Peptide-modified AAV capsid with enhanced muscle transduction efficiency

Abstract

The present invention relates to peptide modified AAV capsids with increased muscle transduction efficiency. The invention also relates to derived recombinant AAV vector particles packaging a gene of interest and their use in gene therapy, in particular for the treatment of muscle diseases.

Description

Technical Field

[0001] The present invention relates to peptide-modified AAV capsids with enhanced muscle transduction efficiency. The present invention also relates to derived recombinant AAV vector particles packaging target genes and their use in gene therapy, in particular for the treatment of muscle diseases. Background Art

[0002] Recombinant adeno-associated virus (rAAV) vectors are widely used for in vivo gene transfer, and clinical trials using AAV vectors are currently underway to treat many diseases.

[0003] AAV is a non-pathogenic virus belonging to the genus Dependoparvovirus of the Parvoviridae family. AAV is a non-enveloped virus consisting of a capsid of about 26 nm in diameter and a single-stranded DNA genome of 4.7 kb. The genome carries two genes, rep and cap, flanked by two palindromic regions named as inverted terminal repeats (ITRs), which serve as viral replication origins and packaging signals. The cap gene encodes three structural proteins VP1, VP2 and VP3, which form an icosahedral AAV capsid by alternative splicing and translation from different start codons. VP1, VP2 and VP3 share the same C-terminus, which is all of VP3. Using AAV2 as a reference, VP1 has a 735 amino acid sequence (GenBank accession number YP_680426.1, accessed on August 13, 2018); VP2 (598 amino acids) starts at threonine 138 (T138), and VP3 (533 amino acids) starts at methionine 203 (M203). The contribution of three different VPs to the AAV2 capsid is 1VP1:1VP2:10VP3. The capsids of all AAV serotypes are assembled from 60 VP monomers with approximately 50 copies of VP3, 5 copies of VP2, and 5 copies of VP1. The rep gene encodes four proteins required for viral replication Rep78, Rep68, Rep52, and Rep40. Recombinant AAV vectors encapsulate the rAAV genome flanked by ITRs, in which the therapeutic gene expression cassette replaces the AAV protein coding sequence.

[0004] Tissue specificity is determined by the capsid serotype, and commonly used AAV serotypes isolated from humans and non-human primates can transduce specific organs more efficiently than others (e.g., AAV6, AAV8, AAV9, and AAV-rh74 in muscle tissue).

[0005] AAV capsid variant libraries displaying short random peptides on the surface of various AAV serotypes have been generated to screen for gene therapy vectors with altered cell specificity and / or transduction efficiency (Review in Büning et al., Molecular Therapy: Methods & Clinical Development, 2019, 12, 248). It has been reported that AAV capsids containing peptides inserted with RGD motifs can improve gene delivery in muscle after systemic administration, and the RGD motif is known to bind to several different cell surface integrins. The most efficient AAV capsids for muscle transduction in mouse, non-human primate and / or human primary myotubes display peptides RGDLGLS or P1 (AAVMYO or AAV9P1), RGDLTTP (MyoAAV 1A), GPGRGDQTTL (MyoAAV 2A), SNSRGDYNSL (MyoAAV 4A), ENRGDFNNT (MyoAAV 4E), SAQRGDYVGL (MyoAAV3A), QERRGDYTSM (MyoAAV 4C) inserted into variable region VIII (WO 2019 / 207132; Weinmann et al., Nature communications, 2020, 11, 5432; Tabebordbar et al., Cell, 2021, 184, 4919-4938).

[0006] The ability to efficiently, selectively, and safely transduce muscle with systemically delivered AAV vectors will benefit gene therapy for many human diseases.

[0007] Brief description of the invention

[0008] The present inventors have shown that a recombinant adeno-associated virus (AAV) capsid comprising an inserted peptide RGDLXXL / I (SEQ ID NO: 1) (wherein XX is different from GS and ST) that binds to the integrin heterodimer α-αVβ6 (ITGAV-B6) has increased transduction efficiency in muscle, particularly after systemic delivery of the recombinant AAV vector.

[0009] Therefore, the present invention relates to a recombinant adeno-associated virus (AAV) capsid protein, comprising at least one copy of a peptide comprising the motif RGDLXXL / I (SEQ ID NO: 1) inserted, wherein XX is different from GS and ST, wherein the recombinant AAV capsid protein modified with the peptide has increased transduction efficiency in muscle compared to the recombinant AAV capsid protein not modified with the peptide.

[0010] In some embodiments, the insertion is in variable region IV.

[0011] In some embodiments, the recombinant AAV capsid protein is a hybrid of AAV serotype 9 and AAV serotype 74 capsid proteins.

[0012] In some preferred embodiments, the insertion is in position 452; preferably, wherein the peptide insertion replaces residues at positions 453-459, as determined by alignment with SEQ ID NO:20.

[0013] In some embodiments, the motif is RGDLX1X2L / I, wherein X1 is G, A, L, K or Q, and X2 is R, K, E, D, A, L, T, I or V. In some specific embodiments, the motif has a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6) and RGDLAEI (SEQ ID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably SEQ ID NO: 2. In some specific embodiments, the peptide comprises a sequence selected from the group consisting of TdGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18), and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or 16; more preferably SEQ ID NO: 14. In some more preferred embodiments, the recombinant AAV capsid protein comprises a sequence having at least 85% identity to any one of SEQ ID NOs: 21 to 26; preferably SEQ ID NOs: 21 or 23; more preferably SEQ ID NO: 21.

[0014] The present invention also relates to a polynucleotide encoding a recombinant AAV capsid protein according to the present disclosure.

[0015] The present invention also relates to a recombinant plasmid comprising the polynucleotide according to the present disclosure.

[0016] Another aspect of the present invention relates to an AAV vector particle packaging a target gene, comprising a recombinant AAV capsid protein according to the present disclosure. In some embodiments, the target gene is selected from the group consisting of a therapeutic gene; a gene encoding a therapeutic protein or peptide (such as a therapeutic antibody or antibody fragment) and a genome editing enzyme; and a gene encoding a therapeutic RNA (such as an interfering RNA, a guide RNA for genome editing, and an antisense RNA capable of exon skipping).

[0017] Another aspect of the present invention relates to a pharmaceutical composition comprising a therapeutically effective amount of an AAV vector particle according to the present disclosure or a cell stably transduced by an AAV vector particle according to the present disclosure.

[0018] Another aspect of the present invention relates to a pharmaceutical composition according to the present disclosure, which is used as a drug in gene therapy, preferably for the treatment of muscle diseases. In some preferred embodiments, the pharmaceutical composition targets a gene that causes a muscle disease, and the muscle disease is selected from dystrophin disease and limb-girdle muscular dystrophy; preferably, the gene is selected from the group consisting of DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB and SGCG. DETAILED DESCRIPTION OF THE INVENTION

[0020] Modified AAV capsid protein

[0021] The present invention relates to a recombinant adeno-associated virus (AAV) capsid protein, which comprises at least one copy of a peptide comprising the motif RGDLXXL / I (SEQ ID NO: 1) inserted therein, wherein XX is different from GS and ST, wherein the recombinant AAV capsid protein modified with the peptide has increased transduction efficiency in muscle compared to a recombinant AAV capsid protein not modified with the peptide.

[0022] Integrins are a class of adhesion receptors that contain 18 α subunits and 8 β subunits that form 24 different integrin heterodimers (Hynes, Cell, 2002, 110, 673-687). The motif RGDLXXL / I (SEQ ID NO: 1), where XX can be any amino acid pair except GS and ST, binds with high affinity to the integrin heterodimer αVβ6 (ITGAV-B6), which is highly enriched in skeletal muscle tissue and upregulated in dystrophic muscle, as shown in the examples of the present application. In this motif, LxxL / I forms an amphipathic α-helix that binds to a hydrophobic pocket in the B6 subunit. This motif can be found in the prodomain of TGF-β1\TGF-β3 and FMDV viral capsid, all of which specifically bind to ITGAV-B6 (DDong et al., Nature Struct. Mol. Biol., 2014, 21, 1091-1096; Dong et al., Nature, 2017, 542, 55-59; Kotecha et al., Nature communications, 2017, 8, 15408; Protein database accession numbers 5FFO, 4UM9 and 5NEM). Therefore, the peptide comprising the motif RGDLXXL / I of SEQ ID NO: 1 according to the present invention binds to muscle cells and directs or targets the capsid-modified rAAV vector carrying the peptide to muscle cells and tissues in vivo, particularly in subjects with muscle diseases.

