Application of rice BR signal transduction haplotype (BSHs) in indica-japonica subspecies differentiation, yield increase and quality improvement

Abstract

The invention relates to application of a paddy BR signal transduction haplotype (BSHs) in indica-japonica subspecies differentiation, yield increase and quality improvement. Specifically, the invention relates to the application of two main BR signal transduction haplotypes formed by co-separation or co-selection of main variations existing in four identified genetically non-linked key components (OsBRI1, OsBAK1, OsGSK3 and OsBZR1) of a rice brassinosteroid signal transduction pathway, and the application of the two main BR signal transduction haplotypes to differentiation, yield increase and quality improvement of indica-japonica subspecies of rice. The genetic contribution of the BSHs to the rice yield and quality is far higher than the contribution of the four components independently, the two main BSHs (BSH2-J and BSH6-I) can be used for genetic improvement of the rice yield and quality traits, and compared with the BSH2-J, the BSH6-I has weaker BR signal strength and BR sensitivity, so that the yield and quality traits of the BSH6-I are superior to those of the BSH2-J.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection breeding, and specifically relates to the application of rice BR signal transduction haplotypes (BSHs) in indica and japonica subspecies differentiation, yield increase and quality improvement. Background Art

[0002] Rice is the staple food for more than half of the world's population. Improving rice yield and improving rice quality have always been important goals in rice breeding. Rice yield traits are a comprehensive indicator, which is mainly determined by grain shape, number of grains per panicle and plant type. Grain shape and size are jointly determined by grain length, grain width and grain thickness; plant type is jointly determined by plant height, number of tillers, leaf angle and panicle type. Therefore, grain shape and leaf angle are two important factors affecting yield. Rice quality traits mainly include appearance quality, cooking and eating quality, milling quality, nutritional quality and hygienic quality. Rice chalkiness is a negative target in rice breeding, which seriously affects the appearance quality, eating quality and nutritional quality of rice, directly determines rice quality and commodity price, and is also the main goal of rice quality genetic improvement. Grain shape and chalkiness traits are both complex traits controlled by QTL. A series of naturally variable grain shape and chalkiness genes have been cloned, such as GS3, GW5, qGL3, GW6, TGW3, Chalk5, WCR1, OsMKK3, bZIP60, GSE5, etc.

[0003] Brassinosteroids (BRs) play an important role in plant growth and development as well as in response to environmental factors, and may serve as a new breeding direction in the future. In rice, exogenous application of low concentrations of eBL can promote the division and elongation of thin-walled cells at the adaxial end of leaf joints, resulting in an imbalance in the development of the adaxial and abaxial ends, which in turn causes leaf bending, and the degree of bending increases with the increase of BRs concentration. In addition, changes in key genes in the synthesis and transduction pathway of rice BR will affect agronomic traits including plant height, grain shape, leaf angle, tillering, flowering, as well as environmental adaptability and resistance to pathogens. In rice BR-insensitive or defective mutants, organs will become smaller, but their semi-dwarf and upright leaf characteristics can increase biomass and grain yield by promoting light distribution and high-density planting, and the panicle branching and yield of rice can be enhanced by inhibiting tissue-specific BR. OsBRI1, OsBAK1, OsGSK3 and OsBZR1 are four key members of the rice BR signaling pathway, functioning as BR receptors, co-receptors, negative regulators and transcriptional co-activators, respectively.

[0004] During the domestication of rice, Asian cultivated rice differentiated into two major subspecies, indica and japonica, which differentiated in morphological characteristics, yield traits and quality traits. These traits can all be used as GWAS indicators for the differentiation of indica and japonica subspecies. The present invention uses 533 core rice germplasm resources from around the world, using grain shape (seed aspect ratio) as an indicator for GWAS analysis, and simultaneously identifies four key members of the BR signal, whose natural variations co-segregate or are co-selected to form two major BSHs that affect the differentiation of indica and japonica subspecies of rice, grain length, leaf angle, seed number, yield per plant, chalkiness and protein content and other traits. The present invention proposes the concept of BR signaling haplotypes (BSHs) for the first time, analyzes the molecular mechanism of BSHs in the differentiation of indica and japonica subspecies, and the application of BSHs in increasing yield and improving quality traits. Summary of the invention

[0005] The present invention aims to disclose the application of rice BR signaling haplotypes (BSHs) in the differentiation of indica and japonica subspecies and the improvement of yield and quality.

[0006] To achieve the above object, the present invention relates to the following contents:

[0007] 1. The present invention provides the gene accession numbers of four key members of BR signal identified by aspect ratio GWAS of 533 core germplasms and the rice genome version number, wherein the gene accession number of OsBRI1 is LOC_Os01g52050, and the genome version number is Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0) physical position 29931487–29927543 on chromosome 1; the gene accession number of OsBAK1 is LOC_Os08g07760, and the genome version number is Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0 )The physical location on chromosome 8 is 4344171–4350502; the gene accession number of OsGSK3 is LOC_Os02g14130, and the genome version number is Os-Nipponbare-Reference-IRGSP-1.0(IRGSP-1.0)The physical location on chromosome 1 is 7723687–7718903; the gene accession number of OsBZR1 is LOC_Os07g39220, and the genome version number is Os-Nipponbare-Reference-IRGSP-1.0(IRGSP-1.0)The physical location on chromosome 1 is 23485344–23483809.

[0008] 2. The present invention provides natural variations of four key members of BR signaling, and their representative natural variation sites are shown in Tables 1-3. Compared with japonica rice, the main natural variation sites of OsBRI1 in indica rice are physical positions 29930909 and 29930698 on chromosome 1 of the rice reference genome version Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), corresponding to the mutation of +424bp to G (amino acid mutation to Gly) and +635bp to A (amino acid mutation to Asp) of the OsBRI1 CDS sequence, respectively; the main natural variation sites of OsBAK1 in indica rice are physical positions 4344465 and 4344466 on chromosome 8 of the rice reference genome version Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), corresponding to the mutation of +424bp to G (amino acid mutation to Gly) and +635bp to A (amino acid mutation to Asp), respectively. The +11bp position of the CDS sequence mutated to C and the +12bp position mutated to G (amino acid mutated to Pro); the main natural variation sites of OsGSK3 in indica rice are the physical positions 7720567, 7719708 and 7719663 on chromosome 2 of the rice reference genome version Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), corresponding to OsGSK3 The +1024bp position of the CDS sequence mutated to T (amino acid mutated to Ser), the +1159bp position mutated to A (amino acid mutated to Ile), and the +1204bp position mutated to C (stop codon mutated to Arg); the main natural variation site of OsBZR1 in indica rice is the physical position 23484899 on chromosome 7 of the rice reference genome version number Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), corresponding to the deletion of a large fragment of 4808bp at -644bp in the promoter region.

