Vesicle-based compositions and uses thereof

Abstract

Vesicle-based compositions and uses thereof are disclosed. Compositions comprise vesicles, such as erythrocyte-derived extracellular vesicles (RBCEVs), for delivery of a retinoic acid-inducible gene I receptor (RIG-1) agonist to a cell. Also disclosed are methods of treating diseases by administering the vesicle-based compositions.

Description

Field of the Invention

[0001] The present invention relates generally to the field of molecular biology. In particular, the present invention relates to vesicle-based compositions and uses thereof. Background of the Invention

[0003] Many therapies, including RNA oligonucleotides, small interfering RNA (siRNA), and antisense oligonucleotides, are being developed to target many disease genes that were once considered undruggable. Despite the potential of these therapies, their clinical application is still limited by the current low efficiency of delivery of these molecules to target cells and toxicity that can cause organ damage and lead to poor survival.

[0004] Lipid-based nanoparticles were developed to deliver, for example, siRNA for cancer treatment, and they were observed to have little toxicity. However, when lipid-based nanoparticles were used with traditional siRNA, off-target effects were observed, leading to accumulation of siRNA in the wrong cells and reducing its effectiveness as an anti-cancer therapy.

[0005] Therefore, there is a need to provide improved compositions that address at least some of the above-mentioned problems.

[0006] Overview

[0007] In one aspect, the disclosure relates to compositions comprising vesicles for delivering a retinoic acid inducible gene I receptor (RIG-I) agonist to a cell.

[0008] In another aspect, the present disclosure relates to a composition comprising:

[0009] - Red blood cell-derived extracellular vesicles (RBCEVs);

[0010] - an immunomodulatory RNA (immRNA) comprising or consisting of 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1), wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or

[0011] - an antisense oligonucleotide (ASO) comprising or consisting of 5'-GGAAGUUAGGGUCUCAGGCCCUAACUUCC-3' (SEQ ID NO: 2), wherein the antisense oligonucleotide (ASO) further comprises a 5' triphosphate cap.

[0012] In another aspect, the present disclosure relates to a composition comprising:

[0013] - lipid nanoparticles;

[0014] - an immunomodulatory RNA (immRNA) comprising 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1), wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or

[0015] -KRAS-ASO.

[0016] In another aspect, the present disclosure relates to a method of delivering a retinoic acid inducible gene I receptor (RIG-I) agonist into a cell, comprising administering to the cell a pharmaceutically effective amount of a composition as disclosed herein, a pharmaceutical composition as disclosed herein, or a kit as disclosed herein.

[0017] In another aspect, the present disclosure relates to a method of treating a disease, comprising administering a pharmaceutically effective amount of a composition as disclosed herein, a pharmaceutical composition as disclosed herein, or a kit as disclosed herein to a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0020] Figure 1 A is a schematic diagram showing fluorescence activated cell sorting (FACS) analysis of RBCEVs loaded with FAM-labeled antisense oligonucleotides (ASOs) using electroporation, Exo-Fect, and REG1. As a negative control, erythrocyte-derived extracellular vesicles (RBCEVs) were incubated with FAM-ASOs without electroporation or loading reagents.

[0021] Figure 1 B is a graph showing the average FAM intensity in RBCEVs loaded with FAM-labeled ASO using electroporation, Exo-Fect, and REG1 (n=3), compared to the extracellular vesicle (EV) only condition for statistical analysis.

[0022] Figure 1 C is a schematic diagram showing a transmission electron microscopy image of FAM-ASO-loaded RBCEVs. Scale bar, 200 nm.

[0023] Figure 1 D is for display use Schematic representation of the size distribution of FAM-ASO-loaded RBCEVs measured by nanoparticle tracking analyzer.

[0024] Figure 1E is a schematic diagram showing representative immunofluorescence images of CA1a cells taking up FAM-ASO in RBCEV. Cell nuclei were stained with Hoechst (blue). Plasma membranes were stained with CellMask Deep Red (red). Scale bar, 20 μm.

[0025] Figure 1 F is a graph showing the mean intensity of FAM in CA1a cells in (E), compared with untreated controls for statistical analysis.

[0026] Figure 1 G is a schematic diagram showing FACS analysis of CA1a cells uptake of FAM-ASO loaded RBCEVs (n=3), compared with untreated controls for statistical analysis.

[0027] Figure 1 H is a graph showing the viability of human breast cancer CA1a cells treated with 0.05 μg / μl NC-ASO-loaded RBCEV at different time points. Viable cells were quantified by normalizing the absorbance readings to untreated controls at each time point (n=3).

[0028] Figure 1 I is a schematic diagram showing the loading efficiency of miR-125b ASO in RBCEVs using Exo-Fect and REG1 determined using gel electrophoresis (n=3).

[0029] Figure 1 J is a schematic diagram showing the quantitative polymerase chain reaction (qPCR) analysis of miR-125b fold change (FC) (normalized to U6B) in CA1a cells treated with different doses of RBCEV containing miR-125b ASO relative to EV only conditions (n=3). All bars represent mean ± SEM. Ns, not significant; *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 determined by Student's two-tailed t-test. Figure 1 It was shown that RBCEVs can be loaded with small RNAs using a variety of methods to deliver RNA to cancer cells.

[0030] Figure 2 A is a schematic diagram showing the design of an immunomodulatory RNA (immRNA) with a 5' triphosphate (ppp).

[0031] Figure 2BD are schematic diagrams showing qPCR analysis of RIG-I encoding mRNA (Ddx58) and its downstream effectors relative to Gapdh in mouse breast cancer 4T1 cells (B), human breast cancer CA1a cells (C), and human lung cancer H358 cells (D) treated with 0.1 μg / μL unloaded RBCEV, NC-RNA loaded RBCEV, and immRNA loaded RBCEV for 24 hours (n=4, using REG1 loaded RNA).

[0032] Figure 2 E shows A549-Dual treated with PBS, 0.05 μg / μL unloaded RBCEV, NC-RNA-loaded RBCEV, and immRNA-loaded RBCEV for 24 and 48 hours. TM and A549-Dual TM RIG-I - / - Graph of average luciferase activity in cells (n=5-9).

[0033] Figure 2 F is a schematic diagram showing multiplex immunoassay analysis of cytokines in the conditioned medium of 4T1 cells treated with 0.1 μg / μL unloaded RBCEV, NC-RNA loaded RBCEV, and immRNA loaded RBCEV for 48 hours (n=3).

[0034] Figure 2 G to I are schematic diagrams showing the FACS analysis of the average percentage of ANXV+PI+ population in 4T1 cells (G), CA1a cells (H), and H358 cells (I) after treatment with 0.1 μg / μL unloaded RBCEV, NC-RNA-loaded RBCEV, and immRNA-loaded RBCEV for 72 hours (n=4). All bar graphs represent mean ± SEM. *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001 were determined by Student's two-tailed t-test. Figure 2 RBCEVs were shown to deliver immunomodulatory RNA to activate the RIG-I pathway and induce immunogenic cell death in cancer cells.

[0035] Figure 3 A is a schematic diagram showing the miR-125b sequence and the design of ASOs with and without 5' triphosphate for miR-125b. The seed sequence of miR-125b is colored in red and underlined. A triphosphate group (PPP) is added to the 5' end of the 3p-125b-ASO, and the first four nucleotides are replaced by GG. During the IVT process, a short sequence (grey circle) is added to the 3' end of the 3p-125b-ASO.

[0036] Figure 3 B is a schematic diagram showing qPCR analysis of miR-125b relative to snoRNA234 in 4T1 cells treated with 0.1 μg / μL unloaded or NC-RNA-loaded, 125b-ASO-loaded, and 3p-125b-ASO-loaded RBCEVs for 24 hours (n=4, using REG1 loaded RNA).

[0037] Figure 3 C is a schematic diagram showing qPCR analysis of Ddx58 and its downstream effectors relative to Gapdh in 4T1 cells treated with RBCEV as in (B).

[0038] Figure 3 D is a schematic diagram showing qPCR analysis of miR-125b relative to U6B in CA1a cells treated with RBCEV as in (B).

[0039] Figure 3 E is a schematic diagram showing qPCR analysis of DDX58 and its downstream effectors relative to GAPDH in CA1a cells treated with RBCEV as in (B).

[0040] Figure 3 F is a schematic diagram showing qPCR analysis of miR-125b relative to U6B in H358 cells treated with RBCEV as in (B).

[0041] Figure 3 G is a schematic diagram showing qPCR analysis of DDX58 and its downstream effectors relative to GAPDH in H358 cells treated with RBCEV as in (B).

[0042] Figure 3 H shows A549-Dual treated with PBS, 0.05 μg / μL unloaded RBCEV, NC-RNA-loaded RBCEV, and 3p-125b-ASO-loaded RBCEV for 24 and 48 hours. TM and A549-Dual TM RIG-I - / - Graph of average luciferase activity in cells (n=5-8).

[0043] Figure 3 I is a schematic diagram showing multiplex immunoassay analysis of cytokines in the conditioned medium of 4T1 cells treated with 0.1 μg / μL unloaded, NC-RNA-loaded, and 3p-125b-ASO-loaded RBCEVs for 48 hours (n=3).

[0044] Figure 3J to L are schematic diagrams showing FACS analysis, revealing the average percentage of ANXV+PI+ populations in 4T1 cells (J), CA1a cells (K), and H358 cells (L) after 72 hours of treatment with 0.1 μg / μL unloaded, NC-RNA-loaded, 125b-ASO-loaded, and 3p-125b-ASO-loaded RBCEV (n=4). All bar graphs represent mean ± SEM. **P<0.01, ***P<0.001, and ****P<0.0001 were determined by Student's two-tailed t-test. Figure 3 RBCEV delivery of bifunctional ASOs was shown to simultaneously inhibit oncogenic miR-125b and activate the RIG-I pathway, leading to cell death of cancer cells.

[0045] Figure 4 A is a schematic diagram showing treatment of mouse 4T1 mammary tumors in BALB / c mice by intratumoral delivery of immRNA in RBCEVs.

[0046] Figure 4 B is a graph showing the volume of 4T1 tumors injected intratumorally every three days with 2.5 mg / kg of RBCEV containing immRNA or NC RNA (n=6 mice).

[0047] Figure 4 C is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to Gapdh in untreated and treated 4T1 tumors (n=6 mice).

[0048] Figure 4 D is a schematic diagram showing flow cytometric analysis of immune cells in untreated and treated 4T1 tumors (n=6 mice), presented as the average percentage of each subset among total cells. NEUT, neutrophil; NK, natural killer cell; MΦ, macrophage; DC, dendritic cell.

[0049] Figure 4 E is a graph showing ELISA quantification of IFN[beta] in the serum of mice bearing 4T1 tumors (n=4 mice).

[0050] Figure 4 F is a schematic diagram showing qPCR analysis of cytokine gene expression relative to Gapdh in untreated and treated 4T1 tumors (n=4 mice).

[0051] Figure 4 G is a schematic diagram showing representative images of TUNEL staining (orange fluorescence) of untreated and treated 4T1 tumor sections. Cancer-associated fibroblasts (green) were stained with anti-αSMA antibody. Cell nuclei were stained with Hoechst (blue). Scale bar, 50 μm. T, tumor; S, stroma.

[0052] Figure 4 H is a graph showing the average intensity per nuclear area of ​​TUNEL staining signals (n=4 mice).

[0053] Figure 4 I is a schematic diagram showing treatment of human CA1a breast tumors in NSG-SGM3 mice by intratumoral delivery of immRNA-loaded RBCEVs.

[0054] Figure 4 J is a graph showing the CA1a tumor volume after intratumoral injection of 2.5 mg / kg RBCEV loaded with immRNA or NC RNA every three days (n=6 mice).

[0055] Figure 4 K is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to GAPDH in untreated and treated CA1a tumors (n=6 mice).

[0056] Figure 4 L is a schematic diagram showing flow cytometry analysis of immune cells in untreated and treated CA1a tumors (n=6 mice). All bars represent mean±SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 were determined by Student's two-tailed t-test. Figure 4 showed that intratumoral delivery of immRNA inhibited breast cancer growth by triggering RIG-I-mediated immune response.

[0057] Figure 5 A is a schematic diagram showing treatment of mouse 4T1 mammary tumors in BALB / c mice by intratumoral delivery of 3p-125b-ASO in RBCEV.

[0058] Figure 5 B is a graph showing the volume of 4T1 tumors injected intratumorally every three days with 5 mg / kg of RBCEV containing 3p-125b-ASO or NC RNA (n=6 mice).

[0059] Figure 5 C is a schematic diagram showing qPCR analysis of miR-125b relative to sno234 in untreated and treated 4T1 tumors (n=6 mice).

[0060] Figure 5 D is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to Gapdh in untreated and treated 4T1 tumors (n=6 mice).

[0061] Figure 5E is a schematic diagram showing flow cytometric analysis of immune cells in untreated and treated 4T1 tumors (n=5 mice). NEUT, neutrophil; NK, natural killer cell; MΦ, macrophage; DC, dendritic cell.

[0062] Figure 5 F is a schematic diagram showing multiplex immunoassay analysis of cytokine concentrations (conc.) in tumor lysates from mice (n=3 mice).

[0063] Figure 5 G is a schematic diagram showing qPCR analysis of cytokine gene expression relative to Gapdh in untreated and treated 4T1 tumors (n=5 mice).

[0064] Figure 5 H is a schematic diagram showing representative images of TUNEL staining (orange fluorescence) of untreated and treated 4T1 tumor sections. Cancer-associated fibroblasts (green) were stained with anti-αSMA antibody. Cell nuclei were stained with Hoechst (blue). Scale bar, 50 μm. T, tumor; S, stroma.

[0065] Figure 5 I is a schematic diagram showing the average intensity per nuclear area of ​​TUNEL staining signals (n=4 mice). All bar graphs represent mean±SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 were determined by Student's two-tailed t-test. Figure 5 Intratumoral delivery of bifunctional ASOs was shown to inhibit breast cancer growth by triggering apoptosis and RIG-I-mediated immune responses.

[0066] Figure 6 A is a schematic diagram showing the modification of RBCEV: RBCEV is conjugated with anti-EGFR nanoantibodies and loaded with immRNA.

[0067] Figure 6 B is a schematic diagram showing FACS analysis of 4T1-hEGFR cells and parental 4T1 cells treated with 0.02 μg / μL uncoated, control (Ctrl)-VHH-coated, and EGFR-VHH-coated CFSE-labeled RBCEVs (n=3).

[0068] Figure 6 C is a schematic diagram showing FACS analysis of 4T1-hEGFR cells and parental 4T1 cells treated with 0.02 μg / μL uncoated, Ctrl-VHH-coated, and EGFR-VHH-coated FAM-NC-ASO-loaded RBCEVs (n=3).

[0069] Figure 6D is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to Gapdh in 4T1-hEGFR cells and parental 4T1 cells treated with 0.1 μg / μL uncoated, Ctrl-VHH-coated, and EGFR-VHH-coated RBCEVs containing immRNA (n=3).