[0023] The modified AAV capsid protein of the present invention is a functional AAV capsid that is capable of forming recombinant AAV vector particles that transduce muscle cells, tissues or organs in vitro or in vivo. In addition, compared with the corresponding unmodified AAV capsid protein derived therefrom, the modified AAV capsid protein according to the present invention has an increased transduction efficiency in muscle.

[0024] The excellent transduction efficiency of the modified AAV capsid protein according to the present invention to muscle can be measured by measuring the ability of AAV vector particles containing modified AAV capsid proteins to transduce muscle cells, tissues or organs in vitro or in vivo using standard assays well known in the art, such as those disclosed in the examples of the present application. AAV vector transduction can be measured in vitro or in vivo by measuring the vector genome copy number or transgene expression. The vector genome copy number per diploid genome can be measured by standard assays well known in the art, such as real-time PCR assays. Transgenic expression is advantageously measured by standard assays well known in the art using reporter genes such as luciferase or fluorescent proteins (GFP or others), such as quantitative bioluminescence in vivo or in vitro or fluorescence determination in vivo or in vitro. For example, muscle transduction levels can be measured by local or systemic administration of AAV vector particles carrying modified AAV capsid proteins in animal models such as mouse models, which are well known in the art and disclosed in the examples of the present application. AAV vectors containing corresponding unmodified AAV capsid proteins are used for comparison.

[0025] Increased transduction efficiency at the muscle level refers to increased transduction levels (higher levels or increased levels) in muscle, in particular, compared to unmodified AAV capsid proteins, the transgene expression level in at least one muscle cell, tissue or organ is increased by at least 1.5 times, preferably 3, 5, 10, 50, 100 times or more, or compared to unmodified AAV capsid proteins, the vector copy number in at least one muscle cell, tissue or organ is increased by at least 1.1 times, preferably 1.5, 2, 2.5, 3, 3.5 times or more. Due to the higher transduction level in muscle, the modified AAV capsid protein of the present invention has an improved biodistribution. This means that it is significantly better targeted to muscle tissue or organs without increasing the targeting of other (non-targeted) tissues, especially the liver (i.e., improved specificity).

[0026] As used herein, the term "muscle" refers to myocardial (i.e., heart) and skeletal muscle. The term "myoblast" refers to myocytes, myotubes, myoblasts and / or satellite cells. Skeletal muscle is divided into different groups according to its anatomical position in the body. The transduction efficiency or tropism of the modified AAV capsid according to the present invention in different skeletal muscle groups can be measured in mouse tibialis muscle (TA), extensor digitorum longus (EDL), quadriceps (Qua), gastrocnemius (Ga), soleus (Sol), triceps, biceps and / or diaphragm, particularly in mouse tibialis muscle (TA), diaphragm and / or quadriceps (Qua). The expression "muscle transduction" refers to the tropism of the heart and various skeletal muscles present in vivo.

[0027] In the description that follows, amino acid residues are indicated using the standard single-letter amino acid code.

[0028] "A", "an" and "the" include plural referents unless the context clearly indicates otherwise. Therefore, the terms "a" (or "an"), "one or more" or "at least one" are used interchangeably herein; unless otherwise specified, "or" means "and / or".

[0029] The modified AAV capsid protein of the present invention is a recombinant protein.

[0030] As used herein, a "sequence" refers to 1 amino acid or at least 2 consecutive amino acids.

[0031] In the present specification, insertion at a given position in the AAV capsid protein sequence means insertion after the amino acid residue at that position.

[0032] The term "identity" refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When the position in the two comparison sequences is occupied by the same base or the same amino acid residue, the corresponding molecules are identical at that position. The identity percentage between the two sequences corresponds to the number of matching positions shared by the two sequences divided by the number of positions compared and multiplied by 100. Usually, two sequences are compared when they are aligned to give maximum identity. Identity can be calculated by alignment, using, for example, GCG (Genetics Computer Group, Program Manual for the GCGPackage, Version 7, Madison, Wisconsin) stacking programs or any sequence comparison algorithms such as BLAST, FASTA or CLUSTALW.

[0033] In some embodiments, the modified AAV capsids of the invention increase transduction levels in muscle following systemic delivery of AAV vectors.

[0034] In some embodiments, the RGDLXXL / I motif according to the present invention consists of RGDLX1X2L / I, wherein X1 is G, A, L, K or Q and X2 is R, K, E, D, A, L, T, I or V. The motif is identified by modeling a sequence that can enhance the binding of the RGDLXXL / I motif to ITGAV-B6 or maintain the stability of the capsid protein. In some specific embodiments, the RGDLXXL / I motif according to the present invention consists of a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6) and RGDLAEI (SEQID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably SEQ ID NO: 2. In some specific embodiments, the peptide comprises a Z-RGDLXXL / I motif according to the present invention, wherein Z is G, P, Q, V or R; preferably G or R. In a specific embodiment, the peptide comprises a sequence selected from the group consisting of GRGDLGRL (SEQ ID NO:8), PRGDLGEL (SEQ ID NO:9), RRGDLATI (SEQ ID NO:10), QRGDLAEL (SEQ ID NO:11), VRGDLQVL (SEQ ID NO:12) and VRGDLAEI (SEQ ID NO:13); preferably SEQ ID NO:8 or 10; more preferably SEQ ID NO:8.

[0035] In some embodiments, the RGDLXXL / I or Z-RGDLXXL / I motif according to the invention is flanked at the N-terminus and / or C-terminus by a sequence of up to 5 amino acids (1, 2, 3, 4 or 5), which may be identical or different; preferably by a sequence of 2 amino acids, which may be identical or different. According to the invention, the sequences at the N-terminus and C-terminus of the motif are the flanking sequences directly adjacent to the N-terminus and C-terminus of the motif. The N-terminal and C-terminal flanking sequences are advantageously selected from the group consisting of TD, GP, EP and GS; preferably, selected from TD or EP in the N-terminus or selected from GP or GS in the C-terminus. In some specific embodiments, the peptide comprises or consists of a sequence selected from the group consisting of TdGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18) and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or 16; more preferably SEQ ID NO: 14. The peptide comprising the RGDLXXL / I motif according to the present invention generally consists of a sequence of up to 30 amino acids. The peptide may consist of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino acids. In some embodiments, the peptide consists of a sequence of at most 25, 20 or 15 amino acids. Preferably, the targeting peptide consists of a sequence of 12, 13, 14 or 15 amino acids; more preferably 12 amino acids.

[0036] In some embodiments, a modified AAV capsid protein according to the invention comprises up to 5 copies (1, 2, 3, 4, or 5) of a peptide according to the invention comprising a RGDLXXL / I motif.

[0037] One or more peptides comprising the RGDLXXL / I motif according to the present invention are inserted into exposed sites on the surface of the AAV capsid. Sites on the surface of the AAV capsid that are exposed on the capsid surface and tolerate peptide insertion (i.e., do not affect the assembly and packaging of the viral capsid) are well known in the art, and particularly include variable regions (VRs) that form loops at the top of the protrusions, such as VR-IV, -V, and -VIII (Review in Büning et al., Molecular Therapy: Methods & Clinical Development, 2019, 12, 248-). According to the numbering in the AAV8 capsid protein sequence, VR-IV corresponds to Y445 to A476 (broad definition) or Q451 to L462 (narrow definition); VR-V corresponds to C485 to G515 (broad definition) or R490 to T509 (narrow definition); VR-VIII corresponds to I581 to L604 (broad definition) or L586 to I595 (narrow definition). According to the numbering in the AAV2 capsid protein sequence, the peptide insertion site is advantageously located at a site of the common VP3 region exposed on the surface of the AAV capsid, such as positions 587, 588, 589, 453, 520 (combined with 584), 584 and 585. The peptide insertion site is indicated by reference to the AAV2 or AAV8 capsid amino acid sequence. The AAV2 capsid (VP1) protein sequence corresponds to the GenBank accession number YP_680426.1 accessed on August 13, 2018. The AAV8 capsid (VP1) protein sequence corresponds to the GenBank accession number YP_077180.1 accessed on August 13, 2018. After aligning any other AAV capsid sequence with the AAV2 or AAV8 capsid sequence using standard protein sequence alignment programs well known in the art, such as BLAST, FASTA, CLUSTALW, etc., a person skilled in the art can easily obtain the corresponding position of the peptide insertion site in other AAV capsid sequences. Insertion sites in VR-VIII include position 590 in AAV1; position 587 or 588 in AAV2; position 586 in AAV3 or AAV4; position 575 in AAV5; position 585 in AAV6; position 585 or 590 in AAV8; position 588 or 589 in AAV9; and position 589 in AAV9.rh74.