[0009] 3. The present invention provides BR signaling haplotypes (BSHs) formed by the co-segregation of representative variants of four key BR signaling members as shown in Table 4, wherein the two main BSHs are named BSH2-J (99.1% in japonica rice subspecies) and BSH6-I (96.7% in indica rice subspecies).

[0010] 4. The contribution rate of BSHs provided by the present invention to yield and quality traits is higher than the contribution rate of each of the four key BR signal members to yield and quality traits.

[0011] 5. The present invention provides the important role of two main haplotypes of BSHs, BSH2-J and BSH6-I, in the differentiation of indica and japonica subspecies in yield and quality traits in core germplasm materials: varieties with the BSH6-I haplotype show a phenotype of smaller leaf angle, increased tiller number, number of grains per ear and yield, as well as smaller chalkiness, protein content and gel consistency, and higher polished rice rate and fatty acid content.

[0012] 6. The present invention provides the functional strengthening and weakening effects of BSH2-J and BSH6-I in BR signal transduction: compared with japonica rice BSH2-J, the interaction between OsBRI1 and OsBAK1 in indica rice BSH6-I is weakened, OsGSK3 autophosphorylation and kinase activity are enhanced, OsBZR1 RNA and protein levels are reduced, BR sensitivity is reduced, and BR downstream response genes are regularly expressed, resulting in the BR signal of BSH2-J being stronger than that of BSH6-I, revealing the molecular mechanism of BSH in the differentiation of indica and japonica subspecies.

[0013] 7. The present invention provides an application of BSHs in rice yield and quality, specifically: a homozygous family with knockout of OsBRI1 results in a lethal phenotype in the seedling stage of the plant; inhibition of the expression of OsBRI1 results in a phenotype of upright leaf angle, shortened grain length, increased chalkiness, reduced amylose content, and increased protein content; a homozygous family with knockout of OsBAK1 has a shorter plant height, a smaller leaf angle, shorter grain and panicle length, increased chalkiness, reduced amylose content, and increased protein content than a control plant; in a chromosome segment substitution line (CSSLs) of OsBAK1 with 9311 as the recipient parent and NIP as the donor parent, OsBAK1 9311 / BSH6-I Compared with OsBAK1 NIP / BSH2-J The leaf angle was smaller, the grain length was shorter, the number of grains per ear, the yield and the chalkiness were increased; the homozygous families with transgenic knockout of OsGSK3 had a phenotype of larger leaf angle and grain shape (mainly grain length), increased chalkiness, reduced amylose content and increased brown rice protein content than the control plants; transgenic complementation of OsGSK3 BSH2-J The indica rice MH63 showed a shorter plant height, a more upright plant shape, and a shorter grain length. Compared with the wild type, the OsBZR1 RNAi family had a smaller leaf angle, shorter grain length, more chalkiness, lower amylose content, and higher brown rice protein content. The OsBZR1 overexpression family had longer grain length, more chalkiness, lower amylose content, and higher brown rice protein content. The OsBRI1 / OsBAK1 / OsGSK3 F2 and F3 genetic segregation populations obtained by hybridizing japonica rice NIP with indica rice C418 showed that OsBRI1 / OsBAK1 / OsGSK3 BSH6-I OsBRI1 / OsBAK1 / OsGSK3 BSH2-J The length-to-width ratio and grain length are longer, the thousand-grain weight is greater, the ear length is longer, and the number of grains per ear and yield are increased.

[0014] Beneficial effects: The present invention first proposed the concept of rice BR signaling haplotypes (BSHs), disclosed the contribution of BSHs to the differentiation of indica and japonica subspecies, yield traits and quality traits, analyzed the molecular mechanism of BR signal differences in indica and japonica subspecies, and BSH6-I increased the number of panicles and yield, reduced the leaf angle, and improved the quality, providing a new gene resource for high-quality and high-yield rice breeding. Using the 7 SNPs and 1 indel contained in OsBRI1, OsBAK1, OsGSK3 and OsBZR1 as molecular markers, different haplotypes were screened and identified, indica and japonica rice were typed, and rice varieties with excellent yield and quality traits were screened. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0016] Figure 1 Four BR signal key genes identified by GWAS analysis of indica-japonica differentiation index (length-width ratio). ac are respectively the GWAS Manhattan plot, QQ plot, local Manhattan plot and LD analysis of seed length-width ratio of chromosomes 1 and 8 (a), chromosome 2 (b) and chromosome 7 (c) in the present invention, and the significance analysis of grain shape of 533 rice core seed materials by representative SN P of four BR signal key genes.

[0017] Figure 2 The natural variation analysis of the four BR signaling key genes. a is a structural diagram of a representative variation of OsBRI1 in the present invention, b is a structural diagram of a representative variation of OsBAK1 in the present invention, c is a structural diagram of a representative variation of OsGSK3 in the present invention, d is a protein detection of four forms of OsGSK3 in 12% SDS-PAGE gel, e is a structural diagram of a representative variation of OsBZR1 in the present invention, and f is a genotype detection of 4808bp and 266bp InDels in the promoter region of OsBZR1 in the present invention.

[0018] Figure 3is the contribution of the four BR signal key genes and BSHs to yield and quality traits. ab is the significance analysis of BSH2-J and BSH6-I in the 533 core germplasm resources of the present invention for yield traits (a) and quality traits (b), and cd is the genetic contribution of the four genes and BSHs of the present invention to the yield (c) and quality (d) traits of the 533 core germplasm resources.