[0070] Figure 6 E is a schematic diagram showing intrapulmonary delivery of EGFR-targeted CFSE-RBCEVs in mice with metastatic 4T1 breast cancer.

[0071] Figure 6 F is a schematic diagram showing FACS analysis of CFSE signals in tumor cells and immune cells in the lungs of mice treated with 25 mg / kg uncoated, Ctrl-VHH-coated, and EGFR-VHH-coated CFSE-RBCEV (n=3 mice). NEUT, neutrophil; MΦ, macrophage; DC, dendritic cell. All bar graphs represent mean ± SEM. **P<0.01 and ***P<0.001 were determined by Student's two-tailed t-test. Figure 6 It was shown that conjugation of RBCEV with EGFR-binding nanobodies promoted the specific delivery of immRNA to metastatic breast cancer cells.

[0072] Figure 7 A is a schematic diagram showing intrapulmonary treatment of mice with breast cancer metastases.

[0073] Figure 7 B is a schematic diagram showing flow cytometric analysis of tumor burden in the lungs using anti-human EGFR antibody after five treatments.

[0074] Figure 7 C is a graph showing the average percentage of hEGFR-positive tumor cells in the lung as shown in (B) (n=4 mice).

[0075] Figure 7 D is a graph showing the average percentage of metastatic areas in lungs treated with 25 mg / kg uncoated, Ctrl-VHH-coated, and EGFR-VHH-coated immRNA-containing RBCEVs after five treatments (n=4 mice).

[0076] Figure 7 E is a schematic diagram showing representative hematoxylin and eosin (H&E)-stained lung sections of mice as in (D). Scale bar, 50 μm.

[0077] Figure 7 F is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to Gapdh in mouse lung as in (A) (n=4 mice).

[0078] Figure 7 G is a schematic diagram showing FACS analysis of immune cells in mouse lungs as in (A) (n=4 mice).

[0079] Figure 7 H is a schematic diagram showing representative images of TUNEL staining (orange fluorescence) of mouse lung sections as in (A). Cell nuclei were stained with Hoechst (blue). Scale bar, 20 μm.

[0080] Figure 7 I is a graph showing the average intensity per nuclear area of ​​TUNEL staining signals (n=4 mice).

[0081] Figure 7 J is a schematic diagram showing multiplex immunoassay of cytokines in lung homogenates of mice with 4T1-hEGFR metastatic tumors (n=3 mice). All bar graphs represent mean±SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 were determined by Student's two-tailed t-test. Figure 7 Intrapulmonary delivery of immRNA using RBCEVs targeting EGFR was shown to inhibit breast cancer metastasis in the lung.

[0082] Figure 8 A is displayed as Figure 7 Schematic representation of flow cytometric analysis of activation and polarization of DCs and macrophages in mouse lungs in a (n=3-4 mice). MΦ, macrophages.

[0083] Figure 8 B is a graph showing the average percentage of cells as shown in (A) (n=3-4 mice).

[0084] Figure 8 C is displayed as Figure 7 Schematic representation of flow cytometric analysis of CD69 and granzyme B in CD8+ tumor infiltrating lymphocytes (TILs) of mouse lungs in a (n=3-4 mice).

[0085] Figure 8 D is a graph showing the average percentages of CD69 and granzyme B in CD8+ TILs as shown in (C).

[0086] Figure 8 E is a graph showing ELISA quantification of IFNγ in tumor-specific CD8+ TILs in culture supernatants at 48 h (n=3-4 mice).

[0087] Figure 8F is a schematic diagram showing the tumor-specific cytotoxic T lymphocyte (CTL) activity of CD8+TIL (n=3-4 mice). All bar graphs represent mean ± SEM. ns, not significant; *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 were determined by Student's two-tailed t-test. Figure 8 We showed that RBCEVs loaded with immRNA targeting EGFR induced DC activation, promoted M1 macrophage polarization, and enhanced tumor-specific CD8+ T cell activity.

[0088] Fig. 9 A is a schematic diagram showing the design and chemical modification of ASOs targeting KRAS G12D and G12V.

[0089] Fig. 9 B is a schematic diagram showing the knockdown of KRAS in A427 and AsPC-1 cells with KRAS G12D mutant and H1975 and DU145 cells with wild-type KRAS after treatment with RBCEV loaded with KRAS G12D ASO, as determined by Western Blot (n=3).

[0090] Fig. 9 C is a graph showing knockdown of KRAS in A427 cells harboring the KRAS G12D mutant and H1975 and DU145 cells harboring wild-type KRAS after treatment with RBCEVs loaded with KRAS G12D ASO, as determined by qPCR analysis (n=3).

[0091] Fig. 9 D is a schematic diagram showing knockdown of KRAS in AsPC-1 cells harboring the KRAS G12D mutant and in H1975 and DU145 cells harboring wild-type KRAS after treatment with RBCEVs loaded with KRAS G12D ASO, as determined by qPCR analysis (n=3).

[0092] Fig. 9 E is a graph showing changes in cell viability caused by KRAS G12D ASO2-loaded RBCEVs in A427 cells as measured by CCK-8 (n=5).

[0093] Fig. 9 F is a graph showing changes in cell viability caused by KRAS G12D ASO2-loaded RBCEVs in AsPC-1 cells as measured by CCK-8 (n=5).

[0094] Fig. 9G is a schematic diagram showing knockdown of KRAS in H441 cells with KRAS G12V mutant and H1975 cells with wild-type KRAS after treatment with RBCEV loaded with KRAS G12V ASO, as determined by Western blotting (n=3).

[0095] Fig. 9 H is a schematic diagram showing knockdown of KRAS in H441 cells with KRAS G12V mutant and H1975 cells with wild-type KRAS after treatment with RBCEV loaded with KRAS G12V ASO, as determined by qPCR analysis (n=3).

[0096] Fig. 9 I is a schematic diagram showing the reduction in cell viability caused by RBCEV loaded with KRAS G12VASO2 in A427 cells and H1975 cells determined by CCK-8 assay (n=5). All bars represent mean ± SD. ns, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 were determined by Student's two-tailed t-test.

[0097] Fig.10 is a schematic diagram showing the use of RBCEVs to deliver RIG-I agonists for anti-cancer immunotherapy.

[0098] Fig.11 A is a schematic diagram showing Western blot of ALIX, TSG101, GPA, HBA, β-actin, and GAPDH in RBCs and RBCEVs.

[0099] Fig.11 B is a schematic diagram showing single EV FACS analysis of GPAs in RBCEVs. A gating strategy was used to obtain distinct RBCEV populations from background noise.

[0100] Fig.11 C is a schematic diagram showing flow cytometric analysis of EpCAM expression in mouse lung epithelial cells and the binding affinity of α-EGFR-VHH to various cells. Fig.11 Characterization of RBCEV, mouse lung epithelial cells, and α-EGFR-VHH binding affinity is shown.

[0101] Fig.12A to D are schematic diagrams showing qPCR analysis of DDX58 and its downstream effectors relative to GAPDH in MDA-MB-468 (A), MDA-MB-231 (B), MCF10A (C), and mouse lung epithelial cells (D) treated with 0.1 μg / μL unloaded or NC-RNA-loaded, immRNA-loaded RBCEVs for 24 hours (n=3-4, using REG1 loaded RNA) ND, not detected.

[0102] Fig.12 E is a schematic diagram showing representative flow cytometry images of ANXV / PI staining in 4T1, CA1a, H358, MDA-MB-468 (MB468), MDA-MB-231 (MB231), MCF10A, and mouse lung epithelial (mLE) cells treated with 0.1 μg / μL unloaded RBCEV, NC RNA-loaded RBCEV, and immRNA-loaded RBCEV for 72 hours.

[0103] Fig.12 F is a schematic diagram showing the average percentage of ANXV+PI+ population in MB468, MB231, MCF10A and mLE cells treated with RBCEV as in (E) (n=3). All bar graphs represent mean ± SEM. *P<0.05, **P<0.01 and ****P<0.0001 were determined by Student's two-tailed t-test. Fig.12 The effects of immRNA-loaded RBCEVs on cancer cells and non-malignant cells are shown.

[0104] Fig.13 A is a schematic diagram showing the secondary structure of 3p-125b-ASO.

[0105] Fig.13 B to D are schematic diagrams showing qPCR analysis of DDX58 and its downstream effectors relative to GAPDH in MDA-MB-231 (B), MCF10A (C), and mouse lung epithelial cells (D) treated with 0.1 μg / μL unloaded or NCRNA-loaded, 125b-ASO-loaded, and 3p-125b-ASO-loaded RBCEVs for 24 hours (n=3-4, using REG1 loaded RNA) ND, not detected.

[0106] Fig.13 E is a schematic diagram showing representative flow cytometry images of ANXV / PI staining in 4T1, CA1a, H358, MDA-MB-231 (MB231), MCF10A, and mouse lung epithelial (mLE) cells treated with 0.1 μg / μL unloaded or NC RNA-loaded, 125b-ASO-loaded, and 3p-125b-ASO-loaded RBCEVs for 72 hours.

[0107] Fig.13 F is a graph showing the average percentage of the ANXV+PI+ population in MB 231, MCF10A, and mLE cells treated with RBCEV as in (E) (n=3).

[0108] Fig.13 G is a schematic diagram showing representative flow cytometry plots of ANXV / PI staining in 4T1 cells and CA1a cells after 72 h of treatment with a combination of 3p-125-ASO-loaded and immRNA-loaded RBCEVs.

[0109] Fig.13 H is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression in 4T1 cells and CA1a cells after treatment with a combination of 3p-125-ASO-loaded and immRNA-loaded RBCEVs for 24 hours. All bars represent mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 were determined by Student's two-tailed t-test. Fig.13 The effects of 3p-125b-ASO-loaded RBCEVs on cancer cells and non-malignant cells are shown.

[0110] Fig.14 A is displayed as Figure 4 Schematic diagram of flow cytometry analysis of immune cells in 4T1 breast tumors treated with RBCEV loaded with immRNA. Cells were gated based on FSC-A and SSC-A to exclude debris and dead cells. Single cells were further gated based on FSC-W and FSC-H to exclude doublets and aggregates. Live cells were gated from the singlet population based on SytoxTM Blue negative. Subsequently, the fluorescence of phenotypic markers of immune cells was gated based on the fluorescence channel and viSNE analysis was performed.

[0111] Fig.14 B is a graphical representation showing the survival rate of mice bearing orthotopic 4T1 tumors treated with 2.5 mg / kg NC-RNA-RBCEV (it), 2.5 mg / kg immRNA-RBCEV (it), 2 mg / kg anti-PD-L1 antibody (intraperitoneal (ip)), and a combination of 2.5 mg / kg immRNA-RBCEV (it) and 2 mg / kg anti-PD-L1 antibody (ip) (n = 2-4 mice).

[0112] Fig.14 C is a graph showing tumor growth in mice treated as in (B) (n=2-4 mice).

[0113] Fig.14 D is a graph showing ELISA quantification of IFN[beta] in the sera of mice bearing 4T1 tumors treated as in (B) (n=2-4 mice).

[0114] Fig.14 E is displayed as Figure 4 Schematic representation of representative viSNE plots of immune cells in CA1a breast tumors treated with immRNA-loaded RBCEVs.

[0115] Fig.14 F is a graph showing the volume of MDA-MB-468 tumors injected intratumorally every three days with 2.5 mg / kg of RBCEV containing immRNA or NC RNA (n=3-4 mice).

[0116] Fig.14 G is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to GAPDH in untreated and treated MDA-MB-468 tumors (n=3-4 mice). All bars represent mean ± SEM. **P<0.01, ***P<0.001 and ****P<0.0001 were determined by Student's two-tailed t-test. Fig.14 The efficacy of immRNA-loaded RBCEVs in breast tumors was shown.

[0117] Fig.15 is a schematic diagram showing representative viSNE plots of flow cytometry analysis of immune cells in 4T1 breast tumors treated with 3p-125b-ASO-loaded RBCEVs.

[0118] Fig.16 A is a schematic diagram showing qPCR analysis of RIG-I pathway gene expression relative to Gapdh in 4T1-hEGFR cells and parental 4T1 cells treated with 0.1 μg / μL uncoated, Ctrl-VHH-coated, and EGFR-VHH-coated RBCEVs containing immRNA (n=3). All bars represent mean ± SEM. **P<0.01 and ***P<0.001 were determined by Student's two-tailed t-test.

[0119] Fig.16 B is a schematic diagram showing representative viSNE plots of EGFR-VHH-CFSE-RBCEV biodistribution in various cell types in lungs with 4T1-hEGFR metastatic tumors. Fig.16 We showed that EGFR-VHH-RBCEV targeted 4T1-hEGFR cells in vitro and 4T1-hEGFR lung metastatic tumors in vivo.

[0120] Fig.17 A is a schematic diagram showing representative viSNE plots of individual cell types in lungs bearing 4T1 metastatic tumors treated with EGFR-VHH-immRNA-RBCEV.

[0121] Fig.17 B is a schematic diagram showing qPCR analysis of cytokine gene expression relative to Gapdh in the lungs of mice with 4T1-hEGFR metastatic tumors (n=4 mice). All bar graphs represent mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 were determined by Student's two-tailed t-test. Fig.17 Flow cytometric analysis of immune cells in the lungs with 4T1 metastatic tumors treated with EGFRVHH-immRNA-RBCEV is shown.

[0122] Fig.18 A is a schematic diagram showing the design and chemical modification of ASOs targeting EGFR L858R and T790M.

[0123] Fig.18 B is a schematic diagram showing knockdown of EGFR in H1975 cells with EGFR L858R / T790M mutant and A549 cells with wild-type EGFR after treatment with RBCEV loaded with EGFR L858R ASO, as determined by Western blotting (n=3).

[0124] Fig.18 C is a schematic diagram showing knockdown of EGFR in H1975 cells with EGFR L858R / T790M mutant and A549 cells with wild-type EGFR after treatment with RBCEV loaded with EGFR L858R ASO, as determined by qPCR analysis (n=3).

[0125] Fig.18 D is a graph showing the reduction in cell viability caused by EGFR L858R ASO4-loaded RBCEVs in H1975 cells and A549 cells, as determined by CCK-8 assay (n=5).

[0126] Fig.18 E is a schematic diagram showing knockdown of EGFR in H1975 cells with EGFR L858R / T790M mutants and A549 cells with wild-type EGFR after treatment with RBCEV loaded with EGFR T790M ASO, as determined by Western blotting (n=3).

[0127] Fig.18F is a schematic diagram showing knockdown of EGFR in H1975 cells with EGFR L858R / T790M mutants and A549 cells with wild-type EGFR after treatment with RBCEV loaded with EGFR T790M ASO, as determined by qPCR analysis (n=3).

[0128] Fig.18 G is a schematic diagram showing the reduction in cell viability caused by RBCEV loaded with EGFR T790MASO4 in H1975 cells and A549 cells determined by CCK-8 assay (n=5). All bars represent mean ± SD. ns, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 were determined by Student's two-tailed t-test.

[0129] Fig.19 A is a schematic diagram showing qPCR analysis of DDX58 and IFN-β expression in A427 cells after treatment with different RBCEV preparations.