[0038] In some preferred embodiments, the modified AAV capsid of the present invention comprises at least one RGDLXXL / I peptide inserted into variable region IV (VR-IV) or variable region VIII (VR-VIII), preferably into VR-IV. Preferably, the insertion in VR-IV is at position 450 (T450) according to numbering in the AAV2 capsid sequence; the corresponding position in the AAV9.rh74 hybrid capsid protein sequence (SEQ ID NO: 8) is 452 (S452). The insertion in VR-VIII is preferably at position 587 (N587) according to numbering in the AAV2 capsid protein; this position is position 589 (N589) in the AAV9.rh74 capsid protein sequence.

[0039] The RGDLXXL / I peptide can be inserted between two consecutive amino acids of the AAV capsid protein sequence (no deletion) or can replace part or all of the residues at the insertion site (deletion). In some embodiments, the RGDLXXL / I peptide replaces the residues at the insertion site, particularly residues 451-457 of the AAV2 capsid protein sequence, corresponding to residues 453-459 of the AAV9.rh74 capsid protein sequence.

[0040] The modified AAV capsid protein can be derived from any natural or artificial AAV capsid serotype, including hybrid serotypes and variant serotypes. Non-limiting examples of AAV capsid serotypes from which the modified AAV capsid protein can be derived include AAV1, AAV2, AAV3 (including 3A and 3B types), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV218, AAVrh10, AAVrh39, AAVrh43, AAVrh74, AAV-LK03, AAV2G9, AAV.PHP, AAV-Anc80, AAV3B, and a hybrid of AAV9 and AAVrh74. In some embodiments, the modified AAV capsid protein is from an AAV serotype selected from the group consisting of AAV6, AAV8, AAV9, AAVrh74, and a hybrid of AAV9 and AAVrh74. In some preferred embodiments, the modified AAV capsid protein is from AAV8, AAV9, or a hybrid of AAV9 and AAVrh74; or from AAV9 or a hybrid of AAV9 and AAVrh74, still more preferably, a hybrid of AAV9 and AAVrh74. The AAV9 capsid corresponds in particular to the amino acid sequence GeneBank accession number AY530579.1 accessed on June 24, 2004. The hybrid of AAV9 and AAVrh74 is preferably AAV9.rh74 as disclosed in WO2019 / 193119; more preferably, an AAV9.rh74 capsid having the amino acid sequence SEQ ID NO: 20.

[0041] In some preferred embodiments, the modified AAV capsid protein is from the AAV9.rh74 serotype and comprises a peptide according to the present invention containing the RGDLXXL / I motif, which is inserted into position 452 of the AAV9.rh74 capsid protein sequence and replaces residues 453 to 459. In some preferred embodiments, the peptide comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 2 to 19, preferably SEQ ID NOs: 2, 4, 8, 10, 14 or 16; still more preferably SEQ ID NOs: 2, 8 or 14.

[0042] In some more specific embodiments, the modified AAV capsid protein comprises or consists of a sequence having at least 85%, 87%, 88%, 90%, 95%, 97%, 98% or 99% identity to any one of SEQ ID NOs: 21 to 26; preferably SEQ ID NOs: 21 or 23; more preferably, it comprises or consists of the sequence of SEQ ID NOs: 21 or 23; still more preferably, it comprises the sequence of SEQ ID NO: 21. The variant according to the present invention has no mutation in the peptide comprising the RGDLXXL / I motif or the Z-RGDLXXL / I motif according to the present invention, and preferably has no mutation in the 5 amino acid sequence before and after the insertion site; preferably has no mutation in the 10 amino acid sequence before and after the insertion site.

[0043] In some embodiments, the modified AAV capsid protein is a modified VP1, VP2 or VP3 protein. In some specific embodiments, the modified VP1, VP2 or VP3 protein is derived from any one of SEQ ID NOs: 21 to 26; preferably SEQ ID NOs: 21 or 23; more preferably SEQ ID NO: 21. VP2 corresponds to the amino acid sequence from T138 to the end of any one of SEQ ID NOs: 21 to 26. VP3 corresponds to the amino acid sequence from M204 to the end of any one of SEQ ID NOs: 21 to 26.

[0044] In some embodiments, the modified AAV capsid protein is a chimeric VP1 or VP2 protein comprising a peptide inserted into the common VP3 region of an AAV serotype and a VP1-specific and / or VP2-specific N-terminal region from another AAV serotype (e.g., an AAV serotype different from the VP3 region serotype). In some specific embodiments, the chimeric VP1 or VP2 protein is derived from SEQ ID NO: 9 or 10.

[0045] In various embodiments of the present invention, the amino acid sequence of the modified AAV capsid protein can be advantageously selected to have the lowest estimated energy (review in Alford et al., J. Chem. Theory Comput, 2017, 13, 6, 3031-3048) using methods available in the art, such as the Rosetta energy function for macromolecular modeling and design. For example, the Rosetta energy function is used to exhaustively sample low energy structure-sequence pairs. This method ensures that the designed modified AAV capsid remains stable, so the productivity of the AAV vector can be maintained or even improved.

[0046] Polynucleotides, vectors and uses for AAV vector production

[0047] Another aspect of the invention is a polynucleotide encoding a recombinant modified AAV capsid protein in an expressible form. The polynucleotide may be DNA, RNA or a synthetic or semisynthetic nucleic acid.

[0048] In some embodiments, the polynucleotide encodes a modified AAV9.rh74 capsid protein according to the present invention, in particular a modified AAV9.rh74 capsid protein comprising a peptide, wherein the peptide comprises or consists of a sequence selected from the following group: SEQ ID NO: 2 to 19, preferably SEQ ID NO: 2, 4, 8, 10, 14 or 16; and more preferably SEQ ID NO: 2, 8 or 14.

[0049] In some preferred embodiments, the polynucleotide encodes a modified AAV9.rh74 capsid protein, which comprises or consists of a sequence that is at least 85%, 87%, 88%, 90%, 95%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 21 to 26; preferably SEQ ID NO: 21 or 23; and more preferably SEQ ID NO: 21.

[0050] In some more preferred embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to any one of SEQ ID NOs: 27 to 32; preferably SEQ ID NOs: 27 or 29; more preferably SEQ ID NO: 27. The nucleotide sequence SEQ ID NO: 27 encodes the modified AAV9.rh74 capsid protein of SEQ ID NO: 21. The nucleotide sequence SEQ ID NO: 29 encodes the modified AAV9.rh74 capsid protein of SEQ ID NO: 23. The polynucleotide is a functional polynucleotide sequence, which means that the sequence of the polynucleotide encodes a modified AAV capsid protein according to the present invention.

[0051] In some embodiments, the polynucleotide further encodes an expressible form of an AAV replicase (Rep) protein, preferably Rep from AAV2.

[0052] The polynucleotide is advantageously inserted into a recombinant vector, which includes, in a non-limiting manner, a linear or circular DNA or RNA molecule consisting of a chromosomal, non-chromosomal, synthetic or semisynthetic nucleic acid, such as, in particular, a viral vector, a plasmid or an RNA vector. The target nucleic acid molecule can be inserted into a variety of vectors in order to introduce and maintain it in a eukaryotic host cell known per se; the choice of a suitable vector depends on the intended use of the vector (e.g., replication of the target sequence, expression of the sequence, maintenance of the sequence in an extrachromosomal form or other integration into the chromosomal material of the host), and also on the nature of the host cell.

[0053] In some embodiments, the vector is a plasmid.

[0054] The recombinant vector for use of the present invention is an expression vector containing an appropriate means for expressing a modified AAV capsid protein (AAV Cap), which can also be an AAV Rep protein. Typically, each coding sequence (modified AAV Cap and AAV Rep) is inserted into a separate expression cassette in the same vector or in a separate vector. Each expression cassette contains a coding sequence (open reading frame or ORF) functionally connected to a regulatory sequence, which allows the corresponding protein to be expressed in an AAV production cell, such as, in particular, a promoter, a promoter / enhancer, a start codon (ATG), a stop codon, and a transcription termination signal. Alternatively, the modified AAV Cap and AAV Rep proteins can be expressed from a unique expression cassette using an internal ribosome entry site (IRES) inserted between two coding sequences or viral 2A peptides. In addition, the codon sequences encoding the modified AAV Cap and AAV Rep (if present) are advantageously optimized for expression in AAV production cells, particularly human production cells.