[0019] Figure 4 Phenotypic analysis of OsBRI1 mutants and RNAi lines. a is the genotype identification result of CRISPR knockout of OsBRI1, b is the comparison of plant phenotypes between homozygous and heterozygous materials of osbri1-CR and wild type, c is the comparison of plant type, leaf angle, grain shape, grain length and grain width between OsBRI1-RNAi lines and wild type, d is the comparison of chalky phenotype between OsBRI1-RNAi lines and wild type, and e is the comparison of amylose content and protein level between OsBRI1-RNAi lines and wild type.

[0020] Figure 5 Phenotypic analysis of OsBAK1 mutants. a is the genotype identification result of CRISPR knockout of OsBAK1, b is the phenotypic comparison of plant type, plant height and leaf angle between homozygous materials of osbak1-CR and wild type, c is the comparison of grain length, grain width and grain shape between osbak1-CR and wild type, d is the comparison of panicle length phenotype between osbak1-CR and wild type, e is the comparison of amylose content and protein level between osbak1-CR and wild type, and f is the comparison of chalky phenotype between osbak1-CR and wild type.

[0021] Figure 6 Phenotypic analysis of OsBAK1 CSSL family. a is a phenotypic analysis of OsBAK1 CSSL family with 9311 as recipient parent and NIP as donor parent. 9311 / BSH6-I OsBAK1 NIP / BSH2-J Comparison of plant types at the seedling stage, b is OsBAK 1 9311 / BSH6-I OsBAK1 NIP / BSH2-J Comparison of leaf angle, ear length, number of grains per ear and yield per plant of OsBAK1 9311 / BS H6-I OsBAK1 NIP / BSH2-J The grain length of OsBAK1 is shown in Table 1. 9311 / BSH6-I OsBAK1 NIP / BSH2-J A chalky comparison.

[0022] Figure 7 Phenotypic analysis of OsGSK3 complementation families, mutant families and genetic groups. a is MH63 wild type and OsGSK3 BSH2-JComparison of plant type, plant height and grain length among complementary families; b is the comparison of plant type, leaf angle and grain length phenotype between homozygous materials of osgsk3-CR and wild type; c is the comparison of chalky phenotype between homozygous materials of osgsk3-CR and wild type; d and e are the OsBRI1 in F2 (d) and F3 (e) genetic segregation populations of OsBRI1 / OsBAK1 / OsGSK3 obtained by hybridization of japonica rice NIP and indica rice C418, respectively. J / OsBAK1 J / OsGSK3 J and OsBRI1 I / OsBAK1 I / OsGSK3 I Comparison of length-to-width ratio, grain length, 1000-grain weight, ear length, number of grains per ear and yield.

[0023] Figure 8 Phenotypic analysis of RNAi and overexpression lines of OsBZR1. a is a phenotypic comparison of plant type, plant height, leaf angle, grain shape, grain length and grain width between OsBZR1-RNAi lines and wild type, b is a comparison of chalkiness, amylose content and protein level between OsBZR1-RNAi lines and wild type, c is a comparison of expression level, grain length, grain width and length-to-width ratio between ZH11 wild type and OsBZR1-OE lines, d is a comparison of chalkiness, amylose content and protein level between ZH11 wild type and OsBZR1-OE lines.

[0024] Fig. 9 Comparison of BR signal intensity of BSH2-J and BSH6-I. a is the Split-Luc experiment to detect the effect of BSH2-J and BSH6-I on the interaction between OsBRI1 and OsBAK1, b is the subcellular localization and Western blot experiment to detect the effect of BSH2-J and BSH6-I on the subcellular localization and protein level of OsBAK1, c is the in vitro kinase experiment to detect the effect of BSH 2-J and BSH6-I on OsGSK3 autophosphorylation and kinase activity, d is Western Blot experiments were used to detect the effects of BSH2-J and BSH6-I on the protein levels and phosphorylation levels of OsGSK3 and OsBZR1 in vivo; e was the effect of BSH2-J and BSH6-I on the RNA level of OsBZR1; f was the effect of BSH2-J and BSH6-I on the promoter activity of OsBZR1; g was the effect of BSH2-J and BSH6-I on the expression level of downstream genes of OsBZR1; h was the effect of BSH2-J and BSH6-I on the BR sensitivity of 533 core germplasm resources; i was the effect of BSH2-J and BSH6-I on the mesocotyl length of 533 core germplasm resources. DETAILED DESCRIPTION

[0025] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0026] Example 1 Association between rice BR signaling haplotypes (BSHs) and grain shape traits

[0027] 1) Based on 533 core germplasms, the present invention conducted GWAS analysis based on the length-width ratio, and identified the BR receptor gene OsBRI1 (LOC_Os01g52050) and co-receptor gene OsBAK1 (LOC_Os08g07760) with young panicle dominance-specific expression near the peak points of chromosomes 1, 8, 2, and 7, the key kinase of the BR signaling pathway OsGSK3 (LOC_Os02g14130) and the transcriptional coactivator of the BR signaling pathway OsBZR1 (LOC_Os07g39220) ( Figure 1 ).

[0028] 2) In order to analyze the functional variation of the above four BR signal key genes, the present invention downloaded all SNPs and InDels from the upstream 2kb promoter region to the downstream 0.5kb 3'-UTR region of the CDS of these four genes from the RiceVarMap 2.0 database, selected non-rare representative phenotypic variation with MAF ≥ 10% for haplotype analysis, and then performed grain shape phenotypic significance analysis on the main haplotypes. The representative natural variation of the BR receptor and co-receptor OsBRI1-OsBAK1 module co-segregated and was divided into two main haplotypes (OsBRI1-OsBAK1 accounting for 99.1% of the japonica rice subspecies) and the OsBRI1-OsBAK1 module co-segregated and divided into two main haplotypes (OsBRI1-OsBAK1 accounting for 99.1% of the japonica rice subspecies). H1 and indica subspecies accounted for 97.9% of OsBRI1-OsBAK1 H4 ), the specific haplotype information of the OsBRI1-OsBAK1 module is shown in Table 1; the representative natural variation of OsGSK3 is divided into two major haplotypes (96.5% of OsGSK3 in japonica rice subspecies H1 and indica subspecies accounted for 93.7% of OsGSK3 H3 ), the specific haplotype information of OsGSK3 is shown in Table 2; the representative natural variation of OsBZR1 is divided into two main haplotypes (OsBZR1 of japonica rice subspecies accounts for 81.7%). H1 and indica subspecies accounted for 93.1% of OsBZR1 H2), the specific haplotype information of OsBZR1 is shown in Table 3.