[0130] Fig.19 B is a schematic diagram showing qPCR analysis of DDX58 and IFN-β expression in CT26 cells after treatment with different RBCEV preparations.

[0131] Fig.19 C is a schematic diagram showing qPCR analysis of DDX58 and IFN-β expression in AsPC-1 cells after treatment with different RBCEV preparations.

[0132] Fig.19 D is a schematic diagram showing qPCR analysis of DDX58 and IFN-β expression in H1975 cells after treatment with different RBCEV preparations.

[0133] Fig.19 E is a schematic diagram showing the cell viability of A427 cells after treatment with different RBCEV preparations as determined by CCK-8 assay.

[0134] Fig.19 F is a schematic diagram showing the cell viability of CT26 cells after treatment with different RBCEV preparations as determined by CCK-8 assay.

[0135] Fig.19 G is a schematic diagram showing the cell viability of AsPC-1 cells after treatment with different RBCEV preparations as determined by CCK-8 assay.

[0136] Fig.19 H is a schematic diagram showing the cell viability of H1975 cells after treatment with different RBCEV preparations as determined by CCK-8 assay.

[0137] Fig.19 I is a schematic diagram showing the expression of DDX58 and IFN-β in AsPC-1 cells after treatment with different LNP formulations as determined by qPCR.

[0138] Fig.19 J is a schematic diagram showing the cell viability of AsPC-1 cells after treatment with different RBCEV preparations as determined by CCK-8 assay.

[0139] Fig.19 K is a schematic diagram showing THP-1 monocyte activation analysis after incubation with cancer cell culture supernatant.

[0140] Fig.19 L is a schematic diagram showing flow cytometry analysis of CD86 expression in THP-1 cells after incubation with pretreated pancreatic AsPC-1 cancer cells. All bars represent mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001 were determined by one-way ANOVA test.

[0141] Fig. 20 A is a schematic diagram showing treatment of H1975 lung tumors expressing mCherry luciferase in NSGS mice by intratracheal administration of NC ASO or EGFR L858R ASO in RBCEV.

[0142] Fig. 20 B is a graph showing tumor progression over time in mice treated with EV-NC ASO or EV-L858R ASO, quantified using average bioluminescent signals. Graphs show mean ± SEM (n=5). **p<0.01 determined by two-way ANOVA test.

[0143] Fig. 20 C is a schematic diagram showing representative bioluminescence imaging of xenograft mice treated with EV-NC ASO or EV-L858R ASO over time.

[0144] Fig. 20 D is a schematic diagram showing representative IHC images of EGFR expression in tumor sections from treated mice at the end of the study. Scale bar, 100 μm.

[0145] Fig.21 A is a graph showing tumor volumes in BALB / c mice injected with CT26 cells and treated every 2 days with RBCEVs unloaded or loaded with KRAS-G12 DASO and / or immRNA by intratumoral injection. The graph represents mean ± SEM (n = 3). *P < 0.05, **P < 0.01 determined by two-way ANOVA test.

[0146] Fig.21 B is a graph showing tumor weights of RBCEV-treated mice at endpoint. Graphs represent mean ± SEM (n=3). *P<0.05 determined by Student's two-tailed t-test.

[0147] Fig.21 C is a schematic diagram showing representative H&E staining of tumors collected from treated mice. Scale bar, 100 μm.

[0148] Fig.21 D is a schematic diagram showing representative TUNEL staining of tumor sections from treated mice at the end of the study. Scale bar, 100 μm.

[0149] definition

[0150] As used herein, the term "lipid" refers to a class of organic compounds comprising carbon, hydrogen and oxygen atoms. Examples of lipids may be, but are not limited to, eicosanoids, monoglycerides, diglycerides, triglycerides, phospholipids, sphingolipids, terpenes, prenols, fatty acids, waxes, steroids or phospholipids. Additional examples of lipids may be, but are not limited to, cationic lipids, ionizable lipids, PEG-lipids, phosphatidylcholine, phosphatidylethanolamine or cholesterol.

[0151] As used herein, the term "cationic lipid" refers to a lipid comprising a hydrophilic head group and a hydrophobic tail, wherein a linker connects the hydrophilic head group and the hydrophobic tail, and the linker can be, but is not limited to, an ether, an ester or an amide.

[0152] As used herein, the term "ionizable lipid" refers to a lipid derived from a cationic lipid wherein the quaternary ammonium head group of the cationic lipid is substituted with a titratable moiety and is thus neutral at physiological pH but positively charged at low pH.

[0153] As used herein, the terms "PEG-lipid" and "PEG-modified lipid" are used interchangeably and refer to a lipid attached to polyethylene glycol (PEG), wherein one end of the PEG chain is attached to the hydrophobic tail of the lipid through a linker. The molecular weight of the PEG attached to the lipid can be, but is not limited to, 750, 2000, 5000 or 8000. PEG can be linked to lipids (e.g., lipids of lipid vesicles) or lipid nanoparticles to extend the blood circulation time of the lipid vesicles.

[0154] As used herein, the term "phospholipid" refers to a lipid comprising a glycerol backbone, a fatty acid tail, and a phosphate group, wherein the phosphate group may be modified with an organic molecule, which may be, but is not limited to, choline, ethanolamine, or serine. Examples of phospholipids may be, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, or phosphatidylserine.

[0155] As used herein, the term "steroid" refers to a lipid characterized by four carbon rings. Examples of steroids may be, but are not limited to, corticosteroids, progestogens, androgens, estrogens, cholesterol, plant sterols or ergosterol.

[0156] As used herein, the term "vesicle" refers to a structure comprising a lipid layer that encapsulates a liquid or cytoplasm. The vesicle can be made of a single lipid layer or a lipid bilayer. The vesicle can be naturally occurring, or can be artificially prepared. Examples of vesicles can be, but are not limited to, liposomes, lysosomes, transport vesicles, secretory vesicles, or extracellular vesicles. In the present disclosure, in one example, the vesicle contains or encapsulates a retinoic acid-inducible gene I receptor (RIG-I) agonist to be delivered to a cell as defined herein.

[0157] As used herein, the term "extracellular vesicle" or "EV" refers to a cell-derived membrane vesicle secreted by a cell into the extracellular space. Extracellular vesicles play a vital role in intercellular communication between cells, wherein the contents of the extracellular vesicles can contain specific molecules that can be used as biomarkers, or act as mediators of different physiological processes. Extracellular vesicles can be derived from different cells, such as but not limited to erythrocytes, cancer cells, fibroblasts, epithelial cells, endothelial cells, immune cells or platelets. Therefore, examples of extracellular vesicles can be but not limited to erythrocyte-derived extracellular vesicles, milk-derived extracellular vesicles, plasmid-derived extracellular vesicles or cancer cell-derived extracellular vesicles. In one example, these extracellular vesicles are used to deliver retinoic acid-inducible gene I receptor (RIG-I) agonists to cells, as described herein.

[0158] As used herein, the term "erythrocyte-derived extracellular vesicle" or "RBCEV" refers to an extracellular vesicle derived from an erythrocyte and having a diameter of about 120-200 nm. The RBCEV can be purified, and the purified RBCEV can have increased markers, which can be, but are not limited to, hemoglobin A (HBA), ALIX, or TSG101m. The purified RBCEV can have reduced markers, which can be, but are not limited to, the cytoskeletal protein β-actin. The RBCEV can be derived from any erythrocyte. When derived from human erythrocytes, the RBCEV can have common features, which can be, but are not limited to, a lipid membrane, a size of 100-300 nm, an increase in glycophorin A (GPA), or an increase in intraluminal hemoglobin.

[0159] As used herein, the term "lipid nanoparticle" or "LNP" refers to a spherical vesicle made of lipids, which is positively charged at low pH and neutral at physiological pH. The lipid nanoparticle can include, for example, but not limited to, one or more cationic lipids, non-cationic lipids and / or PEG-modified lipids. In one example, the lipid nanoparticle includes a lipid modified by PEG2000. In another example, LNP is used to deliver a retinoic acid-inducible gene I receptor (RIG-I) agonist to a cell, as described herein.

[0160] As used herein, the term "retinoic acid inducible gene I receptor (RIG-I)" refers to a protein that functions as a cytosolic RNA sensor and recognizes RNA sequences having a 5' triphosphate moiety and binds to short double-stranded RNA with higher affinity.

[0161] As used herein, the term "antagonist" refers to a chemical substance that binds to a target receptor to inhibit downstream effector mechanisms. The inhibition of downstream effector mechanisms by antagonists may be reversible or irreversible.

[0162] As used herein, the term "agonist" refers to a chemical substance that activates a target receptor to activate a downstream effector mechanism to produce a biological response. Agonists can be endogenous or exogenous. In one example described herein, a retinoic acid inducible gene I receptor (RIG-I) agonist is exogenous.

[0163] As used herein, the term "retinoic acid inducible gene I receptor (RIG-I) agonist" or "RIG-I agonist" refers to a substance that binds to the RIG-I gene or protein (direct agonist), or a substance that binds to a gene or protein upstream of the RIG-I gene or protein (indirect agonist), which will cause RIG-I activation and produce a biological response. Examples of RIG-I direct agonists include, but are not limited to, 3p-125b-ASO and immRNA. Examples of RIG-I indirect agonists include, but are not limited to, KRAS-G12D ASO. KRAS-G12D does not bind to RIG-I, but can act synergistically with immRNA to promote RIG-I activation.

[0164] As used herein, the term "immunomodulatory RNA" or "immRNA" refers to an RNA having a short hairpin RNA (shRNA) structure that binds to a target gene. For example, immRNA binds to a target gene to activate retinoic acid-inducible gene I receptor (RIG-I). The immRNA can comprise about 1-30 nucleotides, or about 7-11 nucleotides, about 10-14 nucleotides, about 13-17 nucleotides, about 16-20 nucleotides, about 19-23 nucleotides, about 22-26 nucleotides, about 25-30 nucleotides, or about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides.

[0165] As used herein, the term "antisense oligonucleotide" or "ASO" refers to a single-stranded deoxyribonucleotide complementary to an RNA target (such as, but not limited to, mRNA, microRNA, or non-long coding RNA). Antisense oligonucleotides silence (block) target genes. For example, antisense oligonucleotides bind to target genes to silence one or more oncogenes. In another example, modified ASOs can activate target genes, such as retinoic acid inducible gene I receptor (RIG-I). Exemplary modified ASOs may include, but are not limited to, ASOs with 5' triphosphate caps that bind to miR-125b and / or RIG-I. The antisense oligonucleotide can comprise about 1-30 nucleotides, or about 1-5 nucleotides, about 4-8 nucleotides, about 7-11 nucleotides, about 10-14 nucleotides, about 13-17 nucleotides, about 16-20 nucleotides, about 19-23 nucleotides, about 22-26 nucleotides, about 25-30 nucleotides, or about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides.

[0166] As used herein, the term "siRNA" is also referred to in the art as "small interfering RNA" and refers to a double-stranded RNA of about 20 to 24 nucleotides in length. siRNA interferes with gene expression by binding to target mRNA through complementary base pairing and degrading the target mRNA.

[0167] As used herein, the term "antibody" refers to an immunoglobulin molecule capable of binding to a specific epitope on an antigen. Antibodies may comprise polyclonal mixtures, or may be monoclonal antibodies in nature. In addition, antibodies may be complete immunoglobulins derived from natural or recombinant sources. The antibodies of the present disclosure may exist in a variety of forms, including, for example, as complete antibodies, or as antibody fragments, or other immunologically active fragments thereof, such as complementary determining regions. Antibodies may exist as antibody fragments having functional antigen binding domains (i.e., heavy and light chain variable domains).

[0168] As used herein, the term "monoclonal antibody" refers to an antibody that recognizes and binds a single epitope.

[0169] As used herein, the term "single chain antibody" is used interchangeably with the terms "single chain Fv" and "scFv" and refers to an antibody or immunoglobulin that comprises variable regions from heavy and light chains connected via a peptide linker and lacks constant regions.

[0170] As used herein, the term "nanobody" refers to an antibody having only a heavy chain variable domain and lacking a light chain. However, the antigen binding ability of nanobodies is similar to that of conventional antibodies and can be combined with a target. Examples of nanobodies can be, but are not limited to, EGFR, HER1, HER2, HER3, human growth factor (HGF), CXCR4, PD-L1, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, ITGA7, ITGA8, ITGA9, ITGA10, ITGA11, CD11D, CD103, CD11a, CD11b, CD51, CD41, CD11c, CD29, CD18, CD61, CD104, ITGB5, ITGB6, ITGB, ITGB8, FOLR1, FOLR2 or FOLR3 in combination with nanobodies.

[0171] As used herein, the term "cancer marker" is also referred to in the art as a "tumor marker" and refers to any molecule that may be present at elevated levels in a subject with cancer compared to the average level. Cancer markers vary from cancer to cancer and are well known to those of skill in the art, who will know which molecules may be present at elevated levels in a subject with cancer. Examples of molecules can be, but are not limited to, alpha-fetoprotein (AFP), immunoglobulins, epidermal growth factor receptor (EGFR), HER1, HER2, HER3, human growth factor (HGF), CXCR4, PD-L1, one or more integrin proteins (e.g., CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, ITGA7, ITGA8, ITGA9, ITGA10, ITGA11, CD11D, CD103, CD11a, CD11b, CD51, CD41, CD11c, CD29, CD18, CD61, CD104, ITGB5, ITGB6, ITGB, or ITGB8), or folate receptors (e.g., FOLR1, FOLR2, or FOLR3). EGFR can be present at elevated levels in cancers (e.g., but not limited to, breast cancer, lung cancer, pancreatic cancer, colorectal cancer, or prostate cancer). HER1 / HER2 / HER3 may be present at elevated levels in cancers such as, but not limited to, breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, or gastric cancer.

[0172] Details

[0173] The development of immunotherapy has made great strides in recent decades, beginning with the breakthrough approval of the anti-tumor cytokine interferon-α2 by the U.S. Food and Drug Administration (FDA).

[0174] RIG-I is a cytosolic RNA sensor that recognizes RNA sequences with a 5' triphosphate moiety and binds to short double-stranded RNAs with higher affinity. Although the role of RIG-I as a prognostic marker varies among cancer types, its activation consistently induces apoptotic tumor cell death and increases the infiltration of immune cells into tumors, enhancing their anticancer effects and reducing immunosuppressive activity.

[0175] Intratumoral delivery of a RIG-I agonist induced apoptosis in pancreatic cancer cells in a type I IFN-dependent manner and enhanced efficient cross-presentation of tumor-associated antigens by dendritic cells to CD8+ T cells, leading to tumor regression, for example, in mice bearing pancreatic cancer.

[0176] As RNA oligonucleotides, including small interfering RNA (siRNA) and antisense oligonucleotides, are being developed to target disease genes, combining gene knockdown with RIG-I activation has emerged as an approach for anticancer therapy.