[0055] Another aspect of the invention is the use of cells stably transformed with recombinant vectors for expressing modified AAV capsid proteins, preferably also AAV Rep proteins. Cells stably express modified AAV capsid and AAV Rep proteins (producer cell lines). Producer cells are advantageously human cells.

[0056] Using standard AAV production methods well known in the art, vectors, preferably recombinant plasmids, or cells can be used to produce hybrid AAV vectors comprising the hybrid AAV capsid protein of the present invention (Review in Aponte-Ubillus et al., Applied Microbiology and Biotechnology, 2018, 102: 1045-1054).

[0057] AAV vectors are usually produced by co-transfecting cells suitable for AAV production with a plasmid containing a recombinant AAV vector genome comprising a target gene inserted into an expression cassette and flanked by AAV ITR (AAV transfer plasmid) and a plasmid expressing AAV Rep and Cap proteins. Alternatively, the production cells according to the present invention (which stably express AAV Rep and Cap proteins) can be transfected with an AAV transfer plasmid.

[0058] Briefly, following transfection with the above plasmids in the presence of sufficient helper functions to allow packaging of the rAAV vector genome into AAV capsid particles, the cells are cultured for a sufficient time to allow production of AAV vector particles, and then harvested, lysed, and the AAV vector particles are purified by standard purification methods such as affinity chromatography and iodixanol or cesium chloride density gradient ultracentrifugation.

[0059] AAV particles, cells

[0060] Another aspect of the present invention is an AAV particle comprising the modified recombinant AAV capsid protein of the present invention.

[0061] AAV particles comprise modified VP1, VP2 and / or VP3 capsid proteins according to the present invention. In some embodiments, AAV particles comprise modified VP1, VP2 and VP3 capsid proteins of the same serotype. In some embodiments, AAV particles further or alternatively comprise chimeric VP1 and / or VP2 capsid proteins and modified VP3 proteins according to the present invention. In some embodiments, AAV particles are mosaic AAV particles, which further comprise another AAV capsid protein from a natural or artificial AAV serotype (different from the serotype of the modified AAV capsid including the chimeric modified AAV capsid), wherein the mosaic AAV particles have increased muscle transduction efficiency or level. Artificial AAV serotypes can be, but are not limited to, chimeric AAV capsids, recombinant AAV capsids or humanized AAV capsids. Such artificial capsids can be produced by any suitable technique using selected AAV sequences (e.g., fragments of the VP1 capsid protein) in combination with heterologous sequences, which can be obtained from different selected AAV serotypes, non-contiguous portions of the same AAV serotype, from non-viral AAV sources, or from non-viral sources.

[0062] Preferably, the AAV particles are recombinant AAV (rAAV) vector particles. AAV vector particles are suitable for gene therapy for muscle cells, tissues or organs in individuals. rAAV vector particles package target genes. The genome of the rAAV vector can be a single-stranded or self-complementary double-stranded genome (McCarty et al, Gene Therapy, 2003, Dec., 10 (26), 2112-2118). Self-complementary vectors are produced by deleting the terminal break site (trs) from one of the AAV terminal repeat sequences. These modified vectors, whose replicating genome is half the length of the wild-type AAV genome, have a tendency to package DNA dimers. The AAV genome is flanked by ITRs. In a specific embodiment, the AAV vector is a pseudotype vector, that is, its genome and capsid are from AAVs of different serotypes. In some preferred embodiments, the genome of the pseudotype vector is derived from AAV2. rAAV vector particles can be obtained using standard AAV production methods known in the art as described above.

[0063] "Target gene" refers to a gene that can be used for a specific application, such as but not limited to diagnosis, reporting, modification, therapy, and genome editing.

[0064] For example, the target gene can be a therapeutic gene, a reporter gene, or a genome editing enzyme.

[0065] "Target gene for therapy," "target therapeutic gene," or "target heterologous gene" refers to a therapeutic gene or a gene encoding a therapeutic protein, peptide, or RNA.

[0066] The target gene is any nucleic acid sequence that can modify the target gene or target cell pathway in the cells of the target organ (i.e., muscle). For example, the gene can modify the expression, sequence, or regulation of the target gene or cell pathway. In some embodiments, the target gene is a functional form of a gene or a fragment thereof. The functional form of the gene includes a wild-type gene, a variant gene such as a variant belonging to the same family and other families, or a truncated form, which at least partially retains the functionality of the encoded protein. The functional form of the gene can be used to replace or additionally gene therapy to replace defective or non-functional genes in patients. In other embodiments, the target gene is a gene that inactivates the dominant allele that causes an autosomal dominant genetic disease. Gene fragments can be used as recombination templates used in combination with genome editing enzymes.

[0067] Alternatively, the target gene can encode a protein of interest (e.g., an antibody or antibody fragment, a genome editing enzyme) or RNA for a specific application. In some embodiments, the protein is a therapeutic protein, including a therapeutic antibody or antibody fragment, or a genome editing enzyme. In some embodiments, the RNA is a therapeutic RNA.

[0068] In some embodiments, the sequence of the target gene is optimized for expression in a treated individual, preferably a human individual. Sequence optimization may include many changes in the nucleic acid sequence, including codon optimization, an increase in GC content, a reduction in the number of CpG islands, a reduction in the number of alternate open reading frames (ARFs), and / or a reduction in the number of splice donor and splice acceptor sites.

[0069] The target gene is a functional gene that can produce a protein, peptide or RNA encoded in the target cell (i.e., myocyte) of the disease. In some embodiments, the target gene is a human gene. The AAV viral vector is contained in the cells (i.e., myocytes) of the target organ, including a target gene in an expressible form in cardiac muscle and skeletal muscle cells. In particular, the target gene is operably connected to an appropriate regulatory sequence for expressing a transgene in an individual's target cell, tissue or organ. This sequence well known in the art particularly includes a promoter and other regulatory sequences that can further control transgene expression, such as, but not limited to, enhancers, terminators, introns, silencers, especially tissue-specific silencers and micro RNA. The target gene is operably connected to a ubiquitous, tissue-specific or inducible promoter, and the promoter is functional in the cells of the target organ (i.e., muscle). The target gene can be inserted into an expression cassette that further comprises other regulatory sequences as described above.

[0070] Examples of ubiquitous promoters include CAG promoter, phosphoglycerate kinase 1 (PGK) promoter, cytomegalovirus enhancer / promoter (CMV), SV40 early promoter, retroviral Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, β-actin promoter and EF1 promoter. Muscle-specific promoters include, but are not limited to, promoters derived from desmin (Des), muscle creatine kinase (MCK), α-myosin heavy chain (α-MHC) promoter, myosin light chain 2 (MLC-2) promoter, cardiac troponin C (cTnC) promoter, human skeletal actin (HSA) promoter or synthetic muscle-specific promoters such as SpC5-12 promoter, upstream sequence of CK6 promoter.

[0071] RNA is advantageously complementary to a target DNA or RNA sequence or is bound to a target protein. For example, RNA is an interfering RNA such as shRNA, microRNA, a guide RNA (gRNA) for genome editing in combination with a Cas enzyme or similar enzyme, an antisense RNA capable of exon skipping such as a modified small nuclear RNA (snRNA) or a long non-coding RNA. Interfering RNA or microRNA can be used to regulate the expression of a target gene involved in muscle disease. Guide RNA and Cas enzyme or similar enzyme complexes can be used for genome editing to modify the sequence of a target gene, particularly to correct the sequence of a mutant / defective gene or to modify the expression of a target gene involved in a disease, particularly a neuromuscular disease. Antisense RNA capable of exon skipping is particularly useful for correcting a reading frame and restoring the expression of a defective gene with a damaged reading frame. In some embodiments, RNA is a therapeutic RNA.