[0029] Table 1 Haplotype analysis of the OsBRI1-OsBAK1 module

[0030]

[0031] Table 2 Haplotype analysis of OsGSK3

[0032]

[0033] Table 3 Haplotype analysis of OsBZR1

[0034]

[0035] 3) Further analysis revealed that the representative natural variations of these four genes located on different chromosomes had the characteristics of co-segregation. All of their representative variations were typed as a whole. The results showed that they were subdivided into 7 haplotypes, of which BSH2-J (99.1% in japonica rice, 105 of 106 varieties, i.e. 105 / 106, see Table 4) and BSH6-I (96.7% in indica rice, 235 of 243 varieties, i.e. 235 / 243, see Table 4) were the two main haplotypes. The specific BR signaling haplotypes (BSHs) and their species distribution information are shown in Table 4. The phenotypes of some materials in the 533 core rice germplasm materials tested and their corresponding variant sites are shown in Table 5.

[0036] Table 4 Analysis of BR signaling haplotypes (BSHs)

[0037]

[0038] Table 5 Phenotypes of some test materials and their corresponding variant sites

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047] NA indicates missing data.

[0048] Example 2: Determination of natural variation positions of OsBRI1, OsBAK1, OsGSK3 and OsBZR1

[0049] 1) Select NIP, a representative japonica rice variety with a known genome sequence, and ZS97 / MH63 / 9311, a representative indica rice variety with a known genome sequence, and download the NIP sequence of the corresponding gene from the MSU database (http: / / rice.plantbiology.msu.edu / ) according to the accession number of the gene in Example 1, download the ZS97 / MH63 sequence of the corresponding gene from the RIGW database (http: / / 211.69.140.160:8082 / cgi-bin / rice_rs3), and download the 9311 sequence of the corresponding gene from the GRAMENE database (http: / / ensembl.gramene.org / Oryza_indica / ), and perform sequence comparison.

[0050] 2) Determination of the stop codon mutation of OsGSK3: The stop codon mutation of OsGSK3 was found in the RiceVarMap 2.0 database. The flanking sequences of the mutation were then determined by comparing the sequences of the indica rice variety MH63 and the japonica rice variety NIP, and primers were designed. BSH2-J (F+R2 / 3) and OsGSK3 BSH6-I The coding sequence of (F+R1 / 3) and the corresponding primer sequences are shown in Table 6. Then, these fragments were cloned into the pMAL-cRI-HAE vector (fused with the MBP tag at the N-terminus) and expressed in BL21 (DE3) respectively. After protein purification, different forms of OsGSK3 were detected using 12% SDS-PAGE gel.

[0051] 3) Determination of the genotype of 4808 bp and 266 bp InDels in the promoter region of OsBZR1: When comparing the sequences of the indica rice variety MH63 and the japonica rice variety NIP, two large 4808 bp ((indel marker located at the physical position 23484899 on chromosome 7 where OsBZR1 is located, the nucleotide sequence of which is shown in SEQ ID NO.1 as the 4808 bp base deletion) and 266 bp InDels (indel marker located at the physical position 23490144 on chromosome 7 where OsBZR1 is located, the nucleotide sequence of which is shown in SEQ ID NO.1 as the 4808 bp base deletion) were found. Subsequently, using DNA from 533 core germplasm resources as templates, the OsBZR1(F1+R1) primers and OsBZR1(F2+R1) primers in Table 6 were used to detect the 4808 bp InDel, and the OsBZR1(F1+R2) primers were used to detect the 266 bp InDel. The PCR products were separated by 2% agarose gel, and the genotypes of the 4808 bp and 266 bp InDels in the OsBZR1 promoter region in the 533 core germplasm resources were finally determined.

[0052] The results of the comparison of the mutation positions of OsBRI1, OsBAK1, OsGSK3 and OsBZR1 are shown in Figure 2 shown.

[0053] Table 6 Primers used for gene function verification of the present invention

[0054]

[0055]

[0056] Example 3: Comparison of the contribution of BSHs and OsBRI1, OsBAK1, OsGSK3 and OsBZR1 to yield and quality traits:

[0057] 1) According to the two main haplotypes of BSHs in Table 4 of Example 2, the yield-related traits (leaf angle, tiller number, aspect ratio, grain length, 1000-grain weight, ear length, number of grains per ear and yield per plant) and quality-related traits (chalkiness area, chalkiness, amylose content, protein content, gel consistency, alkali elimination value and fatty acid content) of 533 core germplasm resources were analyzed for significance. The phenotypes of some materials and the corresponding gene variation site information are shown in Table 5. The results showed that BSH6-I had higher yield traits and better quality traits than BSH2-J. Specifically, the leaf angle of BSH6-I germplasm resources in Wuhan and Hainan became smaller, the number of tillers increased, the length-width ratio increased, the grain length became longer, the ear length became longer, the number of grains per ear and the yield per plant increased, which jointly promoted the higher yield traits of BSH6-I germplasm resources; in addition, the chalky area and chalky rate in BSH6-I germplasm resources were lower, the amylose content was higher, the protein content was lower, the whole polished rice rate was higher, the gel consistency and alkali consumption value were lower, and the fatty acid content was higher ( Figure 3 a, b), jointly promoting better quality traits of BSH6-I germplasm resources.