[0177] However, the clinical application of RNA therapeutics is still limited by the current delivery of these molecules to target cells. One of the most widely used delivery vehicles for RIGI agonists is the polymer in vivo-jetPET (in vivo-jetPEI), but there are conflicting reports on its safety. In vivo-jetPET is prone to liver damage and is associated with low survival rates in mice, which is due to its toxicity. Therefore, the development of delivery methods is crucial for RNA therapeutics.

[0178] In view of the above problems, it is necessary to provide a composition that can be used to deliver retinoic acid inducible gene I receptor (RIG-I) agonists to cells. Effective delivery of retinoic acid inducible gene I receptor (RIG-I) agonists will achieve disease treatment.

[0179] Thus, the inventors of the present disclosure have discovered a composition comprising vesicles for delivering a retinoic acid inducible gene I receptor (RIG-I) agonist to a cell.

[0180] As used herein, the retinoic acid inducible gene I receptor (RIG-I) agonist can be an immunomodulatory RNA (immRNA), an antisense oligonucleotide (ASO), a small interfering RNA (siRNA), or any combination thereof.

[0181] Immunomodulatory RNA (immRNA) can be delivered to cancer cells to trigger immunogenic cell death of cancer cells by activating the RIG-I pathway ( Figure 2 and 12 ). Thus, in one example, the retinoic acid inducible gene I receptor (RIG-I) agonist can be an immunomodulatory RNA (immRNA). In another example, the immunomodulatory RNA (immRNA) comprises the sequence 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1).

[0182] Antisense oligonucleotides (ASOs) can also be delivered to cancer cells to trigger cell death ( Figure 3 and 9 ). In addition, ASOs targeting KRAS-G12D and / or KRAS-G12V can synergize with RIG-I agonists to trigger cancer cell death ( Fig. 9). Thus, in one example, the retinoic acid inducible gene I receptor (RIG-I) agonist can be an antisense oligonucleotide (ASO). In another example, the antisense oligonucleotide (ASO) can be a miRNA-125b-ASO, a KRAS-ASO, an EGFR targeting ASO, or any combination thereof. In one example, the antisense oligonucleotide (ASO) is a miRNA-125b-ASO. In another example, the antisense oligonucleotide (ASO) is a miRNA-125b-ASO. In another example, the antisense oligonucleotide (ASO) is a miRNA-125b-ASO comprising the sequence 5'-GGAAGUUAGGGUCUCAGGCCCUAACUUCC-3 (SEQ ID NO: 2). In another example, the antisense oligonucleotide (ASO) is a KRAS-ASO. In another example, the retinoic acid KRAS-ASO can be a KRAS-G12D ASO, a KRAS-G12VASO, a KRAS-G12CASO, or a KRAS-G12S ASO. In yet another example, the KRAS-ASO is a KRAS-G12D ASO, which may comprise or consist of any one of the sequences in the following table:

[0183]

[0184] In yet another example, the KRAS-ASO is a KRAS-G12V ASO, which may comprise or consist of any one of the sequences in the following table:

[0185]

[0186] In another example, the antisense oligonucleotide (ASO) is an EGFR targeting ASO. In another example, the antisense oligonucleotide (ASO) is an EGFR L858R targeting ASO. In yet another example, the antisense oligonucleotide (ASO) is an EGFR L858R targeting ASO, which may comprise or consist of any sequence in the following table:

[0187]

[0188] In another example, the antisense oligonucleotide (ASO) is an EGFR T790M targeting ASO. In yet another example, the antisense oligonucleotide (ASO) is an EGFR T790M targeting ASO, which may comprise or consist of any sequence in the following table:

[0189]

[0190] Modification of retinoic acid-inducible gene I receptor (RIG-I) agonists can achieve activation of multiple targets ( Figure 3 and 13). Thus, in one example, the immunomodulatory RNA (immRNA) comprises a modification at the 5' and / or 3' end. In another example, the modification may be, but is not limited to, a 5' triphosphate cap, phosphorylation, methylation, adenylation, or any combination thereof. In a specific example, the modification is a 5' triphosphate cap. Thus, in one example, the modified immunomodulatory RNA (immRNA) comprises the sequence 5'-pppGGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 19).

[0191] In another example, the antisense oligonucleotide (ASO) comprises a modification of the 5' and / or 3' end. Suitable modifications may be, but are not limited to, a 5' triphosphate cap, phosphorylation, methylation, adenylation, locked nucleic acid, phosphorothioate, 2-methoxyethyl, and combinations thereof. In a particular example, the modification is a 5' triphosphate cap. Thus, in one example, the modified antisense oligonucleotide (ASO) may be a modified miRNA-125b-ASO, KRAS-ASO, EGFR targeting ASO, or any combination thereof. In one example, the modified antisense oligonucleotide (ASO) is a modified miRNA-125b-ASO comprising the sequence 5'-pppGGAAGUUAGGGUCUCAGGCCCUAACUUCC-3' (SEQ ID NO: 20). In yet another example, the modified antisense oligonucleotide (ASO) is a modified KRAS-ASO. In another example, the modified KRAS-ASO can be a modified KRAS-G12D ASO, a modified KRAS-G12V ASO, a modified KRAS-G12C ASO, or a modified KRAS-G12S ASO. In one example, the modified KRAS-ASO is a modified KRAS-G12D ASO, which can comprise or consist of any of the sequences in the following table:

[0192]

[0193] In another example, the modified KRAS-ASO is a modified KRAS-G12V ASO, which may comprise or consist of any one of the sequences in the following table:

[0194]

[0195] In another example, the modified antisense oligonucleotide (ASO) is a modified EGFR targeting ASO. In another example, the modified antisense oligonucleotide (ASO) is a modified EGFR L858R targeting ASO. In yet another example, the modified antisense oligonucleotide (ASO) is a modified EGFR L858R targeting ASO, which may comprise or consist of any sequence in the following table:

[0196]

[0197] In another example, the modified antisense oligonucleotide (ASO) is a modified EGFR targeting ASO. In another example, the modified antisense oligonucleotide (ASO) is a modified EGFR T790M targeting ASO. In another example, the modified antisense oligonucleotide (ASO) is a modified EGFR T790M targeting ASO, which may comprise or consist of any sequence in the following table:

[0198]

[0199] in:

[0200] +: Locked Nucleic Acid (LNA)

[0201] *: Phosphorothioate (PS)

[0202] m: 2'-O-methoxyethyl (2'-MOE)

[0203] Extracellular vesicles (EVs) derived from red blood cells (RBCs) are non-immunogenic and non-carcinogenic. The absence of DNA in RBCs eliminates the risk of horizontal gene transfer via RBCEVs, a known risk of nucleic acid delivery using EVs from nucleated cells; and blood type matching can prevent immunogenicity. In addition, there is no observable toxicity associated with RBCEV treatment. Therefore, due to limited immunogenicity, extracellular vesicles (EVs) for delivery of RIG-I offer multiple advantages over existing RIG-I agonist delivery systems.

[0204] Thus, the compositions described herein may include extracellular vesicles or lipid nanoparticles ( Figure 1 and 11 ). Thus, in one example, the extracellular vesicle can be, but is not limited to, an erythrocyte-derived extracellular vesicle (RBCEV), a milk-derived EV, a plasmid-derived EV, and a cancer cell-derived EV. In another example, the extracellular vesicle is an erythrocyte-derived extracellular vesicle (RBCEV). In another example, the lipid nanoparticle comprises a lipid, which can be, but is not limited to, a cationic lipid, an ionizable lipid, a PEG-lipid, a phospholipid, a phosphatidylcholine, a phosphatidylethanolamine, or cholesterol. In one example, the lipid nanoparticle comprises a lipid modified with PEG2000.

[0205] Specific targeting of cancer cells is an important feature of EV-based drug delivery to improve efficacy and reduce toxicity. In the present invention, RBCEVs are conjugated with antibodies to promote the uptake of extracellular vesicles by target cells ( Figure 6and 16 ). Therefore, in one example, the antibody can be, but is not limited to, a nanobody, a monoclonal antibody or a single-chain antibody. In another example, the antibody is a nanobody. In yet another example, the antibody is a nanobody that binds to a cancer marker. Therefore, in one example, the cancer marker can be, but is not limited to, epidermal growth factor receptor (EGFR), HER1, HER2, HER3, human growth factor (HGF), CXCR4, PD-L1, one or more integrin proteins (e.g., CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, ITGA7, ITGA8, ITGA9, ITGA10, ITGA11, CD11D, CD103, CD11a, CD11b, CD51, CD41, CD11c, CD29, CD18, CD61, CD104, ITGB5, ITGB6, ITGB or ITGB8), one or more folate receptors (e.g., FOLR1, FOLR2 or FOLR3) or a combination thereof.

[0206] In the present disclosure, novel compositions of EVs and RIG-I agonists are provided, which are capable of activating RIG-I, inducing anti-tumor immunity, particularly type I interferon-mediated anti-tumor polarization, and targeting metastatic EGFR-positive cancers.

[0207] Thus, in one example, disclosed herein is a composition comprising:

[0208] erythrocyte-derived extracellular vesicles (RBCEVs);

[0209] An immunomodulatory RNA (immRNA) comprising or consisting of 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1), wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or

[0210] An antisense oligonucleotide (ASO) comprising or consisting of 5'-GGAAGUUAGGGUCUCAGGCCCUAACUUCC-3' (SEQ ID NO: 2), wherein the antisense oligonucleotide (ASO) further comprises a 5' triphosphate cap (eg, 3p-125b-ASO).

[0211] In another example, disclosed herein is a composition comprising:

[0212] Lipid nanoparticles;

[0213] An immunomodulatory RNA (immRNA) comprising or consisting of 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3', wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or

[0214] KRAS-ASO.

[0215] The compositions disclosed herein can be formulated to be suitable for administration. Therefore, in one example, a pharmaceutical composition is disclosed herein, which comprises a composition disclosed herein and a pharmaceutically acceptable excipient. Suitable excipients are well known to those skilled in the art and can be, but are not limited to, polymers, lactose, sucrose or sodium starch glycolate.

[0216] The compositions or pharmaceutical compositions disclosed herein may be packaged in a kit for the convenience of the user. Such a kit may include a composition disclosed herein or a pharmaceutical composition disclosed herein. The additional components of the kit may include other components, which may be, but are not limited to, anticancer drugs or buffers. Suitable anticancer drugs may be, but are not limited to, anti-PD1 antibodies, anti-oncogene ASOs, anti-cancer cell factors, and combinations thereof.

[0217] Effective immunomodulation of the tumor microenvironment and antitumor activity were achieved using the compositions described herein without any observable side effects, demonstrating the advantages of the compositions described herein for clinical applications. For example, the therapeutic effects of EVs loaded with RIG-I agonists were validated in breast cancer and lung metastasis models ( Figure 4 , 5 , 7 and 17).

[0218] In another example, the delivery of RIG-I agonists and antisense oligonucleotides (ASOs) was shown to induce RIG-I pathway activation, type I IFN production, and apoptosis of cancer cells. In addition, immRNA also synergized with KR4S-G12D ASO and KRAS-G12V ASO in inhibiting the viability of cancer cells.

[0219] Thus, in one example, disclosed herein is a method of delivering a RIG-I agonist using extracellular vesicles. In another example, disclosed herein is a method of providing / delivering an anti-cancer therapy or anti-cancer immunotherapy to a subject in need thereof.

[0220] The delivery method can be carried out by administering the components of the composition, pharmaceutical composition or kit of the present disclosure. In one example, the composition disclosed herein or the pharmaceutical composition disclosed herein can be administered together with an anticancer drug. The anticancer drug can be, but is not limited to, an anti-PD1 antibody, one or more anticancer gene ASOs, and one or more anticancer cell factors. In another example, the anticancer drug can be administered simultaneously or subsequently with the composition described herein. Suitable modes of administration are well known to those skilled in the art. Therefore, in one example, the method of administration can be, but is not limited to, intrapulmonary, intranasal, intratracheal, subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intracranial injection, infusion technique, topical, oral, rectal, nasal, buccal and vaginal administration. In one example, the method of administration is intrapulmonary administration. In another example, the method of administration is intratumoral administration.

[0221] Intratumoral administration of RBCEVs containing or encapsulating RIG-I agonists and antisense oligonucleotides (ASOs) inhibited tumor growth and triggered high levels of type I IFN, immune cell activation, and significant tumor cell apoptosis in the tumor microenvironment, and targeted delivery conferred strong antitumor efficacy ( Figure 7 , 8 and 17).

[0222] Accordingly, disclosed herein are methods of treating a disease in a subject in need thereof using a composition, pharmaceutical composition, or kit of the present disclosure.

[0223] In one example, the disease is cancer. In another example, the cancer can be, but is not limited to, breast cancer, lung cancer, pancreatic cancer, brain cancer, head and neck cancer, liver cancer, stomach cancer, colon cancer, prostate cancer, cervical cancer, and bone cancer. In another example, the cancer is EGFR positive breast cancer. In another example, the cancer is EGFR positive lung cancer. In another example, the cancer is lung metastatic cancer. In another example, the cancer is pancreatic cancer.

[0224] In yet another example, the disease is a pulmonary disease or disorder. In another example, the pulmonary disease or disorder can be, but is not limited to, asthma or pneumonia.

[0225] Also disclosed herein are compositions, pharmaceutical compositions or kits for use in therapy or for treating a disease. In one example, disclosed herein are compositions, pharmaceutical compositions or kits for use in anti-cancer therapy or anti-cancer immunotherapy.

[0226] In another example, disclosed herein is the use of the composition, pharmaceutical composition or kit of the present disclosure in the preparation of a medicament for treating a disease.

[0227] As used in this application, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "genetic marker" includes more than one genetic marker, including mixtures and combinations thereof.

[0228] As used herein, the terms "increase" and "decrease" refer to the relative change in a selected trait or characteristic in a population subset compared to the same trait or characteristic present in the entire population. Thus, an increase indicates a change in the positive range, while a decrease indicates a change in the negative range. As used herein, the term "change" also refers to the difference in a selected trait or characteristic of an isolated population subset compared to the same trait or characteristic in the entire population. However, the term does not assess the difference seen.

[0229] As used herein, the term "about" in the context of a substance concentration, substance size, length of time, or other specified value means + / -5% of the stated value, or + / -4% of the stated value, or + / -3% of the stated value, or + / -2% of the stated value, or + / -1% of the stated value, or + / -0.5% of the stated value.

[0230] Throughout this disclosure, certain embodiments may be disclosed in the form of ranges. It should be understood that the description in the form of ranges is only for convenience and brevity, and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be deemed to have specifically disclosed all possible subranges and individual values ​​within the range. For example, the description of a range (e.g., 1 to 6) should be deemed to have specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual values ​​within the range, such as 1, 2, 3, 4, 5 and 6. Regardless of the width of the range, this applies.

[0231] The invention exemplarily described herein can be appropriately practiced in the absence of any one or more elements, one or more limitations not specifically disclosed herein. Thus, for example, the terms "comprise", "include", "contain", etc. should be understood broadly without limitation. In addition, the terms and expressions employed herein have been used as descriptive terms rather than restrictive terms, and the use of these terms and expressions is not intended to exclude any equivalents or portions thereof of the features shown and described, but it should be recognized that various modifications can be made within the scope of the invention claimed. Therefore, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, those skilled in the art may modify and change the invention embodied in the contents disclosed herein, and such modifications and changes are considered to be within the scope of the present invention.

