figure. Fig.10 shown.

[0122] At the same time, in this example, the inventors used conventional methods known in the art to perform amplification experiments on the four types of cells, and detected their amplification multiples after a certain period of time. The results showed that the introduction of the IL-24 gene greatly enhanced the proliferation ability of CAR19-IL-24-iNK cells. The specific results are as follows Fig.11 shown.

[0123] 3.2 In vivo tumor suppression ability detection

[0124] The iNK, LV-CAR19-iNK, CAR19-iNK and CAR19-IL-24-iNK obtained in Example 3 were further tested for their in vivo tumor inhibition ability. The Nalm6 tumor model was established using immunodeficient mice M-NSG (Shanghai Southern Model Organisms, NM-NSG-001). Specifically, at about 8 weeks of age, mice were transplanted with 1*10 6 Nalm6 tumor cells are recorded as Day 0. The transplanted Nalm6 cells carry a GFP-Luc marker, Luc is firefly luciferase, which can make the corresponding substrate D-Luciferin, Potassium Salt (Yeasen#40902ES08) produce bioluminescence and then be detected. The detection instrument is IVIS Lumina (Perkin Elmer, USA). The luminescence signal value is positively correlated with the progression of tumor cells in mice.

[0125] The substrate was injected on Day 10, 14, 19, 24 and 28, respectively. D-Luciferin (15 mg / mL) was injected intraperitoneally at a dosage of 10 μL / g. The mice were anesthetized and placed in the IVIS Lumina instrument. Bioluminescent signal detection was performed 10 minutes after injection. The corresponding treatment was given on Day 4, 11 and 18. The amount of therapeutic cells injected was 3*10 6 The method is tail vein injection.

[0126] The bioluminescence detection image of tumor model mice indicates the rapid progression of tumors. The bioluminescence signal gradually spreads from the local area, and the signal intensity gradually increases from low (red in the figure indicates high signal intensity). Fig.12 shown.

[0127] In the early stage of treatment, all groups showed good tumor growth inhibition effects. However, on Day 24, mice in the iNK treatment group began to die due to tumor progression, and on Day 28, all mice in the iNK treatment group had died, indicating that the inhibition of tumor growth by NK cells alone was limited in time. Mice in this group died around Day 24, and all mice in this group had died on Day 28, while mice in other groups were still alive. Fig.13 The fluorescence signal statistics are shown in Figure 2. Fig.13 A shows the bioluminescent signal statistics of mice at different time points. It can be seen that compared with CAR19-iNK and LV-CAR19-iNK, the signal value of mice treated with CAR19-IL-24-iNK increased the slowest, and CAR19-IL-24-iNK had a significantly longer-term tumor control effect trend. The fluorescence signal statistics on Day 28 are shown in Figure 2. Fig.13 As shown in B.

[0128] In summary, iPSCs with the gene encoding CAR19 or CAR19-IL-24 integrated in the rDNA region can be used as seed cells for making iNK cells. Compared with cells produced by lentivirus, the cells with site-specific integration are safer and have a longer-lasting tumor suppression effect. Compared with iNK cells with only site-specific integration of the CAR19 gene, iNK cells with site-specific integration of the gene encoding CAR19-IL-24 in the rDNA region have better proliferation ability and inhibit the production of CD56-CD16-double negative cells. The introduction of IL-24 unexpectedly promoted the expression of NKG2D, CD57, CD158 and TRAIL in iNK cells, directly improving the tumor killing ability of iNK cells themselves. It has been verified that CAR19-IL-24-iNK cells have the best anti-tumor ability both in vitro and in vivo.

[0129] All disclosures and patents mentioned in this application are incorporated herein by reference. Without departing from the scope and spirit of the present invention, multiple modifications and variants of the described method and composition of the present invention are apparent to those skilled in the art. Although the present invention has been described by specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to these specific embodiments. In fact, those multiple variants of the described mode for implementing the present invention that are apparent to those skilled in the relevant art are intended to be included in the scope of the appended claims.

Claims

1. An engineered natural killer cell, wherein: The genome of the engineered natural killer cells has a polynucleotide encoding CAR19 and a polynucleotide encoding IL-24 integrated therein, and the engineered natural killer cells simultaneously express CAR19 and IL-24.