[0058] 2) Based on the haplotypes of BSHs and OsBRI1, OsBAK1, OsGSK3 and OsBZR1 in Tables 1-4 of Example 2, the contribution rates of these haplotypes to yield and quality-related traits were calculated using one-way ANOVA. The results showed that the contribution rates of BSHs or BSHI / J to these yield and quality-related traits were higher than the contribution rates of the four genes individually to the yield and quality-related traits ( Figure 3 c,d).

[0059] Example 4: Creation of transgenic materials, genetic populations and phenotypic investigations related to BSHs

[0060] The main purpose of these materials is to prove the genetic function of these genes themselves, knock out or overexpress individual genes to prove their respective effects on these yield traits and quality traits, while genetic population materials such as OsBAK1 BSH2-J Near-isogenic lines and OsBRI1 / OsBAK1 / OsGSK3 genetic groups directly verify the functional differences between BSH2-J and BSH6-I.

[0061] 1. Creation of OsBRI1, OsBAK1 and OsGSK3 knockout materials, OsGSK3 complementation materials and OsBZR1 overexpression materials:

[0062] 1) Specific target primers for OsBRI1, OsBAK1 and OsGSK3 were designed respectively, and U6 plasmid was used as template (CN107686845A), and BRI1 / BAK1 / GSK3-sgRNA forward primer and U6 reverse primer were used for amplification, and BRI1 / BAK1 / GSK3-sgRNA reverse primer and U6 forward primer were used for amplification, and these amplified products were recovered. Subsequently, two exogenous fragments of OsBRI1, OsBAK1 and OsGSK3 were connected to the Kpn1 linearized pCXUN-CAS9 vector (CN201610639854.3) by seamless cloning, and the ligation products were transformed into Escherichia coli competent DH5α, and single clones were selected for sequencing. Finally, the correctly sequenced OsBRI1 knockout vector osbri1-CR, OsBAK1 knockout vector osbak1-CR and OsGSK3 knockout vector osgsk3-CR were obtained.

[0063] 2) Using ZH11 DNA as a template, PC1301-OsGSK3-ZH11 forward and reverse primers were used for amplification. The exogenous fragment was recovered and ligated to the linearized PC1301 (Kpn1 digested). The ligation product was transformed into Escherichia coli competent DH5α, and single clones were selected for sequencing to obtain the correctly sequenced OsGSK3 complementary vector.

[0064] 3) Using ZH11 cDNA as a template, amplification was performed using the forward and reverse primers of 1301U-OsBZR1. The exogenous fragment obtained was recovered and ligated to the linearized PU1301 (Kpn1 digested) vector. The ligation product was transformed into Escherichia coli competent DH5α, and single clones were selected for sequencing to obtain the overexpression vector 1301U-OsBZR1 with correct sequencing of OsBZR1.

[0065] 4) The vectors in 1) and 3) above were electrotransformed into EHA105 competent Agrobacterium, and the two vectors were transformed into ZH11 callus by Agrobacterium-mediated genetic transformation technology of japonica rice, thereby obtaining transgenic plants with knockout of OsBRI1, OsBAK1 and OsGSK3 and overexpression of OsBZR1. The vectors in 2) were sent to Boyuan Biological Company for genetic transformation of indica rice MH63, thereby obtaining OsGSK3 complementation lineage.

[0066] 5) Positive detection of transgenic plants:

[0067] DNA was extracted from the leaves of the transgenic seedlings, and the DNA samples of osbri1-CR were amplified using the forward and reverse primers of BRI1-PAGE, and 6% PAGE gel was run for detection. The DNA of the wild type of ZH11 was used as a negative control, and the plants with band migration changes were successfully edited. The DNA samples of osbri1-CR, osbak1-CR and osgsk3-CR were amplified using the forward and reverse primers of BRI1-seq, BAK1-seq and GSK3-seq, respectively, and the amplified products were sent to a sequencing company for sequencing, and then the sequencing results were compared to determine the edited sequences of the positive transgenic plants.

[0068] Liquid nitrogen was used to take leaves of OsBZR1 overexpressing plants, RNA was extracted, and reverse transcribed into cDNA first chain. This was used as a template, and qPCR was performed using the forward and reverse primers of OsBZR1-qRT. qPCR was performed using the forward and reverse primers of Ubquitin-qRT as a negative control. The expression fold change of OsBZR1 was calculated, and finally the OsBZR1 overexpressing positive family was determined.

[0069] 1.OsBAK1 BSH2-J Construction of near-isogenic lines:

[0070] Indica rice 9311 was used as the recipient parent and japonica rice NIP was used as the donor parent. After hybridization, the indica rice 9311 was backcrossed with 9311 for more than three generations. In each generation, the OsBAK1 from NIP was identified and screened using the BAK1-4bp primer. The OsBAK1 from japonica rice NIP was introduced into the indica rice 9311 background. NIP / BSH2 Nearly isogenic lines.

[0071] 2. Construction of OsBRI1 / OsBAK1 / OsGSK3 genetic population:

[0072] Indica rice C418 was crossed with japonica rice NIP to obtain F1 hybrids. After F1 seeds were separated in the field, 415 F2 families were obtained. The DNA of the 415 F2 families was amplified using forward and reverse primers of BRI1-4bp, BAK1-4bp and GSK3-26bp, respectively, and the genotypes of OsBRI1 / OsBAK1 / OsGSK3 in the F2 population were determined by running 4% PAGE gel and agarose gel.

