Expression vectors, gene editing methods and cells

Abstract

The present invention discloses a fusion protein, a lead editing system, a gene editing kit, a gene editing method and a cell, and relates to the field of gene editing technology. The amino acid sequence of the fusion protein is shown in SEQ ID NO: 1. The fusion protein provided by the present invention can increase histone crotonylation at a specific site, improve the openness of chromatin, and promote the binding of the fusion protein to the chromatin at a specific site. When used for gene editing, the fusion protein can have a higher action efficiency without affecting the cell state, thereby improving the gene editing efficiency.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to expression vectors, gene editing methods and cells. Background Art

[0002] At present, gene editing technology is widely used. Genetic modifications such as substitutions, insertions, and deletions are introduced into the genome through gene editing technology, which can improve agricultural traits, accelerate the improvement and breeding of plants and animals; build disease models, explore the occurrence and progression of diseases, and conduct drug screening; repair or modify endogenous pathogenic mutations to achieve the purpose of gene therapy. Among them, Prime editing (PE) is a precise gene editing technology that can programmatically install substitutions, insertions, and deletions in cells and animals without double-stranded DNA breaks. Compared with methods based on homology-directed repair, the mechanism of prime editing makes it less dependent on cell replication and endogenous DNA repair, and it can accurately install edits without creating double-stranded DNA breaks, thereby minimizing insertions and deletions and other adverse outcomes. However, in mammals, the gene editing efficiency of prime editing is still relatively low.

[0003] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0004] Based on the above-mentioned deficiencies of the prior art, the purpose of the present invention is to provide expression vectors, gene editing methods and cells, aiming to solve the problem that the gene editing efficiency of lead editing is still relatively low.

[0005] The technical solution of the present invention is as follows:

[0006] In a first aspect of the present invention, a PE2-P300M1 expression vector is provided, wherein the nucleotide sequence of the PE2-P300M1 expression vector is shown in SEQ ID NO:3.

[0007] A second aspect of the present invention provides a method for gene editing, wherein the method for gene editing is for the purpose of non-disease prevention and / or treatment, and the method for gene editing comprises the steps of:

[0008] Inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4;

[0009] The PE2-P300M1 expression vector and the pegRNA expression vector of the present invention are transfected into bovine fetal fibroblasts for gene editing.

[0010] Optionally, the step of transfecting the PE2-P300M1 expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes:

[0011] Mixing serum-free culture medium and transfection reagent to obtain a first mixture;

[0012] Mixing the serum-free culture medium, the PE2-P300M1 expression vector, and the pegRNA expression vector to obtain a second mixture;

[0013] Add the first mixture dropwise to the second mixture, mix well, and let stand for 15 to 20 minutes to obtain a third mixture;

[0014] The third mixture is added to a well plate containing bovine fetal fibroblasts, so that the PE2-P300M1 expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

[0015] Optionally, the gene editing is IGF2 The G in intron 3 of the gene mutated to A.

[0016] A third aspect of the present invention provides a cell, wherein the cell is obtained by gene editing using the method of the present invention as described above.

[0017] Beneficial effects: The PE2-P300M1 expression vector provided by the present invention can increase histone crotonylation at a specific site, improve the openness of chromatin, and promote its binding to the chromatin at a specific site. When used for gene editing, the PE2-P300M1 expression vector can have a higher action efficiency without affecting the cell state, thereby improving the gene editing efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are cell fluorescence images after transfection with different expression vectors and pegRNA expression vectors, where (a) is transfection with PE2-P300M1 expression vector and pegRNA expression vector, (b) is transfection with PE2-P300M2 expression vector and pegRNA expression vector, and (c) is transfection with PE2-P300M3 expression vector and pegRNA expression vector.

[0019] Figure 2 This is the result of detecting crotonylation modification of the site by Chip-qPCR.

[0020] Figure 3 (a) is after gene editing IGF2 Sequencing results of the mutation of G to A in intron 3 of the gene, (b) is without gene editing IGF2Figure 2 shows the sequencing results when no mutation occurs in intron 3 of the gene.