2. The engineered natural killer cell according to claim 1, wherein The polynucleotide is site-specifically integrated into the genome of the natural killer cell, and the site-specific integration site is located in the ribosomal RNA transcription region (rDNA region) of the genome, such as the transcription region of 5S rRNA, 5.8S rRNA, 18S rRNA or 28S rRNA, preferably, the site-specific integration site is located in the transcription region of 18S rRNA, and more preferably, the site-specific integration site is located at position 5468 of the 18S rRNA transcription region.

3. The engineered natural killer cell according to claim 1 or 2, wherein: The polynucleotide encoding CAR19 and the polynucleotide encoding IL-24 are located on the same polynucleotide chain.

4. The engineered natural killer cell according to claim 3, wherein A polynucleotide encoding a 2A peptide exists between the polynucleotide encoding CAR19 and the polynucleotide encoding IL-24. Preferably, the 2A peptide is selected from P2A, T2A, E2A and F2A. More preferably, the 2A peptide is T2A, and its amino acid sequence is shown in SEQ ID NO:

1.

5. The engineered natural killer cell according to any one of claims 1 to 4, wherein: The CAR19 is a chimeric antigen receptor targeting the CD19 antigen. Preferably, the amino acid sequence of the CAR19 is as shown in SEQ ID NO:

4.

6. The engineered natural killer cell according to any one of claims 1 to 5, wherein: The IL24 is modified or unmodified IL24. Preferably, the amino acid sequence of the IL-24 is as shown in SEQ ID NO:

2.

7. The engineered natural killer cell according to any one of claims 1 to 6, wherein: The natural killer cells are obtained by engineering natural killer cells isolated from peripheral blood, or are derived from progenitor cells derived from bone marrow, cord blood or peripheral blood through engineering differentiation, or are derived from pluripotent stem cells through engineering differentiation. Preferably, the natural killer cells are derived from pluripotent stem cells through engineering differentiation, and more preferably, the natural killer cells are derived from induced pluripotent stem cells through engineering differentiation.

8. A method for constructing an engineered natural killer cell according to any one of claims 1 to 7, comprising integrating a polynucleotide encoding CAR19 and a polynucleotide encoding IL-24 into the genome of the cell, wherein the integration is performed by a gene editing system without using viruses.

9. The method according to claim 8, wherein: The gene editing system is selected from the Cre-lox system, ZincFinger Nucleases (ZFNs), CRISPR-Cas9 or Transcription Activator-Like EffectorNucleases (TALENs), preferably CRISPR-Cas9 or TALENs.

10. The method according to claim 8 or 9, wherein: The cells are natural killer cells or pluripotent stem cells.

11. The method according to claim 10, wherein: The cells are pluripotent stem cells, preferably, the pluripotent stem cells are induced pluripotent stem cells.

12. A method for directing differentiation of pluripotent stem cells into natural killer cells, comprising the following steps: 1) differentiating the pluripotent stem cells into hematopoietic stem cells, and adding Chroman 1, Emricasan and Trans-ISRIB molecules during the differentiation process; and 2) Inducing the hematopoietic stem cells obtained in step 1) to differentiate into natural killer cells.

13. The method according to claim 12, wherein: The volume molar concentration ratio of Chroman 1, Emricasan and Trans-ISRIB molecules is 1:80~120:10~15.

14. A pharmaceutical composition comprising the engineered natural killer cells according to any one of claims 1 to 7 or the engineered natural killer cells constructed according to any one of claims 8 to 13, and a pharmaceutically acceptable carrier.

15. Use of the engineered natural killer cells according to any one of claims 1 to 7, the engineered natural killer cells constructed according to any one of claims 8 to 13, or the pharmaceutical composition according to claim 14 in the preparation of a medicament for treating tumors or autoimmune diseases.

16. The use according to claim 15, wherein The tumor is selected from advanced or refractory hepatocellular carcinoma, colorectal cancer, non-small cell lung cancer, triple-negative breast cancer, gastric cancer, gastroesophageal junction adenocarcinoma, bile duct cancer, urothelial carcinoma and esophageal square cell carcinoma, brain tumors, lung cancer, breast cancer, ovarian cancer, fallopian tube cancer, prostate cancer, cervical cancer, thyroid cancer, nasopharyngeal carcinoma, glioblastoma, colorectal adenocarcinoma, pituitary tumor, pituitary adenoma, pituitary macroadenoma, gestational trophoblastic tumor, choriocarcinoma, placental site trophoblastic tumor, epithelial trophoblastic tumor, renal cell carcinoma, melanoma, myeloma, lymphoma, lung adenocarcinoma and gliosarcoma.

Images