[0073] 3. Phenotypic investigation of yield and quality traits of BSHs-related transgenic materials and genetic populations:

[0074] The above-mentioned BSHs-related transgenic materials and genetic populations were planted in the field, and their plant height and leaf angle were measured at the heading stage. Plant height determination: After the seeds mature, the vertical distance from the top of the highest ear to the ground is the plant height of the plant. Leaf angle measurement: During the heading stage of the plant, a protractor was used to measure the angle between the main trunk of the plant and the topmost leaf. After the seeds mature, the harvested seeds were dried in an oven at 42°C for 4 days and then the yield and quality traits were investigated. Grain length and grain width determination: 10 single plants in the middle of each row were collected (the two plants in the side rows were not used for phenotypic investigation), and the main ear of each single plant was collected for grain shape investigation. Ten grains were randomly taken from the main ear to represent most of the full grains. The grain length was arranged in a neat row in a way that the grains were connected head to tail, without overlapping and leaving no gaps. The grain width was arranged in a neat row in a way that the grains were shoulder to shoulder, without overlapping and leaving no gaps. The grain length and grain width were read with a vernier caliper, and the average value was taken after 3 repetitions. Measurement of ear length: After the seeds mature, measure the distance from the top of the ear to the neck node of the main stem ear, and examine the 10 plants in the middle of each row. Determination of chalkiness rate and chalkiness area: After the dried seeds are shelled, the chalkiness rate is the proportion of chalky seeds to all seeds. The amylose content and brown rice protein were determined using a near-infrared rapid content analyzer. The results showed that the homozygous family with transgenic knockout of OsBRI1 showed a seedling lethal phenotype, while the OsBRI1 RNAi family had a smaller leaf angle, shorter grain length, and increased chalkiness ( Figure 4 ); The homozygous families with transgenic knockout of OsBAK1 showed shorter plant height, smaller leaf angle and grain shape, and increased chalkiness phenotype than the control plants ( Figure 5 ); In chromosome segment substitution lines (CSSLs) with indica rice 9311 as donor parent and japonica rice Nipponbare (NIP) as donor parent, OsBAK1 9311 / BSH6-I Compared with OsBAK1 NIP / BSH2-J The leaf angle is smaller, the grain length is shorter, and the number of grains per ear, yield and chalkiness increase ( Figure 6 ); The phenotypes of the homozygous families with transgenic knockout of OsGSK3 were larger leaf angle and grain shape (mainly grain length), more chalkiness, lower amylose content, and higher brown rice protein content than the control plants ( Figure 7 ); transgenic complementation of OsGSK3 BSH2-J Indica rice MH63, the plant height became shorter, the plant shape became more upright, and the grain length became shorter ( Figure 7 ); OsBRI1 / OsBAK1 / OsGSK3 F2 genetic segregation population obtained by hybridization of japonica rice NIP and indica rice C418, OsBRI1 / OsBAK1 / OsGSK3 BSH6-I OsBRI1 / OsBAK1 / OsGSK3 BSH2-J The aspect ratio and grain length are longer, the thousand-grain weight is larger, the ear length is longer, the number of grains per ear and the yield are increased ( Figure 7); Compared with the wild type, the OsBZR1 RNAi line had a smaller leaf angle, shorter grain length, more chalkiness, lower amylose content, and higher brown rice protein content ( Figure 8 ); OsBZR1 overexpression lines showed longer grain length, increased chalkiness, decreased amylose content, and increased brown rice protein content ( Figure 8 ).

[0075] Example 5: Comparison of BR signal strengths of two major BSHs (BSH2-J and BSH6-I)

[0076] 1. Effects of natural variation in the OsBRI1-OsBAK1 module on the interaction of proteins within the module:

[0077] In order to verify whether the natural variation of the OsBRI1-OsBAK1 module would change the interaction ability of the proteins in the module, we used luciferase complementation assay (Split-LUC) for verification: using ZH11 cDNA as template, amplification was performed using the forward primers and reverse primers of BRI1-NLUC and BRI1-CLUC in Table 6; using MH63 cDNA as template, amplification was performed using the forward primers and reverse primers of BRI1-NLUC and BRI1-CLUC in Table 6; using ZH11 cDNA as template, amplification was performed using the forward primers and reverse primers of BRI1-NLUC and BRI1-CLUC in Table 6. BSH2-J -CLUC forward primer and reverse primer were used for amplification; MH63 cDNA was used as template and BAK1 in Table 6 was used BSH6-I -CLUC forward primer and reverse primer were used for amplification, and then these amplified products were connected to the corresponding linearized pCAMBIA1300-35S-HA-Nluc-RBS vector (KpnI, SalI double restriction enzyme digestion) and linearized pCAMBIA1300-35S-Cluc-RBS vector (KpnI, SalI double restriction enzyme digestion) (CN103849645A) by seamless cloning to obtain OsBRI1 BSH2-J -NLUC, OsBRI1 BSH2-J -CLUC, OsBRI1 BSH6-I -NLUC, OsBRI1 BSH6-I -CLUC, OsBAK1 BSH2-J -CLUC and OsBAK1 BSH6-I -CLUC vectors. The experimental and control groups of these vectors were combined in equal proportions and infected into the same tobacco leaf by EHA105 Agrobacterium. Two days after infection, luciferase substrate (1 mg / mL) was sprayed and the fluorescence intensity was observed using a cooled CCD imaging device. The results showed that OsBAK1 BSH2-J OsBRI1 BSH2-J 、OsBRI1 BSH2-JThe interaction strength is higher than that of OsBAK1 BSH6-I OsBRI1 BSH2-J 、OsBRI1 BSH6-I The interaction is stronger, OsBRI1 BSH2-J 、OsBRI1 BSH6-I There is no significant difference in the ability to interact with other proteins ( Fig. 9 a).

[0078] 1. Comparison of subcellular localization and protein levels of the two major haplotypes of BAK1

[0079] To verify whether the natural variation of OsBAK1 would affect the subcellular localization and protein level of OsBAK1, we performed subcellular localization experiments and Western blot experiments.

[0080] Using ZH11 cDNA as template, BAK1 BSH2-J -GFP forward primer and reverse primer were used for amplification; MH63 cDNA was used as template and BAK1 in Table 6 was used BSH6-I -GFP forward primer and reverse primer were used to amplify, and these products were connected to the corresponding linearized pCAMBIA1300-GFP vector (double restriction enzyme digestion with SacI and SalI) by seamless cloning to obtain OsBAK1 BSH2-J -GFP and OsBAK1 BSH6-I -GFP vector. OsBAK1 was expressed in EHA105 Agrobacterium BSH2-J -GFP and OsBAK1 BSH6-I -GFP vector was infected into the same tobacco leaf, and the subcellular localization results were observed and total protein samples were extracted, and the protein was detected with anti-GFP. The results showed that OsBAK1 BSH2-J -GFP and OsBAK1 BSH6-I -GFP subcellular localization did not change significantly, but OsBAK1 BSH2-J -GFP showed a stronger GFP fluorescence signal; while Western blot results showed that OsBAK1 BSH2-J -GFP protein level is higher than OsBAK1 BSH6-I -GFP protein levels are higher ( Fig. 9 b).