[0021] Figure 4 This is the editing efficiency result diagram. DETAILED DESCRIPTION

[0022] The present invention provides expression vectors, gene editing methods and cells. To make the purpose, technical solutions and effects of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0023] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0024] If there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the number of the indicated technical features.

[0025] IGF2 The gene encodes insulin-like growth factor 2 (IGF2), which is a polypeptide that promotes cell division, participates in growth and development, and affects skeletal muscle mass and fat deposition. IGF2 The gene is highly conserved, and the destruction of the repressor zinc finger protein 6 (Zinc finger bed domain containing, ZBED6) binding site on intron 3 (i.e., a single base mutation in intron 3 can destroy the repressor zinc finger protein 6 binding site) will cause an increase in the expression of IGF2 in skeletal muscle, thereby affecting muscle growth and fat deposition. IGF2 Gene editing at intron 3 of the gene to achieve mutation will be of great significance. Based on this, in some embodiments, the lead editing system is introduced into bovine fetal fibroblasts for gene editing. IGF2 The G on intron 3 of the gene is mutated to A. Specifically, the steps of introducing the lead editing system into bovine fetal fibroblasts for gene editing specifically include:

[0026] S1. Provide a PE2-P300M1 expression vector, the nucleotide sequence of which is shown in SEQ ID NO: 3;

[0027] S2. inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4;

[0028] S3. Transfect the PE2-P300M1 expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing.

[0029] In this embodiment, the PE2-P300M1 expression vector and the pegRNA expression vector are transfected into bovine fetal fibroblasts for gene editing, which has a high gene editing efficiency. IGF2 The G in intron 3 of the gene mutated to A.

[0030] In step S1, the nucleotide sequence encoding the P300M protein is shown in SEQ ID NO:5.

[0031] In step S2, the nucleotide sequence of pegRNA is shown in SEQ ID NO: 2.

[0032] In step S3, in some embodiments, the step of transfecting the PE2-P300M1 expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes:

[0033] S31, mixing the serum-free culture medium and the transfection reagent to obtain a first mixture;

[0034] S32, mixing the serum-free medium, the PE2-P300M1 expression vector and the pegRNA expression vector to obtain a second mixture;

[0035] S33, adding the first mixture dropwise to the second mixture, mixing well, and standing for 15 to 20 minutes to obtain a third mixture;

[0036] S34. Add the third mixture to a well plate containing bovine fetal fibroblasts, so that the PE2-P300M1 expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

[0037] An embodiment of the present invention further provides a cell, wherein the cell is obtained by gene editing using the method of the present invention as described above.

[0038] The present invention will be further described below by means of specific examples.

[0039] Unless otherwise specified in the following examples, the materials used are all commercially available products.

[0040] In the following examples, the pCMV-PE2-P2A-GFP plasmid used was obtained from Addgene with a catalog number of #132776.

[0041] The pU6-pegRNA-GG-acceptor plasmid used was obtained from Addgene with catalog number #132777.

[0042] The opti-MEM medium (a serum-free medium) used was purchased from Gibco with a catalog number of 11058021.

[0043] The DNA purification kit used was purchased from Beyotime Biotechnology Co., Ltd. with the catalog number D0041S.

[0044] The magnetic chromatin immunoprecipitation analysis kit (Pierce Magnetic ChIP Kit) used was purchased from Thermo Fisher Scientific with the catalog number of 26157X.

[0045] Example

[0046] (1) Construct PE2-P300M1 expression vector, PE2-P300M2 expression vector, and PE2-P300M3 expression vector respectively, as follows:

[0047] Using the NotI restriction site, the nucleotide sequence encoding the P300M protein (as shown in SEQ ID NO: 5) was inserted before the cas9-RT sequence in the pCMV-PE2-P2A-GFP plasmid to obtain the PE2-P300M1 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 3).