[0072] The genome editing enzyme according to the present invention is any enzyme or enzyme complex capable of modifying a target gene or target cell pathway, particularly a target gene or target cell pathway in a muscle cell. For example, a genome editing enzyme can modify the expression, sequence or regulation of a target gene or cell pathway. The genome editing enzyme is advantageously an engineered nuclease, such as but not limited to a meganuclease, a zinc finger nuclease (ZFN), a nuclease (TALEN) based on a transcription activator-like effector, a Cas enzyme and similar enzymes from a clustered regularly spaced palindromic repeat (CRISPR)-Cas system. Genome editing enzymes, particularly engineered nucleases such as Cas enzymes and similar enzymes, can be functional nucleases, which produce double-strand breaks (DSBs) or single-strand DNA breaks (nickases such as Cas9 (D10A)) in a target genome locus, and are used for site-specific genome editing applications, including but not limited to: gene correction, gene replacement, gene knock-in, gene knockout, mutagenesis, chromosome translocation, chromosome deletion, etc. For site-specific genome editing applications, genome editing enzymes, particularly engineered nucleases such as Cas enzymes and similar enzymes can be used in combination with homologous recombination (HR) matrices or templates (also referred to as DNA donor templates) that modify the target genomic locus by homologous recombination induced by double-strand breaks (DSBs). In particular, the HR template can introduce a target transgene into the target genomic locus or repair a mutation in the target genomic locus, preferably a mutation in an abnormal or defective gene that causes a muscle disorder such as a neuromuscular disease. Alternatively, genome editing enzymes (e.g., Cas enzymes and similar enzymes) can be engineered to become nuclease-deficient and used as DNA binding proteins for various genome engineering applications, such as, but not limited to, transcriptional activation, transcriptional repression, epigenomic modification, genome imaging, DNA or RNA pull-down, and the like.

[0073] The present invention also relates to isolated cells, particularly cells from individuals, which are stably transduced with the rAAV vector particles of the present invention. The individual is advantageously a patient to be treated. In some embodiments, the cell is a muscle cell according to the present disclosure, a progenitor cell of the cell or a pluripotent stem cell such as an induced pluripotent stem cell (iPS cell), an embryonic stem cell, a fetal stem cell, and an adult stem cell.

[0074] Pharmaceutical compositions and therapeutic uses

[0075] Another aspect of the present invention is a pharmaceutical composition comprising at least one active agent selected from the AAV vector particles or cells of the present disclosure and a pharmaceutically acceptable carrier.

[0076] The rAAV vector particles, cells and derived pharmaceutical compositions of the present invention can be used to treat diseases by gene therapy, especially targeted gene therapy for muscle cells or tissues. The cells and derived pharmaceutical compositions of the present invention can be used to treat diseases by cell therapy, especially cell therapy for muscle cells.

[0077] As used herein, "gene therapy" refers to the treatment of an individual, which involves delivering a target nucleic acid into the cells of the individual for the purpose of treating a disease. Delivery of nucleic acids is typically accomplished using a delivery vehicle (also referred to as a vector). The rAAV vector particles of the present invention can be used to deliver genes to patient cells.

[0078] "Cell therapy" as used herein refers to a process in which cells stably transduced by the rAAV vector particles of the invention are delivered to an individual in need thereof by any suitable method, such as by intravenous injection (infusion) or injection (implantation or transplantation) in a target tissue. In a specific embodiment, cell therapy comprises collecting cells from an individual, transducing the individual's cells with the rAAV vector particles of the invention, and administering the stably transduced cells back to the patient. "Cells" as used herein refer to isolated cells, natural or artificial cell aggregates, bioartificial cell scaffolds, and bioartificial organs or tissues.

[0079] Gene therapy can be performed by gene transfer, gene editing, exon skipping, RNA interference, trans-splicing or any other genetic modification of any coding or regulatory sequence in the cell, including those contained in the nucleus, mitochondria or as symbiotic nucleic acids, such as but not limited to viral sequences contained in the cell.

[0080] The two main types of gene therapy are as follows:

[0081] - Therapies aimed at providing a functional replacement gene for a defective / abnormal gene: this is replacement or add-on gene therapy;

[0082] - Therapies aimed at gene or genome editing: in this case, the aim is to provide the cells with the necessary tools to correct the sequence or modify the expression or regulation of a defective / abnormal gene, so that a functional gene is expressed or an abnormal gene is suppressed (inactivated): this is gene editing therapy.

[0083] In additional gene therapy, the target gene can be a functional form of a gene that is defective or mutated in the patient, as is the case, for example, in genetic diseases. In this case, the target gene will restore the expression of the functional gene. Thus, by gene editing or gene replacement, the correct version of the gene is provided in the target cells (i.e., muscle cells) of the affected patient, which can contribute to an effective treatment for the disease.

[0084] Gene or genome editing uses one or more target genes, such as:

[0085] - a gene encoding a therapeutic RNA as defined above, such as an interfering RNA, such as a shRNA or a microRNA, a guide RNA (gRNA) for use in combination with a Cas enzyme or similar enzyme, or an antisense RNA capable of exon skipping, such as a modified small nuclear RNA (snRNA); and

[0086] - A gene encoding a genome editing enzyme as defined above, for example an engineered nuclease, such as a meganuclease, a zinc finger nuclease (ZFN), a nuclease based on a transcription activator-like effector (TALEN), a Cas enzyme or similar enzyme, or a combination of these genes, and may also be a fragment of a functional form of a gene used as a recombination template as defined above.

[0087] Gene therapy is used to treat muscle diseases. Muscle diseases include various hereditary (genetic) and acquired diseases or conditions that affect the structure or function of muscles (including skeletal and cardiac muscles). The disease may be caused by trauma, infection, degeneration, structural or metabolic defects, tumors, inflammatory or autoimmune conditions or other causes. Non-limiting examples of muscle diseases that can be treated by gene therapy include neuromuscular genetic diseases, such as muscle genetic diseases; cancer and autoimmune diseases.

[0088] In some embodiments, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes a neuromuscular disease. Neuromuscular genetic diseases include, among others, muscular dystrophy, congenital muscular dystrophy, congenital myopathy, distal myopathy, other myopathies, myotonic syndrome, ion channel myopathy, malignant hyperthermia, metabolic myopathy, hereditary cardiomyopathy, congenital myasthenic syndrome, motor neuron disease, hereditary paraplegia, hereditary motor and sensory neuropathy, and other neuromuscular diseases.

[0089] Specific examples of neuromuscular genetic diseases that can be treated using rAAV with modified capsids according to the present invention are listed below:

[0090] - Dystrophinopathies are a spectrum of X-linked muscle diseases caused by pathogenic variants in the DMD gene encoding the protein dystrophin. Dystrophinopathies include Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and DMD-associated dilated cardiomyopathy.

[0091] - Limb-girdle muscular dystrophy (LGMD) is a group of disorders that are clinically similar to DMD but occur in both sexes due to autosomal recessive and autosomal dominant inheritance. Limb-girdle muscular dystrophy is caused by mutations in genes encoding sarcoglycans and other proteins associated with the muscle cell membrane that interact with dystrophin. The term LGMD1 refers to the inheritance type that shows dominant inheritance (autosomal dominant), while LGMD2 refers to the type with autosomal recessive inheritance. More than 50 pathogenic variants have been reported (LGMD1A to LGMD1G; LGMD2A to LGMD2W). Calpainopathy (LGMD2A) is caused by mutations in the gene CAPN3 with more than 450 such pathogenic variants. Genes that contribute to the LGMD phenotype include: anoctamin 5 (ANO5), vascular adventitial substance (BVES), calpain 3 (CAPN3), caveolin 3 (CAV3), CDP-L-ribitol pyrophosphorylase A (CRPPA), dystroglycan 1 (DAG1), desmin (DES), DnaJ heat shock protein family (Hsp40) homolog subfamily B member 6 (DNAJB6), dysferlin (DYSF), fukutin-related protein (FKRP), fukutin (FKT), GDP-mannose pyrophosphorylase B (GMPPB), heterogeneous nuclear ribonucleoprotein D-like (HNRNPDL), LIM zinc finger domain containing 2 (LIMS2), lainA:C (LMNA), troponin (MYO T), plectin (PLEC), protein O-glucosyltransferase 1 (PLOGLUT1), protein O-linked mannose N-acetylglucosaminidase 1 (β1,2-) (POMGNT1), protein O-mannose kinase (POMK), protein O-mannosyltransferase 1 (POMT1), protein O-mannosyltransferase 2 (POMT2), sarcoglycan alpha (SGCA), sarcoglycan beta (SGCB), sarcoglycan delta (SGCD), sarcoglycan gamma (SGCG), titin-cap (TCAP), transport protein 3 (TNPO3), torsades de pointes 1A-interacting protein (TOR1AIP1), transport protein particle complex 11 (TRAPPC11), tripartite motif containing 32 (TRIM 32), and titin (TTN). The main contributing genes to the LGMD phenotype include CAPN3, DYSF, FKRP and ANO5 (Babi Ramesh Reddy Nallamilli et al., Annals of Clinical and Translational Neurology, 2018, 5, 1574-1587).