[0232] The invention has been described broadly and generically herein. Each narrower species and subgeneric grouping that falls within the generic disclosure also forms part of the invention. This includes the generic description of the invention with the proviso or negative limitation that deletes any subject matter from that genus, whether or not the deleted matter is specifically recited herein.

[0233] Other embodiments are within the scope of the following claims and non-limiting examples.In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0234] Experimental Section

[0235] Materials and methods

[0236] Cell culture

[0237] Mouse breast cancer 4T1 cell line and human breast cancer MCF10CA1a (CA1a) cell line were purchased from Karmanos Cancer Institute (Wayne State University, USA). Human breast cancer MDA-MB-468 and MDA-MB-231 cell lines, non-transformed human mammary epithelial cell line MCF10A, human lung cancer NCI-H358 (H358) cell line, H1975, H441 and A427 cell lines, human pancreatic cancer AsPC-1 cells and human prostate cancer DU145 cell line, human monocytic THP-1 cells and murine colorectal cancer CT26 cell line were obtained from the American Type Culture Collection (ATCC, USA). Human lung epithelial cancer reporter cell line A549-Dual TM and A549-Dual TM RIGI - / - All cell lines except MCF10A cells were cultured at 37°C in a humidified incubator with 5% CO2 in a medium supplemented with 10% fetal bovine serum (FBS) (Biosera, France), 1× penicillin-streptomycin (Thermo Fisher Scientific) and 5 μg / ml Plasmocin. TM MCF10A cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Thermo Fisher Scientific, USA) containing prophylactic agent (InvivoGen, USA). MCF10A cells were cultured in MEBM medium supplemented with additives from the MEGM kit (Lonza, UK) and 100 ng / ml cholera toxin (Sigma, USA).

[0238] Isolation of primary mouse lung epithelial cells

[0239] Mouse lung epithelial cells were isolated from female BALB / c mice as previously described (Kasinski & Slack, 2013). Briefly, 7-week-old mice were euthanized. Mouse lungs were excised and dissociated using a GentleMACS dissociator (Miltenyi Biotec, Germany) in RPMI medium containing 10% FBS and 5 mg / ml collagenase IV (Thermo Fisher Scientific). Cells were filtered through a 70 μm filter, washed and seeded in 10 cm plates. Fibroblasts are more sensitive to trypsin and can therefore be removed, while epithelial cells adhere longer. During epithelial cell selection, removing the first batch of cells that begin to fall off the plate after trypsinization helps to improve the purity of epithelial cells. After three rounds of selection, flow cytometry was used to evaluate the expression of EpCAM in epithelial cells.

[0240] Purification of RBCEV

[0241] Blood samples from healthy donors were obtained from the Health Sciences Authority of Singapore and the Hong Kong Red Cross, China, with informed consent. RBCs were isolated from whole blood and RBCEVs were purified from RBCs as previously described (Pham et al., 2021). Briefly, RBCs were separated from plasma using centrifugation at 1,000 × g for 8 min at 4 °C and washed three times with PBS (centrifugation at 1,000 × g for 8 min at 4 °C). Leukocytes were completely removed by a leukocyte removal filter (Nigale, China). The separated RBCs were collected in Nigale buffer (0.2 g / L citric acid, 1.5 g / L sodium citrate, 7.93 g / L glucose, 0.94 g / L sodium dihydrogen phosphate, 0.14 g / L adenine, 4.97 g / L sodium chloride, 14.57 g / L mannitol), diluted in PBS containing 0.1 mg / mL calcium chloride, and incubated overnight with 10 μM calcium ion carrier (Sigma, USA) at 37 ° C with 5% CO2. RBC and cell debris were precipitated and the supernatant was collected by centrifugation at increasing speeds (600 × g for 20 min, 1,600 × g for 15 min and 3,260 × g for 15 min). The supernatant was filtered through a 0.45 μm membrane and then ultracentrifuged at 50,000 × g for 70 min at 4 ° C using a SW32 rotor (Beckman Coulter, USA). The pellet was suspended in 1 mL PBS and then loaded onto a 60% sucrose cushion and ultracentrifuged at 50,000×g for 16 h at 4° C. RBCEVs were collected at the interface and washed with PBS at 50,000×g for 70 min at 4° C. Purified RBCEVs were stored in PBS containing 4% trehalose at −80° C.

[0242] Characterization of RBCEVs

[0243] use The size distribution and concentration of RBCEVs were quantified by a nanoparticle tracking analyzer (Particle Metrix, Germany). Since hemoglobin is the main component of RBCEVs, the amount of RBCEVs is indicated by the amount of hemoglobin throughout this study. The hemoglobin content in RBCEVs was quantified using a NanoDropTM 2000 spectrophotometer (Thermo Fisher Scientific).

[0244] Western blot analysis

[0245] RBCEVs were lysed on ice for 5 min using RIPA buffer (Thermo Fisher Scientific) supplemented with protease inhibitors (Biotool, USA). Cells were lysed on ice for 30 min. Protein concentration was measured by PierceTM BCA assay (Life Technologies, USA) using BSA (New England Biolabs, UK) concentration as standard. A total of 50 μg of protein lysate was mixed with Precision Plus Protein TM The samples were loaded onto 10% polyacrylamide gels together with KaleidoscopeTM prestained protein standards (Bio-Rad, USA). The proteins were transferred to Immobilon-P polyvinylidene difluoride membranes (Merck Millipore, USA), blocked for 1 h with 5% milk in Tris-buffered saline (TBST) containing 0.1% Tween-20, and then incubated with primary antibodies, anti-ALIX antibody (Santa Cruz, USA, dilution 1:1,000), anti-TSG101 antibody (Santa Cruz, dilution 1:1,000), anti-human GAPDH antibody (Santa Cruz, dilution 1:1,000), anti-human GPA antibody (Santa Cruz, dilution 1:500), anti-human HBA antibody (Santa Cruz, dilution 1:1,000), anti-human KRAS antibody (Invitrogen, USA, dilution 1:1,000), anti-EGFR antibody (Santa Cruz, dilution 1:1,000), and anti-ALIX antibody (Santa Cruz, USA, dilution 1:1,000). Cruz, USA, dilution 1:1,000) or anti-human β-actin antibody (CST, USA, dilution 1:1,000) was incubated overnight at 4°C. The membrane was washed three times with TBST and then incubated with HRP-conjugated secondary antibody (Jackson ImmunoResearch, USA, dilution 1:10,000) at room temperature for 1 hour. The blot was imaged using the ChemiDocTM gel documentation system (Bio-Rad).

[0246] Transmission electron microscopy

[0247] RBCEVs were fixed with 2% paraformaldehyde for 10 min and loaded onto glow-discharged copper grids (200 mesh, coated with formvar carbon film). RBCEVs on the grids were incubated with 3% uranyl acetate for 5 min to negatively stain RBCEVs. The grids were then quickly washed with distilled water to remove excess stain. The grids were air-dried for 10 min and then imaged using a Tecnai G2 transmission electron microscope (FEI) at 100 kV.

[0248] Single EV flow cytometry

[0249] Single EV flow cytometry was performed using a CytoFLEX LX flow cytometer (Beckman Coulter, USA). RBCEVs were stained with anti-human GPA-FITC antibody (BioLegend, USA) for 3 h at 4 °C, followed by two washing steps with sterile 0.2 μm-filtered PBS to remove unbound antibodies. 3 Up to 2.5×10 5 EV suspensions in the EV / μL range enable accurate analysis of single EVs (Pham et al., 2021). Therefore, stained RBCEVs were diluted to a concentration of 3 × 10 in 0.2 μm filtered PBS. 4 EV / μL. RBCEVs were gated out from background noise using the violet side scatter (VSSC) channel acquired with a 405 nm laser ( Fig.11 B). Reference 100 nm beads were used to verify gating of the EV population. Data were acquired using the following settings: FSC 138, SSC 180, FITC 3000, VSSC 800, with the threshold for the trigger signal (VSSC) manually set to 4000. The flow rate was maintained at 30 μL / min (achieving an event rate of ~5000 events / second), and the abort rate was kept below 5% for the duration of the experiment.

[0250] Sequence and modification of RNA oligonucleotides

[0251] As described in the following section, immRNA (5'-PPPGGAUUUCCACCUUCGGGGGAAAUCC-3') (SEQ ID NO: 19) and 5' triphosphate 125b-ASO (3p-125b-ASO) (5'-pppGGAAGUUAGGGUCUCAGGCCCUAACUUCC-3') (SEQ ID NO: 20) were synthesized by in vitro transcription. Anti-miR-125b ASO (125b-ASO) (5'-UCACAAGUUAGGGUCUCAGGGA-3') (SEQ ID NO: 53), negative control RNA (NC RNA) (5'-CAGUACUUUUGUGUAGUACAA-3') (SEQ ID NO: 54) and FAM-labeled NC-ASO (5'-FAMCAGUACUUUUGUGUAGUACAA-3') (SEQ ID NO: 55) were synthesized by Shanghai GenePharma (Shanghai, China), and each nucleotide was 2'O-methyl modified.

[0252] Oncogene-targeting ASOs with 2'-O-methoxyethyl (MOE), phosphorothioate (PS), and locked nucleic acid (LNA) modifications ( Fig. 9 A and 18A) were synthesized by Integrated DNA Technologies (USA).

[0253] In vitro transcription of RNA (IVT)

[0254] immRNA was prepared according to the protocol of Yong et al., 2019. Briefly, RNA was transcribed in vitro using T7 RNA polymerase and a pair of primers (forward: GGATTTCCCCCGAAGGTGGAAATCCTATAGTGAGTCGTATTAC (SEQ ID NO: 125); reverse: GTAATACGACTCACTATAGGATTTCCACCTTCGGGGGAAATCC (SEQ ID NO: 126)). The reaction contained 40 mM Tris-HCl pH 8.0, 30 mM MgCl2, 2 mM spermidine, 10 mM DTT, 0.01% Triton-X100, 5 mM GTP and 4 mM NTP (CTP, ATP and UTP), 1 μM annealed DNA template, 400-600 nM T7 RNA polymerase and 0.2 U / mL thermostable inorganic pyrophosphatase, and the reaction was carried out at 37 ° C overnight. The IVT reaction was terminated and RNA was extracted using phenol:chloroform:isoamyl alcohol (25:24:1). RNA was precipitated with three volumes of 95% ethanol at -80°C overnight in the presence of 0.1% (v / v) sodium acetate. Target RNA was further separated by Hi-TrapQ HP column and the expected RNA band was excised from 20% denaturing urea-PAGE. Similar to immRNA, 3p-125b-ASO was prepared as described above using a DNA template (sense: 5'-GTAATACGACTCACTATAGGAAGTTAGGGTCTCAGGCT-3' (SEQ ID NO: 56); antisense: 3'-CATTATGCTGAGTGATATCCTTCAATCCCAGAGTCCGA-5' (SEQ ID NO: 57)) and a pair of primers (forward: AGCCTGAGACCCTAACTTCCTATAGTGAGTCGTATTAC (SEQ ID NO: 127); reverse: GTAATACGACTCACTATAGGAAGTTAGGGTCTCAGGCT (SEQ ID NO: 128)). Prior to subsequent experiments, the quality of immRNA and 3p-125b-ASO was again determined on 20% denaturing urea-PAGE and by IFN activity assay.

[0255] To confirm the sequence of 3p-125b-ASO, the ASO was incubated with RNA 5' pyrophosphohydrolase (RppH) (New England Biolabs) at 37°C for 1-2 hours. RNA was analyzed using BioAnalyzer 2100 (Agilent, USA) and converted into cDNA using NEBNext Small RNA Library Preparation Kit (New England Biolabs) according to the manufacturer's instructions. The library was sequenced using the Illumina HiSeq 2500 system. Sequencing reads were processed using Geneious Prime to trim the 3' adapter sequence (TGGAATTCTCGGGTGCCAAGG) (SEQ ID NO: 58). The sequence was aligned to the miR-125b ASO using Bowtie.

[0256] RNA loading into RBCEV

[0257] REG1 EV loading reagent (Carmine Therapeutics, USA) or Exo-Fect was used according to the manufacturer’s protocol. TM Exosome transfection kit (System Biosciences, Canada) was used to transfect 50 μg of RBCEV with 1 μg of RNA. After that, free RNA and transfection reagent were washed away using centrifugation at 21,000 × g for 30 min. For electroporation, 50 μg of RBCEV was electroporated with 1 μg of RNA at 250 V in a 0.4 cm cuvette with a fixed capacitance of 100 μF using a GenePulser Xcell electroporator (Bio-Rad) with an exponential program.

[0258] RNA loading into lipid nanoparticles (LNPs)

[0259] RNA-loaded LNPs were prepared by dilution. In brief, 10 μg of NC-ASO, KRAS G12D ASO, immRNA, NC-ASO-immRNA or KRAS G12D ASO-immRNA in 500 μl of HEPES buffer (10 mM, pH 4.0) was added to 500 μl of ethanol containing 185 nmole of DOTAP, 500 nmole of DOPE, 300 nmole of cholesterol and 15 nmole of DSPE-mPEG under vortex conditions. Then, 4.5 ml of HEPES (10 mM, pH 4.0) was added to the solution to dilute the concentration of ethanol. The resulting solution was centrifuged (4000 g, 30 min, 20 ° C) using Amicon Ultra 100K tubes. Next, 4.0 ml of PBS pH 7.4 was added to the tube to exchange the buffer and concentrate the LNP, and again centrifuged at 4000 g, 30 min, 20 ° C.

[0260] RNA loading into lipid nanoparticles (LNPs)

[0261] 1,2-Dioleoyl-3-trimethylammonium-propane (chloride salt) (DOTAP), (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)) (DSPE-mPEG2000) and cholesterol were purchased from Avanti Polar Lipids (Alabama, USA). RNA-loaded LNPs were prepared by the dilution method. In brief, 10 μg of NC-ASO, KRAS G12D ASO, immRNA, NC-ASO-immRNA or KRAS G12D ASO-immRNA in 500 μl of HEPES buffer (10 mM, pH 4.0) was added to 500 μl of ethanol containing 185 nmole of DOTAP, 500 nmole of DOPE, 300 nmole of cholesterol and 15 nmole of DSPE-mPEG under vortexing conditions. Then, 4.5 ml of HEPES (10 mM, pH 4.0) was added to the solution to dilute the ethanol concentration. The resulting solution was centrifuged (4000 × g, 30 min, 20 ° C) using an Amicon Ultra 100K tube. Next, LNPs were buffer exchanged and concentrated by adding 4.0 ml of PBS pH 7.4 to the tube and centrifuged again at 4000 g, 30 min, 20 ° C.