[0048] Using the KpnI restriction site, the nucleotide sequence encoding P300M (as shown in SEQ ID NO: 5) was inserted into the middle of the cas9-RT sequence in the pCMV-PE2-P2A-GFP plasmid to obtain the PE2-P300M2 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 6).

[0049] The nucleotide sequence encoding P300M (as shown in SEQ ID NO: 5) was inserted into the pCMV-PE2-P2A-GFP plasmid after the cas9-RT sequence using the PmeI restriction site to obtain the PE2-P300M3 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 7).

[0050] (2) Construction of pegRNA expression vector

[0051] The nucleotide sequence of pegRNA (as shown in SEQ ID NO: 2) was inserted into the pU6-pegRNA-GG-acceptor plasmid (backbone double-digested with BsaAI and BsaBI) to obtain a pegRNA expression vector (the nucleotide sequence of which is shown in SEQ ID NO: 4).

[0052] (3) Gene editing

[0053] Transfection of PE2-P300M1 expression vector and pegRNA expression vector into bovine fetal fibroblasts to cause gene editing at the genomic DNA target site specifically includes the following steps:

[0054] a. Take out the cryopreserved tube containing bovine fetal fibroblasts from liquid nitrogen, immediately put it in a 37°C water bath, shake it slightly, and centrifuge it at 1500rpm for 5min after the liquid is completely melted; discard the supernatant, add 1mL of cell culture medium to resuspend the cells, and then transfer them to a 10cm culture dish containing 7mL of cell culture medium and shake it gently from front to back and left to right to evenly distribute the cells in the culture dish; place it in a 37°C, 5% CO2 incubator for culture, and after the cells adhere to the wall and grow full, subsequent operations can be performed. In this step a and the following step b, the cell culture medium used is composed of DMEM culture medium and fetal bovine serum (FBS), and the mass of FBS accounts for 10% of the mass of DMEM culture medium. DMEM culture medium is purchased from Gibco, with the item number C119995500BT, and FBS is purchased from Gibco, with the item number 10099-141C.

[0055] b. 1.1×10 6 Bovine fetal fibroblasts were inoculated in a 6-well plate containing cell culture medium at a seeding density of 10 cells and grown. After the cells grew for 24 hours, the PE2-P300M1 expression vector and the pegRNA expression vector were transfected with a transfection reagent.

[0056] The transfection method is:

[0057] Add 200 μL of opti-MEM medium and 10 μL of transfection reagent (ExFect Transfecion Reagent, purchased from Nanjing Novogene Biotech Co., Ltd., catalog number #T101) to a 1.5 mL sterile centrifuge tube (referred to as the first sterile centrifuge tube), and mix gently with a pipette;

[0058] In another 1.5 mL sterile centrifuge tube (recorded as the second sterile centrifuge tube), add 200 μL of opti-MEM medium, 3.75 μg of PE-P300M1 expression vector and 1.25 μg of pegRNA expression vector, and mix gently with a pipette;

[0059] The mixture in the first sterile centrifuge tube was added dropwise to the second sterile centrifuge tube, mixed by pipetting, and allowed to stand at room temperature for 20 min, and then slowly added to the above 6-well plate inoculated with bovine fetal fibroblasts for transfection.

[0060] Repeat step b, except that the PE2-P300M1 expression vector is replaced by the PE2-P300M2 expression vector; repeat step b again, except that the PE2-P300M1 expression vector is replaced by the PE2-P300M3 expression vector.

[0061] c. Collect cells 48 hours after transfection and extract DNA genome. At the same time, the fluorescence images of cells after transfection with different expression vectors and pegRNA expression vectors are shown in Figure 2. Figure 1 As shown, it can be seen that the transfection efficiency is highest when PE2-P300M1 expression vector and pegRNA expression vector are transfected.