[0092] -Emery-Dreyfus muscular dystrophy (EDMD) is caused by a defect in one of the genes including the EMD gene (encoding emerin), the FHL1 gene, and the LMNA gene (encoding lamins A and C).

[0093] -Nesprin-1 and Nesprin-2 related muscular dystrophy caused by defects in the SYNE1 and SYNE2 genes, respectively; LUMA related muscular dystrophy caused by defects in the TMEM43 gene; LAP1B related muscular dystrophy caused by defects in the TOR1AIP1 gene.

[0094] - facioscapulohumeral muscular dystrophy, type 1 (FSHD1A), such as associated with defects in the DUX4 gene (contraction of the D4Z4 macrosatellite repeat in the subtelomeric region of chromosome 4q35) or the FRG1 gene; facioscapulohumeral muscular dystrophy, type 2 (FSHD1B), caused by defects in the SMCHD1 gene.

[0095] - Spinal muscular atrophy is a genetic disease caused by mutations in the survival motor neuron 1 (SMN1) gene and is characterized by weakness and wasting (atrophy) of the muscles used for movement.

[0096] -X-linked myotubular myopathy is a genetic disease caused by mutations in the myotubularin (MTM1) gene that affects muscles used for movement (skeletal muscle) and occurs almost exclusively in males. This condition is characterized by muscle weakness (myopathy) and decreased muscle tone (hypotonia).

[0097] - Titinopathies are genetic diseases caused by mutations in the titin (TTN) gene. Both dominant and recessive TTN mutations have been reported to cause a broad spectrum of cardiac and skeletal muscle diseases. Dominant titinopathy includes hereditary myopathy with early respiratory failure (HMERF) and late-onset tibial muscular dystrophy (TMD) caused by mutations in exon 344. Recessive titinopathy includes limb-girdle muscular dystrophy 2J, distal titinopathy of young or early adult onset, Emery-Dreifuss myopathy without cardiomyopathy, and congenital myopathy with or without heart disease.

[0098] -Pompe disease is a genetic disease caused by mutations in the acid alpha-glucosidase (GAA) gene. Mutations in the GAA gene prevent acid alpha-glucosidase from effectively breaking down glycogen, which allows this sugar to accumulate to toxic levels in lysosomes. This accumulation damages organs and tissues throughout the body, especially muscles, leading to the progressive signs and symptoms of Pompe disease.

[0099] - Glycogen storage disease III (GSD3) is an autosomal recessive metabolic disease caused by homozygous or compound heterozygous mutations in the amylo-α-1,6-glucosidase, 4-α-glucanotransferase (AGL) gene, which encodes a glycogen debranching enzyme and is associated with abnormal glycogen accumulation with short outer chains. Clinically, GSD III patients present with hepatomegaly, hypoglycemia, and growth retardation in infancy or early childhood. Muscle weakness in patients with IIIa is minimal in children but can become more severe in adults; some patients develop cardiomyopathy.

[0100] In some embodiments, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes a neuromuscular disease, which is selected from the group comprising dystrophin disease (DMD gene) and limb-girdle muscular dystrophy (LGMD) (CAPN3, DYSF, FKRP, ANO5, DNAJB6 gene and other such as SGCA, SGCB, SGCG). In some preferred embodiments, the target gene for gene therapy is selected from the group consisting of DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB and SGCG.

[0101] A specific example of gene editing is the treatment of limb-girdle muscular dystrophy 2A (LGMD2A) caused by mutations in the calpain-3 gene (CAPN3). Other non-limiting examples are the treatment of mutations in the DMD or TNT genes.

[0102] Therefore, by gene editing or gene replacement, the correct version of this gene is provided in the muscle cells of the affected patient, which may contribute to an effective treatment for the disease. Other genetic diseases of muscle as listed above may be treated by gene replacement or gene editing using the same principle.

[0103] Alternative or additional gene therapy can be used to treat cancer, particularly rhabdomyosarcoma. Target genes in cancer can modulate the cell cycle or metabolism and migration of tumor cells, or induce tumor cell death. For example, inducible caspase-9 can be expressed in muscle cells to induce cell death, preferably in combination therapy to induce a durable anti-tumor immune response.

[0104] In the case of autoimmunity or cancer, gene editing can be used to modify gene expression in target cells (i.e., muscle cells), or to interfere with viral circulation in such cells. In this case, preferably, the target gene is selected from those encoding guide RNA (gRNA), site-specific endonucleases (TALEN, meganucleases, zinc finger nucleases, Cas nucleases), DNA templates, and RNAi components (such as shRNA and microRNA). Tools such as CRISPR / Cas9 can be used for this purpose.

[0105] In some embodiments, gene therapy is used to treat diseases that affect other tissues by expressing therapeutic genes in muscle tissue. This is useful to avoid expression of therapeutic genes in the liver, particularly in patients with concurrent liver diseases such as hepatitis, including viral or toxic hepatitis. The therapeutic gene preferably encodes a therapeutic protein, peptide, or antibody that is secreted from the muscle cells into the bloodstream where it can be delivered to other target tissues such as the liver. Examples of therapeutic genes include, but are not limited to, factor VIII, factor VIII, and GAA genes.

[0106] In various embodiments of the invention, the pharmaceutical composition comprises a therapeutically effective amount of rAAV vector particles or cells. In the context of the present invention, a therapeutically effective amount refers to a dose sufficient to reverse, alleviate or inhibit the progression of a disorder or condition to which the term applies, or to reverse, alleviate or inhibit the progression of one or more symptoms of a disorder or condition to which the term applies. The term "effective dose" or "effective dosage" is defined as an amount sufficient to achieve or at least partially achieve the desired effect.

[0107] The effective dosage will be determined and adjusted depending upon factors such as the composition used, the route of administration, the physical characteristics of the individual in question (eg, sex, age and weight), co-administered medications and other factors that will be recognized by those skilled in the medical arts.

[0108] In various embodiments of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and / or vehicle.

[0109] "Pharmaceutically acceptable carrier" refers to a vehicle that does not produce adverse, allergic or other untoward reactions when properly administered to mammals, especially humans. A pharmaceutically acceptable carrier or excipient refers to any type of non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation aid.

[0110] Preferably, the pharmaceutical composition contains a vehicle which is pharmaceutically acceptable for an injectable formulation. These may be in particular isotonic, sterile saline solutions (mono- or disodium phosphate, sodium chloride, potassium chloride, calcium chloride or magnesium chloride, etc. or mixtures of these salts), or dry, in particular lyophilized compositions which, after adding sterile water or physiological saline, can be reconstituted into injectable solutions, as appropriate.

[0111] The pharmaceutical form suitable for injection includes a sterile aqueous solution or suspension. The solution or suspension may include an additive that is compatible with the viral vector and does not prevent the viral vector particles from entering the target cell. In all cases, the form must be sterile and must be a fluid that reaches the extent of easy injection capability. It must be stable under production and storage conditions and must prevent the contamination of microorganisms such as bacteria and fungi. Examples of suitable solutions are buffers, such as phosphate buffered saline (PBS) or lactated Ringer's solution.

[0112] The present invention also provides a method for treating a disease by expressing a therapeutic gene in a target tissue (ie, muscle tissue), which comprises: administering a therapeutically effective amount of the pharmaceutical composition as described above to a patient.

[0113] The present invention also provides a method for treating a muscle disorder, comprising: administering a therapeutically effective amount of the pharmaceutical composition described above to a patient.

[0114] Another aspect of the present invention relates to the use of the rAAV vector particles, cells, and pharmaceutical compositions according to the present disclosure in the preparation of drugs for treating muscle disorders, especially neuromuscular genetic diseases, according to the present disclosure.

[0115] Another aspect of the invention relates to rAAV vector particles, cells, pharmaceutical compositions according to the present disclosure for use as medicaments and / or for gene therapy, in particular for the treatment of muscle disorders according to the present disclosure, in particular neuromuscular genetic diseases.

[0116] Another aspect of the present invention relates to the use of the rAAV vector particles, cells, pharmaceutical compositions according to the present disclosure for treating muscle disorders according to the present disclosure, in particular neuromuscular genetic diseases.

[0117] Another aspect of the present invention relates to a pharmaceutical composition for treating muscle disorders according to the present disclosure, especially neuromuscular genetic diseases, which comprises rAAV vector particles and cells according to the present disclosure as active ingredients.