[0081] 2. Effects of the two major haplotypes of OsGSK3 on kinase autophosphorylation and kinase activity:

[0082] The MBP tag constructed in Example 2-2) was used to fuse different forms of OsGSK3 (OsGSK3 BSH2-J and OsGSK3 BSH6-I), and an in vitro kinase assay was performed using MBP-OsBZR1 (Sun et al., 2018) as a substrate. The results showed that OsGSK3 BSH6-I OsGSK3 BSH2-J Has stronger autophosphorylation and kinase activity ( Fig. 9 c).

[0083] 3. Comparison of protein levels and phosphorylation levels of OsGSK3 and OsBZR1 in core germplasm resources:

[0084] Protein samples belonging to BSH2-J and BSH6-I materials were randomly selected from 533 core germplasm resources. After total protein extraction, anti-OsGSK3 and anti-OsBZR1 were used to detect the protein level or phosphorylation level of OsGSK3 and OsBZR1, respectively. The results showed that the phosphorylation levels of OsGSK3 and OsBZR1 in BSH2-J materials were generally lower than those in BSH6-I materials, and the protein level of OsBZR1 was generally higher than that in BSH6-I materials ( Fig. 9 d).

[0085] 4.OsBZR1 BSH2-J and OsBZR1 BSH6-I Functional comparison of promoter region variants:

[0086] In the 1 mm spikelets of 533 core germplasm, the expression levels of OsBZR1 in BSH2-J and BSH6-I materials were compared; ZH11 DNA was used as template and 0800-OsBZR1 in Table 6 was used as template. BSH2-J -LUC forward and reverse primers were used for amplification, MH63 DNA was used as template, and 0800-OsBZR1 in Table 6 was used. BSH6-I -LUC forward primer and reverse primer were used to amplify, and these products were connected to the corresponding linearized pGreenII 0800-LUC vector (SalI single restriction enzyme digestion) by seamless cloning to obtain 0800-OsBZR1 BSH2-J -LUC and 0800-OsBZR1 BSH6-I -LUC vector. 0800-OsBZR1 was transformed into BSH2-J -LUC and 0800-OsBZR1 BSH6-I -LUC vector was infected into the same tobacco leaf, and samples were taken to detect the enzyme activities of LUC and REN. The results showed that the expression level of OsBZR1 in BSH2-J material was stronger than that in BSH6-I material; OsBZR1 BSH2-J OsBZR1 BSH6-I The promoter activity is stronger ( Fig. 9 e,f).

[0087] 5. Comparison of expression levels of downstream genes of OsBZR1 in BSH2-J and BSH6-I materials:

[0088] In the 1 mm and 4 cm panicles of the 533 core germplasm, the expression levels of the downstream genes D11, BRD1, BRD2, OsDWARF4, CYP734A2, OsWRKY53, DLT, OsLIC, OsmiR396d, and OsGRF4 of OsBZR1 were compared between BSH2-J and BSH6-I materials. The results showed that the genes OsWRKY53 and OsmiR396d, which were positively regulated by OsBZR1, were expressed at higher levels in the core germplasm materials of BSH2-J, while the genes D11, BRD1, BRD2, OsDWARF4, CYP734A2, DLT, OsLIC, and OsGRF4, which were negatively regulated by OsBZR1, were expressed at higher levels in the core germplasm materials of BSH6-I ( Fig. 9 g).

[0089] 6. Comparison of BR sensitivity in BSH2-J and BSH6-I materials:

[0090] The leaf angle change and mesocotyl length were used as indicators of BR sensitivity. The results showed that the leaf angle of 533 core germplasm resources of BSH2-J changed more significantly, and the mesocotyl was longer ( Fig. 9 h,i).

[0091] In summary, the 7 SNPs and 1 indel markers contained in OsBRI1, OsBAK1, OsGSK3 and OsBZR1 can be used to divide rice into haplotypes BSH2-J or BSH6-I. Compared with BSH2-J, BSH6-I has weaker BR signal intensity and BR sensitivity, making the yield and quality traits of BSH6-I better than BSH2-J. The above molecular marker combination specifically includes: SNP1 with A / G polymorphism located at physical position 29930909 on chromosome 1 where OsBRI1 is located; SNP2 with G / A polymorphism located at physical position 29930698 on chromosome 1 where OsBRI1 is located; SNP3 with A / C polymorphism located at physical position 4344465 on chromosome 8 where OsBAK1 is located; SNP4 with T / G polymorphism located at physical position 4344466 on chromosome 8 where OsBAK1 is located. SNP4 with a G / T polymorphism located at physical position 7720567 on chromosome 2 where OsGSK3 is located; SNP5 with a G / T polymorphism located at physical position 7719708 on chromosome 2 where OsGSK3 is located, SNP6 with a T / A polymorphism; SNP7 with a T / C polymorphism located at physical position 7719663 on chromosome 2 where OsGSK3 is located; and an indel marker with a 4808bp base deletion as shown in the nucleotide sequence of SEQ ID NO.1 located at physical position 23484899 on chromosome 7 where OsBZR1 is located.

[0092] By screening the above molecular marker combinations, rice varieties with weaker BR signal intensity and BR sensitivity, as well as better yield traits and quality traits can be screened. For example, the following primer pairs can be used:

[0093] Primers used for amplification and identification of SNP1 and SNP2: CCTCCTCATCACTTCCCAC and GAGCTCACTGCCTCACGAC; primers used for amplification and identification of SNP3 and SNP4: CATCACTTCTTTATCGCAT and CTGTGAGCTTAACCCATCG; primers used for amplification and identification of SNP5, SNP6 and SNP7: GGTCCAAGCTCCTT GAAAT and TGCCTCAATTATCTAAAGC; primers used for amplification of indel markers: ACCGCCACGGACG GCGTGGC, GCTCGCCATGTCGCTGGGAG and TAGTCGTGCTAAACTGCGAG.