[0262] Quantification of RNA loaded in RBCEVs

[0263] After RNA loading, RBCEV or LNP were incubated with 1% Triton-X (Sigma) at room temperature for 5 min, and then incubated with heparin sulfate at a final concentration of 20 mg / mL at 37°C for 1 hour. The samples were separated on 2% Tris-acetate-EDTA agarose gels containing nucleic acid gel stain (Sigma) at 100 V for 60 min and analyzed with ChemiDoc TM The gel was visualized using the Gel Documentation System and the fluorescence intensity of the bands was quantified using ImageJ v1.8.0.

[0264] Conjugation of RBCEV with anti-human EGFR nanobodies

[0265] A method for functionalizing the RBCEV surface was previously developed using OaAEP1 ligase to attach peptides with a ligase binding motif (NGL) at the C-terminus to the RBCEV surface (Pham et al., 2021). For OaAEP1-mediated peptide ligation, RBCEVs were incubated in a solution with a final concentration of 2 μM ligase and 500 μL of a biotinylated linker peptide (biotin-TRNGL, GL Biochem, China) at 25°C for 3 h. After incubation, RBCEVs were washed three times with PBS using centrifugation at 21,000 × g for 20 min. Then, biotin-TRNGL-linked RBCEVs were incubated with streptavidin (SA) (Abcam, UK) at a final concentration of 0.1 mg / mL at room temperature for 2 h. SA-biotin-RBCEVs were subsequently washed as previously described to remove free, unbound streptavidin. For further functionalization, sequences of anti-human EGFR nanobody (α-EGFR-VHH) and anti-mCherry nanobody (α-mCherry-VHH) were cloned with additional epitope tags for detection and purification. VHH encoding DNA was synthesized by Guangzhou IGE Biotechnology Ltd (China) and inserted into the pET32(a+) plasmid behind the T7 promoter. Nanobody expression and purification were performed as described previously (Pham et al., 2021). After purification, the nanobody was purified using Lightning-B according to the manufacturer's instructions. α-EGFR-VHH or α-mCherry-VHH was biotinylated using a biotinylation kit (Abcam). Biotin-hEGFR-VHH or biotin-mCherry-VHH was then incubated with SA-biotin-RBCEV at 4°C for 6 hours and washed twice with PBS. After washing, uncoated or VHH-coated RBCEVs were incubated with 20 μM CFSE (Life Technologies) at 37°C for 1 hour and washed twice with PBS. After washing, the labeled RBCEVs were washed once using centrifugation and loaded onto a size exclusion chromatography (SEC) column (Izon, New Zealand) and eluted with PBS to wash away unbound dye. RBCEVs collected from SEC fractions 7 to 9 were washed twice with PBS by centrifugation at 21,000 × g for 15 min at 4°C. For in vivo treatment, uncoated or VHH-coated RBCEVs were loaded with immRNA using REG1 as described previously.

[0266] In vitro treatment of cancer cells with RBCEV

[0267] A total of 50,000 4T1, CA1a, or H358 cells were seeded in 24-well plates and then incubated with 0.1 μg / μL RBCEVs loaded with immRNA, 3p-125b-ASO, 125b-ASO, or NC-RNA for 24-72 hours in a humidified incubator at 37°C with 5% CO2. Cells were then harvested for immunofluorescence imaging, RT-qPCR, or flow cytometry analysis. For dose-response assays, 50,000 CA1a cells were incubated with 0.2, 0.1, 0.05, 0.025, and 0.0125 μg / μL of 125b-ASO-loaded RBCEVs for 24 hours and then collected for RT-qPCR analysis. For EV targeted delivery assays, 100,000 4T1-hEGFR cells were incubated with 0.02 μg / μL uncoated or VHH-coated CFSE-labeled or FAM-NC-ASO-loaded RBCEVs for 2 h and then collected for flow cytometry analysis. 100,000 4T1-hEGFR cells were incubated with 0.1 μg / μL uncoated or VHH-coated immRNA-RBCEVs for 24 h and then collected for RT-qPCR analysis.

[0268] To examine the knockdown efficacy of KRAS G12D, KRAS G12V, EGFR L858R, or EGFR T790M targeting ASOs, 50,000 cells were seeded into each well of a 12-well plate and cultured overnight in a humidified incubator at 37°C with 5% CO2. Cells were then treated with 100 nM NC ASOs or RBCEVs loaded with oncogene targeting ASOs. After 48 hours, cells were harvested for RT-qPCR and western blot analysis.

[0269] Cell viability assay

[0270] A total of 10,000 CA1a cells were seeded in a 96-well plate and then incubated with 0.05 μg / μL NC-ASO-loaded RBCEV. After 24, 48, and 72 hours, the cells were incubated with 10% (v / v) CCK-8 reagent (Biosharp, China) at 37°C with 5% CO2 for 2 hours. The absorbance was measured at 450 nm using a microplate reader (Tecan, Switzerland).

[0271] To evaluate the antitumor effects of KRAS or EGFR ASOs in combination with immRNA, 5,000 AsPC-1 cells were seeded in each well of a 96-well plate and then incubated with 0.1 μg / μl RBCEVs or lipid nanoparticles loaded with NC-ASO, targeting, immRNA, NC-ASO-immRNA, or KRASG12D ASO-immRNA for 48 hours. The cells were then incubated with 10% (v / v) CCK-8 reagent and the absorbance was measured as described above. Cell viability was determined according to the following equation:

[0272] Cell viability (%) = [(OD450 (样品) –OD450 (空白) ) / (OD450 (对照) –OD450 (空白) )]x 100%

[0273] Immunofluorescence imaging

[0274] 24 hours before treatment, CA1a cells were pre-seeded on 12 mm coverslips (Citoglass, China) coated with poly-D-lysine (Gibco, USA). After treatment with FAM-NC-ASO-loaded RBCEV, the coverslips were rinsed with fresh culture medium and stained with CellMask TMDeep red plasma membrane stain (Thermo Fisher Scientific) was stained at 37°C for 10 minutes. The cells were rinsed twice in PBS and stained with Hoechst 33342 (Abcam) at room temperature for 5 minutes. The coverslips were rinsed three times with PBS and then fixed for 12 minutes using 4% paraformaldehyde (Alfa Aesar, USA) in PBS. The coverslips were subsequently washed three times with PBS, followed by the final wash with distilled water, and then mounted on a slide using an anti-fading fluorescent mounting agent (Abcam). Images were acquired using an Olympus FV3000 confocal microscope (Olympus, Japan). Image acquisition was performed using FluoView software, and further analysis and quantification were performed using ImageJ v1.8.0. The cell region was selected as a region of interest (ROI) based on the expansion mask of the Hoechst signal. The FAM signal was measured as the average pixel intensity of the ROI. Under each condition, the total measurement area covered 1200 to 1600 cells.

[0275] IFN reporter assay

[0276] A549-Dual TM and A549-Dual TM RIG-I - / - Cells were seeded in 96-well plates at 10,000 cells per well in culture medium, cultured for 18-24 hours, and then incubated with RBCEVs. 0.05 μg / μL of RBCEVs loaded with immRNA, 3p-125b-ASO, or NC-RNA were incubated with cells for 24 and 48 hours. Lucia luciferase in the supernatant was detected by QUANTI-Luc reagent (InvivoGen) on a Synergy H1 microplate reader (Biotek, USA).

[0277] Activation of immune cells in co-culture systems

[0278] AsPC-1 cells were seeded in 12-well plates at a density of 50,000 cells / well and cultured overnight in a humidified incubator at 37°C with 5% CO2. The cells were then treated with RBCEVs that delivered 1 μg / ml of NC ASO, KRASG12D ASO, immRNA, or a combination of KRAS G12D ASO and immRNA. After 48 hours, the cell culture medium was harvested and centrifuged at 21,000 × g for 20 minutes to completely remove free RBCEVs. The supernatant was collected and added to THP-1 cells pre-seeded in 12-well plates at a density of 100,000 cells / well. After 24 hours, the treated THP-1 cells were collected, blocked with anti-human CD16 / CD32 antibodies, and stained with anti-human CD86-APC (Biolegend). The stained cells were then analyzed by FACS LSRII cytometer (BD BioSciences, USA).

[0279] According to the manufacturer's protocol (Miltenyi Biotec, USA), monocytes from human peripheral blood mononuclear cells (PBMCs) separated by Ficoll were separated from lymphocytes by using human CD14 microbeads. Monocytes were differentiated into macrophages by culturing in RPMI medium supplemented with 10% fetal bovine serum, 1× penicillin-streptomycin and 10ng / ml M-CSF for 7 days and then incubated with the supernatant of treated PDOs. PCA067 PDOs were seeded in 24-well plates until the diameter reached 50-200nm. Afterwards, PDOs were treated with RBCEVs, which delivered 1μg / ml of NC ASO, KRAS G12D ASO, immRNA or a combination of KRAS G12D ASO and immRNA. After 48 hours, the culture medium was harvested and centrifuged at 21,000×g for 20 minutes to completely remove free RBCEVs. The collected supernatant was added to PBMC-derived macrophages. After 24 h, macrophages were harvested for RNA extraction and qPCR analysis.

[0280] Generation of cancer models in vivo and treatment with RBCEV

[0281] All mouse experiments were performed according to experimental protocols approved by the Institutional Animal Care and Use Committee of National University of Singapore. Mice of similar age were marked and randomly divided into groups for control and test treatments. The experiments were performed in a blind manner. Mice that died unexpectedly due to anesthesia were excluded. BALB / c mice were purchased from InVivos Pte Ltd, Singapore. NSG-SGM3 mice (NOD.CgPrkdc <scid>Il2rg <tm1wjl> / Tg(CMV-IL3,CSF2,KITLG)1Eav / MloySzJ) and BALB / c nude mice (NU / JInv strain) were purchased from Jackson Laboratory, USA.

[0282] Intratumoral administration of RBCEV

[0283] 1.25×10 5 4T1 cells. Ten days later, the mice were randomized and injected intratumorally with 2.5 mg / kg RBCEV loaded with immRNA, 5 mg / kg RBCEV loaded with 3p-125b-ASO, or an equal amount of RBCEV loaded with NC-RNA as a control. The intratumoral injection was repeated every three days for a total of five times. For PD-L1 blocking treatment, 2 mg / kg of anti-mouse PD-L1 monoclonal antibody (BioXCell, USA) was injected intraperitoneally into mice bearing 4T1 tumors one day after intratumoral injection of RBCEV loaded with immRNA. The treatment was repeated five times at intervals of three days. Tumor size was measured every two days using a digital caliper. When the diameter of the untreated tumor approached ~15 mm, the mice were killed. Tumors were collected for RNA extraction, flow cytometry analysis, or imaging.

[0284] 1×10 6 CA1a cells. Fourteen days later, mice were randomized and injected intratumorally with 2.5 mg / kg RBCEV loaded with immRNA or NC-RNA. Intratumoral injections were repeated every three days for a total of five times. Tumor size was measured every two days using a digital caliper. Mice were sacrificed when untreated tumors approached ~15 mm in diameter. Tumors were harvested for RNA extraction, flow cytometry analysis, or imaging.

[0285] 5 × 10 5 CT26 cells. When the tumor volume reaches about 40-50mm 3 At 1:10 p.m., mice with similar tumor volume and body weight were selected and randomly divided into four groups (recorded as day 0), and intratumorally injected with 2.5 mg / kg RBCEV, NC ASO, KRAS G12D ASO, or 5 mg / kg RBCEV loaded with KRAS G12D ASO and immRNA at intervals of 2 days. Tumor size was measured every two days using a digital caliper. When the diameter of the untreated tumor approached ~15 mm, the mice were sacrificed. The absolute wet weight of the isolated tumor was measured by an automatic electronic balance. The tumor was then subjected to RNA extraction or imaging.

[0286] Targeted delivery of RBCEVs into the lungs

[0287] To generate a breast cancer metastasis model, 4T1 cells were transduced with a lentiviral vector (pHAGE-EGFR, Addgene, USA), selected with puromycin (Santa Cruz) and sorted using an Aria II sorter (BD Biosciences) to create a stable cell line with high expression levels of human EGFR. A total of 2.5 × 10 5 4T1-hEGFR cells were injected intravenously into 7-week-old female BALB / c mice. One day after inoculation, each mouse was intrapulmonary delivered with 25 mg / kg of uncoated or VHH-coated immRNA-RBCEV every two days using a mouse microspray nebulizer (Yuyan, China). After five treatments, mice were sacrificed and lungs were removed for RNA extraction, flow cytometric analysis, or imaging. For intrapulmonary biodistribution of RBCEV, 5 × 10 5 4T1-hEGFR cells were injected intravenously into 7-week-old female BALB / c mice. Seven days later, 25 mg / kg of uncoated or VHH-coated CFSE-RBCEV was delivered intrapulmonary. After 24 hours, mice were sacrificed and lungs were removed for flow cytometry analysis.

[0288] To generate an orthotopic lung cancer model, H1975 cells were transduced with a lentiviral vector (pLenti-mCherry-luc, Addgene, USA), selected with puromycin (Santa Cruz) and sorted using an Aria II sorter (BD Biosciences) to create a stable H1975 cell line expressing luciferase and mCherry (Luc-mCherry-H1975). A total of 1×10 6 Luc-mCherry-H1975 cells were injected intravenously into 8-week-old NSGS mice. Five weeks later, mice were imaged by IVIS to check for tumor growth in the lungs. Mice with similar bioluminescent intensity were divided into two groups (recorded as day 0) and RBCEVs loaded with NC ASO or EGFR L858RASO were administered intratracheally at intervals of 3 days. On the 14th day, mice were killed and lung tissues were collected for H&E and immunohistochemical staining.

[0289] Flow cytometric analysis

[0290] RBCEV analysis

[0291] To quantify the loading efficiency of FAM-NC-ASO, 50 μg of RBCEV was incubated with 2.5 μg of latex beads (ThermoFisher Scientific) on a shaker at 4 ° C overnight, washed three times with PBS and resuspended in 100 μL FACS buffer. FACS analysis of latex beads was performed using a CytoFlex LX cytometer (Beckman Coulter). FACS plots were generated using FlowJov10.0.7.

[0292] Apoptosis analysis

[0293] After treatment with RBCEV, cells were collected and washed with PBS. Cell apoptosis was determined by Annexin V (ANXV) / propidium iodide (PI) staining using an apoptosis detection kit (Life Technologies). Briefly, 50,000 treated cells were incubated with ANXV and PI in binding buffer at 4 ° C for 15 min. Cells were then analyzed using a FACS LSRII cytometer (BD BioSciences, USA) or a CytoFlexS cytometer (Beckman Coulter). FACS graphs were generated using FlowJo v10.0.7.