[0118] Another aspect of the present invention relates to a pharmaceutical composition comprising rAAV vector particles and cells according to the present disclosure, which is used to treat muscle disorders according to the present disclosure, especially neuromuscular genetic diseases.

[0119] As used herein, the term "patient" or "subject" includes humans and other mammalian subjects receiving prophylactic or therapeutic treatment. Preferably, the patient or subject according to the present invention is a human.

[0120] As used herein, "treatment" or "treating" is defined as the application or administration of a therapeutic agent or combination of therapeutic agents to a patient, or the application or administration of said therapeutic agent to an isolated tissue or cell line from a patient, said patient having a disease, particularly a muscle disorder, with the purpose of curing, healing, alleviating, relieving, altering, remedying, improving, enhancing or affecting the disease or any symptom of the disease. In particular, the term "treat" or "treatment" refers to the reduction or alleviation of at least one adverse clinical symptom associated with the disease.

[0121] The terms "treatment" or "treating" are also used herein in contexts where a therapeutic agent is administered prophylactically.

[0122] The pharmaceutical composition of the present invention is usually administered according to known methods in a dosage and time period that effectively induces the therapeutic effect of the patient. The pharmaceutical composition can be administered by any convenient route, such as by infusion or push injection in a non-limiting manner, absorbed by the epithelium or mucocutaneous lining (e.g., oral mucosa, rectum and intestinal mucosa, etc.). The administration can be systemic, local, or systemic combined with local; systemic includes parenteral and oral, and local includes local and local areas. Systemic administration, preferably parenteral administration such as subcutaneous (SC), intramuscular (IM), intravascular administration such as intravenous (IV) or intraarterial administration; intraperitoneal (IP); intradermal (ID), epidural or other. Administration can be, for example, by injection or perfusion. In some preferred embodiments, administration is parenteral, preferably intravascular, such as intravenous (IV) or intraarterial. Parenteral administration is advantageously by injection or perfusion.

[0123] Various embodiments of the present disclosure may be combined with each other, and the present disclosure covers various combinations of the embodiments of the present disclosure.

[0124] Unless otherwise indicated, the practice of the present invention will employ conventional techniques known to those skilled in the art, which are fully explained in the literature.

[0125] The invention will now be illustrated by the following non-limiting examples with reference to the accompanying drawings, in which: BRIEF DESCRIPTION OF THE DRAWINGS

[0126] Figure 1 : Expression levels of ITGAV and ITGB6

[0127] AB. Normalized read counts per million - CPM of ITGAV and ITGB6 in total RNA-seq of different human tissues. The data were extracted and reanalyzed from the GTEx database (https: / / gtexportal.org / home / ).

[0128] Figure 2 : Cap9rh74_VR4_modified infectivity in human myoblasts and myotubes

[0129] Luciferase activity of five AAV variants in human myoblasts and myotubes 48 hours after infection.

[0130] Figure 3 : Distribution of Cap9rh74_VR4_modified after intravenous injection in WT mice.

[0131] Luciferase activity (A) and vector copy number (B) in different tissues (TA, diaphragm, quadriceps, heart, liver, lung, and kidney, respectively) in different AAV injections or control groups.

[0132] Example: Construction and biodistribution of capsid-modified rAAV vectors

[0133] 1. Materials and Methods

[0134] 1.1. Plasmid construction

[0135] Using standard cloning methods, a plasmid containing a hybrid AAV9.rh74 capsid modified by different peptides containing the motif RGDLXXL / I (SEQ ID NO: 1) (wherein XX is different from GS and ST) was derived from the plasmid pRep2-Cap9rh74 containing AAV2 Rep and the hybrid AAV9.rh74 capsid (Cap9rh74_WT) gene disclosed in WO2019 / 193119. The peptides 4um9 or 4um9_native (TDGRGDLGRLGP), 4um9_modified (SEPRGDLGELN), 5ffo or 5ffo_native (EPRRGDLATIGS), 5ffo_modified (TDQRGDLAELHG), 5nem_native (APVRGDLQVLAP) and 5nem_modified (APVRGDLAEINP) were inserted into the variable region 4 (VR-IV) between residues S452 and Q460 of the hybrid AAV9.rh74 capsid protein sequence, replacing residues T453 to T459. Bacterial clones were verified by sequencing. The resulting peptide-modified hybrid AAV9.rh74 capsid (VP1 protein) was named Cap9rh74_VR4-4um9 or Cap9rh74_VR4-4um9.Nat (SEQ ID NO: 21), Cap9rh74_VR4-4um9.Mod (SEQ ID NO: 22), Cap9rh74_VR4-5ffo or Cap9rh74_VR4-5ffo.Nat (SEQ ID NO: 23), Cap9rh74_VR4-5ffo.Mod (SEQ ID NO: 24), Cap9rh74_VR4-5nem.Nat (SEQ ID NO: 25) and Cap9rh74_VR4-5nem.Mod (SEQ ID NO: 26). The corresponding coding sequences are SEQ ID NOs: 27 to 32. A modified hybrid AAV9.rh74 capsid (Cap9rh74-HB-P1) containing peptide P1 (RGDLGLS) flanked by AAA and SG was inserted into position 589 of the hybrid AAV9.rh74 capsid sequence disclosed in WO2022 / 053630 for comparison.

[0136] 1.2. rAAV production

[0137] Recombinant AAV (rAAV) containing modified and unmodified AAV9rh74 containing a GFP-luciferase transgene under the control of a CMV promoter was produced in Généthon as described by Ayuso E et al. (Hum. Gene Ther. 2014, 25, 977–987). Viral genomes were quantified as described by Rohr et al. (J. Virol. Methods, 2002, 106, 81–88). rAAV titers were expressed as viral genome copy number (vg).

[0138] 1.3 In vivo experiments

[0139] Animals were treated according to French and European regulations. Animal procedures were approved by the local ethics committee and the Ministry of Higher Education, Research and Innovation (APAFIS#19736). rAAV expressing GFP-luciferase was added at 1×10 13 The dose of vg / kg was administered to 6-week-old C57BL / 6 mice (n=4 per group) by intravenous (IV) injection. In vivo bioluminescence images were collected 14 days after injection. Three weeks after injection, mice were sacrificed by cervical dislocation and several muscles and organs were sampled: tibialis anterior, diaphragm, heart, liver, kidney and lung.

[0140] 1.4 Bioluminescence in vivo

[0141] In vivo bioluminescence images were collected 20 days after injection. Mice were anesthetized by isoflurane inhalation and injected intraperitoneally with 100 μl of 50 mg / ml D-luciferin (Life Technologies, California, USA). In vivo imaging was performed using a luminescent imaging system (PerkinElmer).

[0142] 1.5 Quantification of vector copy number

[0143] gDNA and viral DNA were extracted from the different muscles and organs sampled using the NucleoMag Pathogen kit (Macherey-Nagel) and the KingFisher Flex instrument (ThermoFisher Scientific).

[0144] Viral genome copies were quantified by multiplex qPCR in a Light Cycler 480 instrument (Roche) using Thermo Scientific Absolute qPCR ROX Mix, primers (forward: CATCAATGGGCGTGGATAGC (SEQ ID NO:35); reverse: GGAGTTGTTACGACATTTTGGAAA (SEQ ID NO:36)) and probe (ATTTCCAAGTCTCCACCC, FAM (SEQ ID NO:37)) to detect the CMV promoter from the vector, and primers (forward: CTCCAAGCAGATGCAGCAGA (SEQ ID NO:38); reverse ATAGCCTTGCGCATCATGGT (SEQ ID NO:39)) and probe (CCGTGGTGCTGATGGGCAAGAA, VIC (SEQ ID NO:40)) to detect Rplp0 (60S acidic ribosomal protein P0) as an internal control for the samples.

[0145] In vitro luciferase assay

[0146] The samples were homogenized in lysis buffer (25 mM triphosphate, 15% glycerol, 1 mM DTT, 1 mM EDTA, 8 mM MgCl2, 0.2% TritonX-100) with a protease inhibitor cocktail (cOmpleteTM ULTRA tablets, Mini EDTA-free, EASYpack protease inhibitor cocktail tablets REF: 5892791001) using a FastPrep-24 Classic instrument (MP Biomedicals) (5 m / s, 40 s). The samples were subjected to 3 freeze / thaw cycles. After centrifugation (5 min, 10000 g, +4°C), 10 μl of the supernatant was transferred to a white opaque plate. The luminescent signal from the sample homogenate was measured using an EnSpire multimode plate reader (PerkinElmer) with a pump system that allows the dispensing of 100 μl of assay buffer (same lysis buffer without Triton X-100 and containing 2 nM ATP, Sigma, REF: 10519979001) and 100 μl of 167 μM D-luciferin. Protein quantification was performed using the Pierce BCA protein assay kit to normalize the luminescent signal by the amount of protein in the sample.