[0094] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A method for detecting rice BR signaling haplotype, characterized in that: Rice was divided into haplotype BSH2-J or BSH6-I according to the 7 SNPs and 1 indel markers contained in OsBRI1, OsBAK1, OsGSK3, and OsBZR1. Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0) was used as the rice reference genome. SNP1 is located at the physical position 29930909 of chromosome 1 where OsBRI1 is located, and there is an A / G polymorphism. SNP2 is located at the physical position 29930698 of chromosome 1 where OsBRI1 is located, and there is a G / A polymorphism. SNP3 is located at the physical position 4344465 on chromosome 8 where OsBAK1 is located, and there is an A / C polymorphism. SNP4 is located at the physical position 4344466 on chromosome 8 where OsBAK1 is located, and there is a T / G polymorphism. SNP5 is located at the physical position 7720567 on chromosome 2 where OsGSK3 is located, and there is a G / T polymorphism. SNP6 is located at the physical position 7719708 on chromosome 2 where OsGSK3 is located, and there is a T / A polymorphism. SNP7 is located at the physical position 7719663 on chromosome 2 where OsGSK3 is located, and there is a T / C polymorphism. The indel marker is located at the physical position 23484899 on chromosome 7 where OsBZR1 is located, and there is a 4808 bp base deletion in the nucleotide sequence as shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that When the combination of SNP1-7 and indel markers is AGATGTT+, it is recorded as BSH2-J, and when the combination of SNP1-7 and indel markers is GACGTAC-, it is recorded as BSH6-I. Among them, rice with the BSH6-I haplotype showed weaker BR signal intensity and BR sensitivity than BSH2-J, as well as better yield traits and quality traits.

3. The method according to claim 2, characterized in that Rice with the BSH6-I haplotype showed a phenotype of smaller leaf angle, increased tiller number, panicle number and yield, as well as less chalkiness, protein content and gel consistency, and higher head rice rate and fatty acid content.

4. A method for detecting rice yield traits and / or quality traits, characterized in that: Rice haplotype detection is performed using the method described in any one of claims 1 to 3, wherein rice with the BSH6-I haplotype exhibits better yield traits and quality traits than BSH2-J, the yield traits including leaf angle, tiller number, aspect ratio, grain length, 1,000-grain weight, panicle length, number of grains per panicle and / or yield per plant, and the quality traits including: chalky area, chalkiness, amylose content, protein content, gel consistency, alkali elimination value and / or fatty acid content.

5. The method according to claim 4, characterized in that Rice with the BSH6-I haplotype showed a phenotype of smaller leaf angle, increased tiller number, panicle number and yield, as well as less chalkiness, protein content and gel consistency, and higher head rice rate and fatty acid content.

6. Use of a reagent for detecting rice BR signal transduction haplotype in any of the following A1)-A8), characterized in that: Rice was divided into haplotype BSH2-J or BSH6-I according to the 7 SNPs and 1 indel markers contained in OsBRI1, OsBAK1, OsGSK3, and OsBZR1. Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0) was used as the rice reference genome. SNP1 is located at the physical position 29930909 of chromosome 1 where OsBRI1 is located, and there is an A / G polymorphism. SNP2 is located at the physical position 29930698 of chromosome 1 where OsBRI1 is located, and there is a G / A polymorphism. SNP3 is located at the physical position 4344465 on chromosome 8 where OsBAK1 is located, and there is an A / C polymorphism. SNP4 is located at the physical position 4344466 on chromosome 8 where OsBAK1 is located, and there is a T / G polymorphism. SNP5 is located at the physical position 7720567 on chromosome 2 where OsGSK3 is located, and there is a G / T polymorphism. SNP6 is located at the physical position 7719708 on chromosome 2 where OsGSK3 is located, and there is a T / A polymorphism. SNP7 is located at the physical position 7719663 on chromosome 2 where OsGSK3 is located, and there is a T / C polymorphism. The indel marker is located at the physical position 23484899 on chromosome 7 where OsBZR1 is located, and there is a 4808 bp base deletion in the nucleotide sequence as shown in SEQ ID NO.

1. When the combination of SNP1-7 and indel markers was AGATGTT+, it was recorded as BSH2-J, and when the combination of SNP1-7 and indel markers was GACGTAC-, it was recorded as BSH6-I; A1) identifying or assisting in the identification of rice yield traits and / or quality traits, A2) preparing a product for identifying or assisting in identifying rice yield traits and / or quality traits, A3) Identify or assist in identifying the strength of rice BR signaling pathway, A4) preparing a product for identifying or assisting in identifying the strength of the rice BR signaling pathway, A5) identifying or assisting in identifying indica rice and / or japonica rice, A6) preparing and identifying or assisting in identifying indica rice and / or japonica rice products, A7) Cultivate high-yield and / or high-quality rice varieties, A8) Preparing and cultivating high-yield and / or high-quality rice variety products.

7. The use according to claim 6, characterized in that: The yield traits include leaf angle, tiller number, length-width ratio, grain length, 1000-grain weight, ear length, number of grains per ear and / or yield per plant; the quality traits include chalky area, chalkiness, amylose content, protein content, gel consistency, alkali elimination value and / or fatty acid content.

8. The use according to any one of claims 6-7, characterized in that: The reagents include primers and PCR reaction solution, wherein: The primers used for amplification and identification of SNP1 and SNP2 were CCTCCTCATCACTTCCCAC and GAGCTCACTGCCTCACGAC The primers used for amplification and identification of SNP3 and SNP4 were CATCACTTCTTTATCGCAT and CTGTGAGCTTAACCCATCG The primers used for amplification and identification of SNP5, SNP6, and SNP7 were GGTCCAAGCTCCTTGAAAT and TGCCTCAATTATCTAAAGC The primers used to amplify the indel marker were ACCGCCACGGACGGCGTGGC, GCTCGCCATGTCGCTGGGAG, and TAGTCGTGCTAAACTGCGAG.

Images