[0294] Immune cell analysis

[0295] Tumors were excised, washed with PBS, and dissociated in DMEM medium containing 10% FBS and 5 mg / mL collagenase IV (Thermo Fisher Scientific) using a GentleMACS dissociator (Miltenyi Biotech, Germany). Cells were filtered through a 70 μm filter, blocked with anti-mouse CD16 / CD32 antibody (BioLegend), and stained with the following antibodies at 4°C for 30 min: anti-mouse CD45-PECy7 (BioLegend), anti-mouse CD11b-FITC (BioLegend), anti-mouse F4 / 80-APC (BioLegend), anti-mouse Ly6G / C-APC (BioLegend), anti-mouse CD3ε-APC (BioLegend), anti-mouse CD11c-PB (BioLegend), anti-mouse CD49b-APC ( The cells were then washed three times in FACS buffer. Cells were analyzed using a FACS LSRII cytometer (BD BioSciences) or a CytoFLEX S cytometer (Beckman Coulter) or a CytoFLEX LX cytometer (Beckman Coulter). Dead cells were identified and removed from the analysis by staining with SYTOXTM dye (ThermoFisher Scientific). FCS files were analyzed using FlowJo v10.0.7, Kaluza (Beckman Coulter) or Cytobank viSNE (Beckman Coulter). In brief, cells were first gated using FSC-A and SSC-A graphs to exclude debris and dead cells. Subsequently, single cells were gated by FSC-W and FSC-H graphs to exclude doublet cells and aggregated cells. Subsequently, fluorescence-positive cell populations were gated by targeted fluorescence channels, and viSNE analysis was then performed. Equal event sampling was selected. The viSNE graphs of each individual parameter were downloaded from Cytobank. Phenotypic markers were used to assign cell phenotypes to viSNE graphs based on distribution and expression characteristics.

[0296] Ex vivo analysis of tumor-specific T cell activity

[0297] To detect CD69 and granzyme B expression of tumor-infiltrating CD8+T cells, CD8+T cells were selected from dissociated tumor cells using a CD8+ tumor-infiltrating lymphocyte isolation kit (Miltenyi Biotec). The isolated CD8+T cells were blocked with anti-mouse CD16 / CD32 antibodies and stained with anti-mouse CD69-PE (BioLegend) or anti-mouse granzyme B-FITC antibodies (BioLegend). Data were acquired using a FACS LSRII cytometer and analyzed using FlowJo. To detect tumor-specific T cell activity, isolated CD8+T cells were incubated with 4T1-hEGFR-luciferase cells at a ratio of 50:1 for 48h. Supernatants without floating cells were harvested. The amount of IFNγ in each supernatant was analyzed using a mouse IFNγ ELISA kit (BioLegend) according to the manufacturer's instructions. Tumor cell viability was assessed using a luciferase assay kit (Promega, USA) according to the manufacturer's instructions. Data were acquired using a microplate reader (Tecan).

[0298] Mouse cytokine immunoassay

[0299] At the end point of in vivo treatment, mouse blood was harvested by cardiac puncture. Whole blood was coagulated at 37°C for 30 min, and serum was separated after centrifugation at 5,000 rpm for 20 min. The separated serum was collected and stored at -80°C. IFNβ concentration in serum was measured using a recombinant mouse IFNβ ELISA kit (Biolegend) according to the manufacturer's instructions. For multiplex immunoassays, cell culture supernatants were collected after centrifugation at 300×g for 5 min. Tumors were excised and homogenized in cold RIPA buffer supplemented with protease inhibitors. Tumor lysates were collected using centrifugation at 12,000×g for 20 min. ProcartaPlex TM The multiplex immunoassay kit (Invitrogen, USA) measured the cytokine concentrations in the collected supernatant or tumor lysate. The cytokines measured included IFNα, IFNβ, IL-6, IL-10, IL-12p40, and TNFα.

[0300] RNA extraction and RT-qPCR

[0301] Total RNA was extracted from cells or tissues using TRIzol (Thermo Fisher Scientific) according to the manufacturer's manual. RNA was converted into cDNA using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific) according to the manufacturer's protocol. mRNA levels were quantified using the PCR amplification kit (Bio-Rad) and normalized to GAPDH (see Supplementary Table S1 for primer sequences). miRNA levels were quantified using the miRNA qPCR kit (ThermoFisher Scientific) and normalized to snoRNA234 (mouse) or U6B snRNA (human). All qPCR reactions were performed using the CFX96 Touch TM Real-time PCR detection system (Bio-Rad) or QuantStudio 6Flex Real-time PCR system (Life Technologies).

[0302] Hematoxylin and eosin (H&E) staining and TUNEL assay

[0303] After being fixed overnight in 10% neutral buffered formalin (Sigma), tumor or lung tissue was dehydrated in 70%, 80%, 90% and 100% ethanol at 37°C using Leica TP1020 tissue processor (Leica, Germany). Samples were clarified in three Histo-Clear baths (National Diagnostics, USA), each bath lasted 1.5 hours at 37°C, and immersed in 3 paraffin baths (Thermo Fisher Scientific), each bath lasted 1 hour at 62°C. Paraffin blocks were cut into 5 μm sections using Leica RM2255 rotary microtome. Sections were dried at 37°C, and dewaxed continuously in 3 Histo-Clear baths, then immersed in 2 absolute ethanol baths and 1 70% ethanol bath, each lasting 10min. Sections were rehydrated in 90%, 75% and 50% ethanol, each lasting 5min, and rehydrated in distilled water for 10min. Subsequently, the sections were stained with hematoxylin (Abcam) for 5 min. After washing with water, the sections were treated with 0.3% acid alcohol, washed and blued with a blueing reagent (Abcam). The sections were then stained with 0.5% eosin (Abcam) for 1 min. After washing with water, the sections were dehydrated in anhydrous ethanol, clarified in Histo-Clear, and then sealed with Histomount mounting solution (National Diagnostics). Images were acquired by TissueFAXS PLUS slide scanner (TissueGnostics, Austria). Image acquisition was performed using TissueFAXS viewer software, and further analysis and quantification were performed using ImageJ v1.8.0.

[0304] Apoptosis was evaluated using the TUNEL assay BrdU-Red kit (Abcam) combined with immunofluorescence staining. 4T1 tumor sections were washed twice with PBS. Antigen retrieval was performed by superheating the sections in a microwave oven for 15 min until boiling of the antigen retrieval solution (Tris-EDTA, pH 9.0) was achieved. The sections were allowed to cool in the retrieval solution for 30 min. Blocking buffer (5% normal donkey serum and 0.3% TritonX-100 in PBS) was applied for 1 h at room temperature. After incubation with rabbit anti-mouse α-smooth muscle actin antibody (Abcam, dilution 1:250) at 4°C overnight, the sections were incubated with Alexa Fluor conjugated to Donkey anti-rabbit secondary antibody (Jackson ImmunoResearch, dilution 1:200) with 647 fluorophore was incubated at room temperature for 1 h. The sections were then stained using a TUNEL assay kit according to the manufacturer's protocol. After staining, TUNEL staining images were acquired using a LSM-710NLO confocal microscope (Zeiss, Germany) or an Olympus FV3000 confocal microscope (Olympus). Image acquisition was performed using ZeissZen software or FluoView software, while further analysis and quantification were performed using ImageJ v1.8.0. The nuclear region was selected as the region of interest (ROI) based on the Hoechst signal. The BrdU-Red signal was measured as the average pixel intensity in the selected ROI.

[0305] Statistical analysis

[0306] All statistical analyses were performed using a Student's two-tailed t-test in GraphPad Prism 8 (GraphPad Software, CA) to determine significant differences between treated samples and controls. P values ​​less than 0.05 were considered significant based on at least 3 independent replicates. In all graphs, data are presented as median or mean and standard error of the mean (SEM). Animal experiments were repeated in groups of 5 to 6 mice. The minimum sample size was determined to be 3 using G*Power analysis, which compared the mean differences of 2 independent groups, with an alpha error probability of 0.05, an effect size of d = 5, and a power of 0.95.

[0307] result

[0308] RBCEVs can be loaded with small RNAs using a variety of methods for RNA delivery to cancer cells

[0309] RBCEVs were purified according to a previous protocol (Usman et al., 2018). Purified RBCEVs were enriched for common EV markers, such as ALIX and TSG101, as well as the major RBC protein hemoglobin A (HBA) ( Fig.11 A). It was also found that RBCEVs express glycophorin A (GPA) on their surface, which serves as a unique marker for EVs derived from human RBCs ( Fig.11 AB). The cytoskeletal protein β-actin was almost absent in RBCEV, indicating that the purified RBCEV was free of cellular debris ( Fig.11 A). In addition, the purified RBCEVs were uniform in size, with diameters ranging from 120 to 200 nm ( Figure 1 D).

[0310] To deliver therapeutic RNA to cancer cells, RBCEVs were loaded with small RNAs using a variety of methods, including electroporation, Exo-Fect-mediated transfection, and REG1-mediated transfection. RBCEVs were separated from RNA transfectant complexes using three rounds of centrifugation. Bead-assisted flow cytometry analysis of FAM-ASO-loaded RBCEVs showed that FAM-ASOs were efficiently loaded into RBCEVs using three different methods ( Figure 1 AB). The loading efficiency of Exo-Fect and REG1 is relatively higher than that of electroporation ( Figure 1 AB). It was also observed that loading with REG1 resulted in a homogeneous RBCEV population with strong FAM fluorescence ( Figure 1 AB). In contrast, simple incubation did not promote the incorporation of FAM-ASO into RBCEVs ( Figure 1 A). Transmission electron microscopy showed that after REG1 transfection, RBCEVs retained a morphology similar to untreated controls, whereas electroporated and Exo-fect transfected RBCEVs showed signs of aggregation as indicated by a greater degree of ruffled membranes ( Figure 1 C). Nanoparticle tracking analysis also revealed that REG1 maintains the size of RBCEVs ( Figure 1 D). After electroporation and Exo-Fect transfection, RBCEVs are prone to aggregation, as evidenced by an increase in the proportion of larger EVs (diameter ∼400-600 nm) ( Figure 1 D).

[0311] The uptake of FAM-ASO-loaded RBCEVs by human breast cancer MCF10aCA1a (CA1a) cells was further investigated using three loading methods. FACS and immunofluorescence analysis showed that CA1a cells readily took up RBCEVs containing FAM-ASO ( Figure 1 EG). Confocal imaging showed that FAM signal existed inside the cells ( Figure 1 E). FACS showed that Exo-Fect-transfected RBCEVs were most uptaken by CA1a cells ( Figure 1 G), while immunofluorescence analysis showed that REG1-transfected RBCEVs were taken up most by CA1a cells ( Figure 1 EF). To evaluate the potential toxic effects of the three loading methods, CA1a cells were incubated with electroporated, Exo-Fect-transfected, and REG1-transfected RBCEVs for three days. CCK-8 analysis showed that electroporation and REG1 were not toxic to CA1a cells, while Exo-fect showed mild toxicity to cells after 24 h of incubation but not at later time points ( Figure 1 H). Overall, RBCEV treated with REG1 and Exo-Fect were comparable in terms of delivery. Both REG1 and Exo-Fect performed better than electroporation for loading RNA into RBCEV. Therefore, in subsequent experiments, Exo-Fect and REG1 were used as transfectants for RBCEV. To estimate the loading efficiency of transfectants, RBCEV were transfected with miR-125b ASO using Exo-Fect and REG1, and then lysed by detergent. The miR-125b ASO was separated by gel electrophoresis ( Figure 1 I). Based on the band fluorescence intensity, it was observed that approximately 94.2% and 86% of 125b-ASO were loaded into RBCEVs by Exo-Fect and REG1, respectively ( Figure 1 I). Of the two transfection methods, REG1 conferred a stronger inhibitory effect on miR-125b in CA1a cells, and the transfection efficiency was similar, as shown by dose-response assays ( Figure 1 J).

[0312] RBCEVs deliver immunomodulatory RNA to activate the RIG-I pathway and induce immunogenic cell death in cancer cells

[0313] A series of immRNA species are known in the art as potent RIG-I agonists in human skin dendritic cells and macrophages (Yong et al., 2019; Ho et al., 2019). Among the immRNA variants, 3p10LA9 showed the strongest cellular IFN production activity. To examine the effect of immRNA 3p10LA9 on breast cancer cells ( Figure 2 A), RBCEVs were transfected with immRNA using REG1, and the immRNA-loaded RBCEVs were incubated with highly metastatic mouse breast cancer 4T1 cells for 24 h. Scrambled RNA was used as a negative control (NC). qPCR analysis showed that the uptake of immRNA-loaded RBCEVs by 4T1 cells resulted in significant upregulation of cellular RLRs, Ddx58 (gene encoding RIG-I) and Mda5, as well as RLR downstream effectors including Irf3, Irf7, Ifnb, Rsad2 (Viperin), and Isg56, compared with NC-RNA-loaded RBCEVs ( Figure 2 B). The effect of immRNA was also evaluated in human triple-negative basal-like breast cancer (TNBC) CA1a cells, a progressively invasive and metastatic derivative of MCF10A cells, using the same dose of immRNA-loaded RBCEVs, resulting in a similar upregulation of RIG-I-related genes. Uptake of immRNA-loaded RBCEVs by CA1a cells significantly upregulated cellular levels of DDX58, MDA5, IRF3, IRF7, IFNB, RSAD2, and ISG56 ( Figure 2 C). Similarly, human TNBC MDA-MB-468 cells were highly responsive to immRNA-loaded RBCEVs, as indicated by substantial upregulation of DDX58, MDA5, IRF7, IFNB, RSAD2, and ISG56 ( Fig.12 A). However, immRNA-loaded RBCEVs did not induce RIG-I activation in human TNBC MDA-MB-231 cells ( Fig.12 B).

[0314] The delivery of immRNA to lung cancer cells was also tested. Human lung cancer NCI-H358 (H358) cells showed significant upregulation of DDX58, MDA5, MAVS, IRF7, IFNB, RSAD2, and ISG56 after incubation with immRNA-loaded RBCEVs ( Figure 2 D). RSAD2, known as an IFN-stimulated gene, was increased 305-fold, 518-fold, and 143-fold in all three cell lines, respectively ( Figure 2 BD and 12A).

[0315] To evaluate the effects of the immRNA on normal cells, non-transformed mammary epithelial MCF10A cells were incubated with immRNA-loaded RBCEVs, which resulted in a mild increase in DDX58 and RSAD2 levels in the cells, but not in the levels of other RIG-I-related genes ( Fig.12 C). Mouse lung epithelial (mLE) cells were also generated using a previously established protocol (Kasinski & Slack, 2013). The cell surface marker EpCAM ( Fig.11 C). Uptake of immRNA-loaded RBCEV by lung epithelial cells resulted in significant upregulation of Ddx58, Mda5, Irf7, Rsad2, and Isg56. Ifnb was undetectable in the cells, while Ifna4, Ifna11, and Ifna12 were significantly upregulated ( Fig.12 D).

[0316] To evaluate the activity of type I IFN production induced by immRNA, RBCEV loaded with immRNA were inoculated with human lung epithelial carcinoma A549-Dual TM and A549-Dual TM RIG-I - / - The cells were incubated together. The two cell lines secreted Lucia luciferase mediated by the interferon regulatory factor (IRF) pathway under the combined control of the ISG54 minimal promoter and five IFN-stimulated response elements. The results showed that wild-type (WT) A549-Dual TM Cells responded to this RIG-I activator as shown by increased luciferase activity after 24 and 48 hours ( Figure 2 E). Removal of the RIG-I gene from cells results in a complete abrogation of IFN signaling in response to immRNA ( Figure 2 E), confirming that RIG-I is the main immRNA sensor in cells. To evaluate the impact of immRNA on inflammatory responses, the concentrations of key inflammatory mediators were measured in 4T1 conditioned medium. 4T1 cells treated with immRNA-loaded RBCEVs secreted significantly higher levels of IFNα (~55.95 pg / mL) and IFNβ (~1844.33 pg / mL) ( Figure 2 F). In addition, immRNA-RBCEV taken up by 4T1 cells also induced the secretion of proinflammatory cytokines TNFα (~10.91 pg / mL) and IL-6 (~793.22 pg / mL) ( Figure 2 F).