[0147] 2. Results

[0148] A recombinant AAV vector targeting the integrin heterodimer αVβ6 (ITGAV-B6) was designed for the following reasons. First, ITGB6 expression is highly upregulated in human skeletal muscle ( Figure 1 AB). Although not overexpressed in muscle tissue, ITGAV expression in muscle was significantly higher than in liver, which makes sense for liver detargeting. Second, high expression levels of both transcripts in myocyte nuclei were previously observed by single nucleus sequencing in mouse muscle tissue and in the malnutrition model-DMD. delta51 Even higher expression levels were observed in the B6 subunit (Chemello et al., PNAS, 2020, 117, 29691-29701). These results are particularly meaningful for targeting muscle tissue, especially in muscular dystrophy. Mechanistically, ITGAV-B6 binds to the RGDLxxL / I motif with high affinity, where LxxL / I forms an amphipathic α-helix and binds in a hydrophobic pocket in the B6 subunit. These motifs can be found in the prodomains of TGF-β1, TGF-β3 and FMDV viral capsid, all of which specifically bind to ITGAV-B6 (Dong et al., Nature Struct. Mol. Biol., 2014, 21, 1091-1096; Dong et al., Nature, 2017, 542, 55-59; Kotecha et al., Nature communications, 2017, 8, 15408; Protein DataBank accession number 5FFO, 4UM9 and 5NEM).

[0149] The capsid-modified rAAV was designed using the hybrid capsid Cap9rh74 as a backbone. The entire loop of the VR-IV (VR4) region was replaced by 8 amino acids of the xRGDLxxL / I motif obtained from the protein database: 4UM9, 5FFO and 5NEM. Appropriate linkers (2 amino acids) were added at each end of the peptide to allow a stable conformation of the RGD motif in the VR4 loop. The construct with the best energy score was selected for experimental validation using the Rosetta energy function. Recombinant AAV vectors containing modified capsids and CMV-GFP / Luc transgene expression cassettes were produced and purified. All capsid-modified rAAVs were produced with good titers ( AAV_Cap9rh74_VR4-4um9.Nat: 8.1x10 13 VG / mL;AAV_Cap9rh74_VR4-4um9.Mod: 1.2x10 13 VG / mL;AAV_Cap9rh74_VR4-5ffo.Nat: 3x10 13 VG / mL;AAV_Cap9rh74_VR4-5ffo.Mod: 3.5x10 12VG / mL;AAV_Cap9rh74_VR4-5nem.Nat: 1.5x10 12 VG / mL;AAV_Cap9rh74_VR4-5nem.Mod: 3.1×10 13 VG / mL), which was comparable to the wild-type AAV_Cap9rh74 (AAV9.rh74: 3.26×10 13 VG / mL) were comparable to most capsid-modified rAAVs.

[0150] Next, we tested the binding of the capsid-modified rAAV to the ITGAV-B6 heterodimer. TM The transposon system was used to construct a 293 cell line that overexpressed both hITGAV and hITGB6. Purified capsid-modified rAAVs were then infected with 2 different doses, 5E9 and 5E10 vg, in 293_WT or 293_ITGAV-B6. All capsid-modified rAAVs showed dose-dependent levels of luciferase activity, which were 100-1000 times higher than wild-type AAV_Cap9rh74.

[0151] During myogenic differentiation, ITGB6 is highly expressed only in the differentiated myotube stage, but not in satellite cells or myoblasts. To analyze the correlation between ITGAV-B6 expression levels and rAAV infectivity in myogenic systems, rAAV with modified capsids ( Figure 2 As expected, the infection level of all capsid-modified rAAVs was very low at the myoblast stage. All tested capsid-modified rAAVs showed increased infectivity in myotubes compared to wild-type AAV_Cap9rh74.

[0152] Next, the biodistribution of capsid-modified rAAV was tested after intravenous injection in wild-type mice, and vector copy number and luciferase activity were determined. AAV_Cap9rh74-HB-P1 was also included as a positive control for muscle-enriched and liver-detargeted vectors. As shown in the bioluminescent images, all variants of modified AAV were highly enriched in muscle compared to Cap9rh74-WT. In addition, luciferase activity and VCN assays confirmed higher transduction levels in all muscles compared to Cap9rh74-WT ( Figure 3 A and B). Cap9rh74_VR4-4um9 increased transduction levels in quadriceps muscle by 100-fold compared to wild-type Cap9rh74 and by approximately 3-fold compared to Cap9rh74-HBP1 ( Figure 3 A and Table 1).

[0153] Table 1: Muscle transduction efficiency of AAV_Cap9.rh74 modified with RGDXXL / I-peptide

[0154]

[0155] *from Figure 3 The values ​​derived from the data presented in A

[0156] Using this approach, at least 2 promising candidates (Cap9rh74_VR4-4um9 and Cap9rh74_VR4-5ffo) were generated that had high titers, high affinity to the ITGAV-B6 heterodimer, and displayed high infectivity in human myotubes as well as high transduction efficiency of muscle.

[0157] Sequence Listing

[0158]

[0159]

Claims

1. A recombinant adeno-associated virus (AAV) capsid protein comprising at least one copy of a peptide comprising the motif RGDLXXL / I (SEQ ID NO: 1) inserted therein, wherein XX is different from GS and ST, wherein the recombinant AAV capsid protein modified with the peptide has increased transduction efficiency in muscle compared to a recombinant AAV capsid protein not modified with the peptide.

2. The recombinant AAV capsid protein of claim 1, wherein the insertion is in variable region IV.

3. The recombinant AAV capsid protein according to claim 1 or 2, which is a hybrid of AAV serotype 9 (AAV9) and AAV serotype 74 (AAVrh74) capsid proteins.

4. A recombinant AAV capsid protein according to claim 2 or 3, wherein the insertion is in position 452; preferably, wherein the peptide insertion replaces residues at positions 453-459, and the indicated positions are determined by comparison with SEQ ID NO:

20.

5. The recombinant AAV capsid protein of any one of claims 1-4, wherein the motif is RGDLX1X2L / I, wherein X1 is G, A, L, K or Q, and X2 is R, K, E, D, A, L, T, I or V.

6. A recombinant AAV capsid protein according to claim 5, wherein the motif has a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6) and RGDLAEI (SEQ ID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably SEQ ID NO:

2.

7. The recombinant AAV capsid protein according to claim 6, wherein the peptide comprises or consists of a sequence selected from the group consisting of: TDGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18) and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or 16; more preferably SEQ ID NO:

14.

8. The recombinant AAV capsid protein according to claim 7, comprising a sequence having at least 85% identity with any one of SEQ ID NOs: 21 to 26; preferably SEQ ID NOs: 21 or 23; more preferably SEQ ID NO:

21.

9. A polynucleotide encoding the recombinant AAV capsid protein according to any one of claims 1-8.

10. A recombinant plasmid comprising the polynucleotide according to claim 9.

11. An AAV vector particle packaging a target gene, comprising the recombinant AAV capsid protein according to any one of claims 1 to 8.

12. An AAV vector particle according to claim 11, wherein the target gene is selected from the group consisting of: a therapeutic gene; a gene encoding a therapeutic protein or peptide (such as a therapeutic antibody or antibody fragment) and a genome editing enzyme; and a gene encoding a therapeutic RNA (such as interfering RNA, a guide RNA for genome editing, and an antisense RNA capable of exon skipping).

13. A pharmaceutical composition comprising a therapeutically effective amount of the AAV vector particle according to claim 11 or 12, or a cell stably transduced by the AAV vector particle according to claim 11 or 12.

14. The pharmaceutical composition according to claim 13, for use as a medicament in gene therapy.

15. The pharmaceutical composition according to claim 13, for use in treating muscle diseases.

16. The pharmaceutical composition for use according to claim 15, which targets genes that cause muscle diseases, and the muscle diseases are selected from the group consisting of dystrophinopathy and limb-girdle muscular dystrophy; preferably the genes are selected from the group consisting of DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB and SGCG.

Images