[0062] (4) Detection of crotonylation expression

[0063] Design primers for chromatin immunoprecipitation coupled with quantitative polymerase chain reaction (Chip-qPCR) IGF2 Detecting the expression of crotonylation near the editing site of intron 3 of the gene includes the following steps:

[0064] Take 4×10 transfected cells (i.e. gene-edited cells) 6 The cells were cross-linked with formaldehyde at a final concentration of 1% (mass concentration) for 10 min.

[0065] A magnetic chromatin immunoprecipitation assay kit was used for immunoprecipitation. The primary antibody was lysine acetylated rabbit polyclonal antibody (i.e., Anti-Crotonyllysine Rabbit pAb, purchased from Hangzhou Jingjie Biotechnology Co., Ltd.) and the secondary antibody was immunoglobulin G (i.e., Rabbit Ig G, purchased from Cell Signaling Technology (CST) in the United States). The selection of the primary and secondary antibodies was carried out according to the instructions of the magnetic chromatin immunoprecipitation assay kit.

[0066] The immunoprecipitated DNA fragments were purified using a DNA purification kit to obtain purified DNA fragments, which were used as templates for quantitative PCR (qPCR).

[0067] Among them, the qPCR system: 1 μL of cDNA (i.e., the purified DNA fragments mentioned above), 1 μL of upstream primer IGF2-qPCR-F (1 μM), 1 μL of downstream primer IGF2-qPCR-R (1 μM), 10 μL of SYBR qPCR master mix (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number Q711-07) and 7 μL of RNase-free water (RNase-free H2O), a total of 20 μL.

[0068] The sequences of the primers are as follows:

[0069] IGF2-qPCR-F: AAATTGGGTTCGCCTTCGTC (as shown in SEQ ID NO: 8);

[0070] IGF2-qPCR-R: GCTCTGGGCTCCCTGCTC (as shown in SEQ ID NO: 9).

[0071] The specific procedures are as follows:

[0072] Pre-denaturation at 95°C for 30 seconds;

[0073] Denaturation at 95°C for 5 seconds;

[0074] Annealing at 60℃ for 34s,

[0075] 72°C extension for 30 s;

[0076] 40 cycles in total.

[0077] By Chip-qPCR IGF2 The results of detecting crotonylation modification near the editing site of gene intron 3 are shown in the figure Figure 2 As shown, ** indicates P < 0.01, ns indicates no statistical significance, and WT indicates wild-type bovine fetal fibroblasts (not transfected with PE2-P300M1, PE2-P300M2, PE2-P300M3 expression vectors and pegRNA expression vectors). It can be seen that the PE2-P300M1 expression vector has the best crotonylation modification effect.

[0078] (5) Sequencing

[0079] First, the genomic DNA of bovine fetal fibroblasts transfected with the PE2-P300M1 expression vector and the pegRNA expression vector was extracted, specifically including the following steps:

[0080] The original liquid of the transfected cells was discarded, and the cells were washed twice with 1.5 mL of phosphate buffer, and then 1.5 mL of trypsin (i.e., 0.05% trypsin-EDTA, purchased from Gibco, catalog number 25300-062) was added, and the cells were collected in a 15 mL centrifuge tube, and centrifuged at 1500 rpm for 5 min, and the liquid above was discarded, and 1 mL of phosphate buffer was added to resuspend, and the cells were centrifuged again for 5 min, and the liquid above was discarded, and 1 mL of phosphate buffer was added to obtain the digested cells;

[0081] The digested cells were added to a 1.5 mL centrifuge tube, and then 20 μL of proteinase K solution was added to the centrifuge tube and mixed, and a DNA extraction system was added. The DNA extraction system was derived from a DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number DP348).

[0082] Then, the extracted DNA was used as a template for PCR amplification, and the PCR reaction system was prepared for first-generation sequencing and second-generation sequencing. At the same time, the results of direct transfection using pCMV-PE2-P2A-GFP plasmid (referred to as PE expression vector) and pegRNA expression vector were used as controls.

[0083] Among them, the primers for first-generation sequencing (Sanger sequencing) are:

[0084] IGF2-F: GGCCCGAGAAGGCC (as shown in SEQ ID NO: 10);

[0085] IGF2-R: CTCTGGGCTCCCTGC (as shown in SEQ ID NO: 11).

[0086] The PCR reaction system used for first-generation sequencing (20 μL in total) included: 1 μL DNA template, 1 μL upstream primer IGF2-F (1 μM), 1 μL downstream primer IGF2-R (1 μM), 10 μL Green Taq Mix (purchased from Nanjing Novogene Biotech Co., Ltd., catalog number P131-02), and 7 μL RNase-free water (RNase-free H2O);

[0087] The PCR reaction procedure is as follows:

[0088] Pre-denaturation at 95°C for 3 min;

[0089] Denaturation at 95°C for 10 seconds;

[0090] Anneal at 59°C for 30 seconds.

[0091] 72°C extension for 25 s;

[0092] Extension at 72°C for 10 min;

[0093] 30 cycles in total.

[0094] Primers for next generation sequencing:

[0095] IGF2-F-1: ggagtgagtacggtgtgcGGCCCGAGAAGGCC (as shown in SEQ ID NO: 12);

[0096] IGF2-R-1: gagttggatgctggatggCTCTGGGCTCCCTGC (as shown in SEQ ID NO: 13).

[0097] The PCR reaction system used for next-generation sequencing (20 μL in total) included: 1 μL DNA template, 1 μL upstream primer IGF2-F-1 (1 μM), 1 μL downstream primer IGF2-R-1 (1 μM), 10 μL Green Taq Mix (purchased from Nanjing Novogene Biotech Co., Ltd., catalog number P131-02), and 7 μL RNase-free water (RNase-free H2O);

[0098] The PCR reaction procedure is as follows:

[0099] Pre-denaturation at 95°C for 3 min;

[0100] Denaturation at 95°C for 10 seconds;

[0101] Anneal at 59°C for 30 seconds.

[0102] 72°C extension for 25 s;

[0103] Extension at 72°C for 10 min;

[0104] 30 cycles in total.

[0105] The PCR product library was purified using the Agencourt AMPure XP Nucleic Acid Purification Kit (purchased from Beckman Coulter, Inc.), and the purified PCR product library was mixed for next-generation sequencing.

[0106] The results are as follows Figure 3 and Figure 4 As shown by Figure 3 It can be seen that IGF2 Intron 3 of the gene is the editing site, specifically the G in it is mutated to A; Figure 4 It can be seen that compared with the existing pilot editing system (i.e., the pilot editing system based on pCMV-PE2-P2A-GFP plasmid, whose gene editing efficiency is 0.5%), the gene editing efficiency of the gene editing system provided by the present invention (0.82%) is greatly improved.

[0107] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A PE2-P300M1 expression vector, characterized in that: The nucleotide sequence of the PE2-P300M1 expression vector is shown in SEQ ID NO:

3.

2. A gene editing method, characterized in that: The gene editing method is for the purpose of non-disease prevention and / or treatment, and the gene editing method comprises the steps of: Inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4; The PE2-P300M1 expression vector and the pegRNA expression vector described in claim 1 are transfected into bovine fetal fibroblasts for gene editing.

3. The method according to claim 2, characterized in that The step of transfecting the PE2-P300M1 expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes: Mixing serum-free culture medium and transfection reagent to obtain a first mixture; Mixing the serum-free culture medium, the PE2-P300M1 expression vector, and the pegRNA expression vector to obtain a second mixture; Add the first mixture dropwise to the second mixture, mix well, and let stand for 15 to 20 minutes to obtain a third mixture; The third mixture is added to a well plate containing bovine fetal fibroblasts, so that the PE2-P300M1 expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

4. The method according to any one of claims 2 to 3, characterized in that: The gene editing is IGF2 The G in intron 3 of the gene mutated to A.

5. A cell, characterized in that The cell is obtained by gene editing using the method according to any one of claims 2 to 4.

Images