[0317] The induction of immunogenic cell death in cancer cells treated with each EV was subsequently quantified using annexin V (ANXV) and propidium iodide (PI) staining. After 72 h of incubation, RBCEVs loaded with immRNA induced 4T1 cells (~15.9%) ( Figure 2 G and 12E), CA1a cells (~24.6%) ( Figure 2 H and 12E), H358 cells (~17.6%) ( Figure 2 I and 12E) and MDA-MB-468 cells (~16.0%) ( Fig.12 EF), as shown by the average percentage of the ANXV+PI+ population. RBCEVs loaded with immRNA failed to induce cell death in RIG-I-low MDA-MB-231 cells ( Fig.12 EF), indicating that RIG-I is an essential receptor for responding to immRNA. MCF10A cells and mLE cells did not undergo apoptosis after incubation with immRNA-loaded RBCEVs ( Fig.12 EF). These data suggest that immRNA-loaded RBCEVs activate the cellular RIG-I pathway, triggering type I IFN secretion and inducing cell death in cancer cells, while sparing non-malignant cells.

[0318] RBCEVs deliver bifunctional ASOs to simultaneously inhibit oncogenic miR-125b and activate the RIG-I pathway, leading to cell death in cancer cells

[0319] After confirming that 5' triphosphate immRNA can effectively trigger RIG-I activation, a combined approach incorporating both ASO-mediated oncogene silencing and RIG-I-mediated immune activation was tested. Figure 3 A). To increase the yield of 3p-125b-ASO, the first four nucleotides of the original 125b-ASO (full-length complementary to miR-125b) were removed and replaced with two guanine nucleotides. Several 3' end truncations were also tested. According to established protocols, the dsDNA template of the modified 125b-ASO sequence was inserted behind the T7 promoter for efficient in vitro transcription (IVT) (Luo et al., 2012; Yong et al., 2019). This resulted in a longer product ( Fig.13 A) The sequence of the IVT-produced 3p-125b-ASO was confirmed by sequencing.

[0320] To evaluate the functional impact of 3p-125b-ASO in cancer cells, 3p-125b-ASO was delivered using RBCEV. After incubating ASO-loaded RBCEV with cancer cells for 24 hours, the miR-125b silencing activity of IVT-generated 3p-125b-ASO was compared with that of unmodified miR-125ASO (125b-ASO) carrying a free 5'-OH group using qPCR. As a result, unmodified 125b-ASO and modified 3p-125b-ASO inhibited endogenous miR-125b levels to a similar extent in 4T1 cells, CA1a cells, and H358 cells ( Figure 3 B, D, F). Therefore, the silencing activity is not hampered by the presence of a 5'-terminal triphosphate group. RIG-I signaling in cancer cells in response to treatment with 3p-125b-ASO-loaded RBCEVs was then evaluated. Uptake of 3p-125b-ASO-loaded RBCEVs induced a significant upregulation of Ddx58, Mda5, Irf7, Ifnb, Rsad2, and Isg56 in 4T1 cells ( Figure 3 C); DDX58, MDA5, MAVS, IRF3, IRF7, IFNB, RSAD2, and ISG56 were significantly upregulated in CA1a cells ( Figure 3 E); Significant upregulation of DDX58, MDA5, MAVS, IRF7, IFNB, RSAD2, and ISG56 in H358 cells ( Figure 3 G). Silencing of miR-125b by unmodified 125b-ASO had no effect on RIG-I activation in the three cell lines ( Figure 3 C, E, G). Similar to RBCEVs loaded with immRNA, RBCEVs loaded with 3p-125b-ASO showed no effect on MDA-MB-231 cells, moderate effect on MCF10A cells, and up-regulated Ifna but not Ifnb in mLE cells via RIG-I activation ( Fig.13 BD).

[0321] To verify the type I IFN secretion activity induced by 3p-125b-ASO, A549-Dual TM and A549-Dual TM RIG-I - / - Cells were assayed with reporter substances in duplicate. TM RIG-I - / - Compared with A549-Dual cells, RIG-I stimulation by 3p-125b-ASO-loaded RBCEVs significantly induced TM Secretion of IFN in wild-type (WT) cells Figure 3 H). RIG-I knockout confirmed the key role of RIG-I in inducing IFN secretion. Similarly, cytokine immunoassay analysis showed that 4T1 cells that ingested RBCEV loaded with 3p-125b-ASO released significantly higher levels of IFNα (~25.42 pg / mL), IFNβ (~815.41 pg / mL), and TNFα (~8.23 pg / mL) ( Figure 3 I).

[0322] To examine the functional effects of 3p-125b-ASO on intrinsic apoptosis in cancer cells, cancer cells were incubated with 3p-125b-ASO-RBCEV for 72 h. 3p-125b-ASO-RBCEV treatment strongly induced 4T1 (~15.5%) ( Figure 3 J and 13E), CA1a (~21.7%) ( Figure 3 K and 13E) and H358 cells (~14.6%) ( Figure 3 L and 13E), similar to the effect of the original 125b-ASO. 3p-125b-ASO-RBCEV also induced cell death in MDA-MB-231 cells and produced moderate cytotoxicity to non-malignant cells, an effect attributed to the inhibition of miR-125b in cells ( Fig.13 EF). Notably, in both 4T1 and CA1a cells, combined treatment with immRNA-RBCEV and 3p-125b-ASORBCEV did not enhance the effects of each agent on RIG-I activation and apoptosis ( Fig.13 GH). In contrast, the combination of immRNA-RBCEV and 3p-125b-ASO-RBCEV resulted in lower activity of the RIG-I response pathway and less effect on apoptosis than either single substance treatment ( Fig.13 GH). Taken together, these data suggest that the bifunctional 3p-125b-ASO contains two distinct and independent functions that can simultaneously inhibit oncogenic miR-125b and activate RIG-I signaling, leading to immunogenic death of cancer cells.

[0323] Intratumoral delivery of immRNA inhibits breast cancer growth by triggering RIG-I-mediated immune response

[0324] To examine the antitumor activity of immRNA in vivo, 4T1 cells were implanted into the fourth mammary fat pad (MFP) of BALB / c mice ( Figure 4 A). Tumors were treated intratumorally with RBCEV containing immRNA or NC RNA every three days and tumor growth was monitored ( Figure 4 A). Treatment with immRNA-loaded RBCEVs was observed to significantly inhibit the growth of 4T1 tumors compared to NC-RNA-loaded RBCEVs ( Figure 4 B). On day 18, when the untreated tumors reached ~15 mm in diameter, the mice were sacrificed and the tumors were excised. qPCR analysis of dissociated tumor cells showed that the delivery of immRNA-loaded RBCEVs resulted in upregulation of Ddx58, Mda5, Mavs, Irf3, Irf7, Ifnb, Rsad2, and Isg56 in tumors ( Figure 4 C). To confirm the cytotoxic effect of immRNA-loaded RBCEVs on tumors, TUNEL staining was performed and tumor sections were co-stained with an antibody against alpha smooth muscle actin (αSMA) to mark cancer-associated fibroblasts, the most abundant cell type in the tumor stroma. Increased apoptosis was observed in tumors treated with immRNA-loaded RBCEVs compared to those treated with NC-RNA-loaded RBCEVs ( Figure 4 GH). In addition, TUNEL-positive cells were concentrated in the main tumor area rather than in the stromal area ( Figure 4 G). Interestingly, robust immune activation was observed in tumors treated with immRNA-RBCEVs compared to NC-RNA-loaded RBCEVs, as evidenced by increased infiltration of neutrophils (CD45+CD11b+Ly6G / C+), natural killer (NK) cells (CD45+CD11b+CD49b+), macrophages (CD45+CD11b+F4 / 80+), dendritic cells (DCs) (CD45+CD11c+), total T cells (CD45+CD3ε+), and CD8+ T cells (CD45+CD3ε+CD8+) ( Figure 4 D and 14A). In addition, serum IFN-β levels were measured at the endpoint. Intratumoral administration of immRNA-loaded RBCEVs slightly increased serum IFN-β levels in mice (~6.99 pg / mL) ( Figure 4 E). To further characterize the cytokine environment in tumors, qPCR of cytokine encoding genes was performed in dissociated tumor cells. The results showed that RBCEV loaded with immRNA significantly increased the mRNA levels of Ifna4, Ifna11 and Ifna12, as well as multiple pro-inflammatory cytokine genes (including Tnf, Il6, Il12b, Il2, Ifng, Il1b and Il18), while reducing the levels of anti-inflammatory cytokine genes (including Il4, Il5 and Tgfb1), indicating a shift in the immune response from Th2 to Th1 ( Figure 4 F).

[0325] 4T1 tumors were treated with 2.5 mg / kg immRNA-loaded RBCEV (intramu- lar (it)) and 2 mg / kg anti-PD-L1 monoclonal antibody (intraperitoneal (ip)) one day apart. Monotherapy with immRNA-loaded RBCEV or anti-PD-L1 antibody was used as control. The dose and frequency of anti-PD-L1 antibody treatment were implemented based on previous studies (Hong et al., 2019). 2 mg / kg of anti-PD-L1 is 34-fold lower than the clinical equivalent dose (Herbst et al., 2014). Surprisingly, 2 of 4 mice treated with anti-PD-L1 alone and 2 of 4 mice treated with immRNA RBCEV in combination with anti-PD-L1 were observed to die after three or five doses ( Fig.14 B). In contrast, all mice survived after five doses of immRNA-RBCEV monotherapy ( Fig.14 B). Serum IFNβ levels in surviving mice at endpoint suggest that anti-PD-L1 alone triggers cytokine release syndrome, which appears to be alleviated when anti-PD-L1 is combined with immRNA-RBCEV, although the endpoint-related mortality rate is the same as that caused by anti-PD-L1 monotherapy ( Fig.14 D). Combination treatment and anti-PD-L1 treatment alone did not have a better tumor inhibitory effect compared with immRNA-RBCEV monotherapy ( Fig.14 C). Therefore, these data suggest that immRNA-loaded RBCEVs are safe and sufficiently effective as a single-agent immunotherapy for breast cancer treatment.

[0326] As a human breast cancer model, CA1a cells were implanted into the fourth MFP of immunocompromised NSG-SGM3 mice ( Figure 4 I). Similarly, tumors were treated intratumorally with RBCEV loaded with immRNA every three days and tumor size was measured ( Figure 4 I). Treatment with immRNA-loaded RBCEVs significantly inhibited the growth of CA1a tumors ( Figure 4 J). qPCR results showed that the RIG-I cascade (including DDX58, MDA5, MAVS, IRF3, IRF7, IFNB, RSAD2, and ISG56) was upregulated in tumors after immRNA-RBCEV treatment ( Figure 4 K). Furthermore, immRNA-RBCEV treatment was associated with enhanced infiltration of neutrophils, macrophages, and dendritic cells in tumors ( Figure 4 L and 14E). The same experimental setup was performed in the MDA-MB-468 tumor model in nude mice, with 4 mice per group. Treatment with immRNA-loaded RBCEV resulted in rapid and extensive shrinkage of MDA-MB-468 tumors ( Fig.14 F), one of the tumors was eliminated. A limited number of tumor cells were analyzed for RIG-I activation by qPCR. The results showed that immRNA-loaded RBCEV treatment activated the RIG-I pathway by upregulating DDX58, MDA5, RSAD2, MAVS, IRF3, IRF7, IFNB, and ISG56 in tumor cells ( Fig.14 G). Taken together, these data suggest that intratumoral administration of immRNA-RBCEV suppresses both orthotopic and xenograft breast cancer by activating the RIG-I pathway and recruiting immune cells, triggering an antitumor response.

[0327] Intratumoral delivery of bifunctional ASO inhibits breast cancer growth by triggering apoptosis and RIG-I-mediated immune response

[0328] Next, the antitumor efficacy of 3p-125b-ASO was tested in vivo in the 4T1 cancer model. 4T1 cells were implanted into the 4th MFP of BALB / c mice ( Figure 5 A). 4T1 tumors were treated with 5 mg / kg 3p-125b-ASO-loaded RBCEV every three days and monitored every two days ( Figure 5 A). When untreated tumors reached ~15 mm in diameter, mice were sacrificed and tumors were harvested. Similar to immRNA treatment, significant inhibition of 4T1 tumor growth was observed with 3p-125b-ASO delivered using RBCEV ( Figure 5 B). qPCR analysis of dissociated tumor cells clearly showed that miR-125b levels were decreased, while Ddx58, Mda5, Mavs, Irf3, Irf7, Ifnb, Rsad2, and Isg56 levels were increased in tumors treated with 3p-125b-ASO-loaded RBCEVs compared to NC-RNA-loaded RBCEVs ( Figure 5 In addition, FACS analysis showed that the number of tumor-infiltrating neutrophils, NK cells, macrophages, dendritic cells, total T cells, and CD8+ T cells were increased in tumors treated with 3p-125b-ASO-loaded RBCEVs compared with NC-RNA-loaded RBCEVs ( Figure 5 E and 15). Since low systemic IFNβ levels were detected by ELISA in tumor-bearing mice receiving intratumoral administration of immRNA-RBCEV, cytokine immunoassays were performed in tumor lysates to increase the sensitivity of detecting the lowest concentration of cytokines. The data showed that elevated levels of IFNα (~25.62 pg / mL), IFNβ (~38.71 pg / mL), TNFα (~72.64 pg / mL), IL-6 (~139.26 pg / mL), IL-12p40 (~100.78 pg / mL), and IL-10 (~23.06 pg / mL) were detected in tumors treated with RBCEV loaded with 3p-125b-ASO compared to controls ( Figure 5 F). The IL-12 / IL-10 ratio increased significantly after treatment with 3p-125b-ASO-loaded RBCEVs ( Figure 5 F), indicating a pro-inflammatory tumor microenvironment. Additional qPCR analysis of tumor cells showed a significant increase in Il2, Ifng, Il1b, and Il18, while a significant decrease in Il4, Il5, and Tgfb1 ( Figure 5 G), indicating a Th1-dominated immune response. Indeed, 3p-125b-ASO-loaded RBCEVs significantly induced apoptosis, with TUNEL-positive cells concentrated within the tumor bulk but not in the stroma, as determined by TUNEL staining of tumor sections, suggesting that miR-125b knockdown and RIG-I activation contribute to 3p-125b-ASO-mediated tumoricidal activity ( Figure 5 Together, these data provide evidence that both miR-125b inhibition and RIG-I-mediated activation enhance the antitumor efficacy of 3p-125b-ASO in an orthotopic breast cancer model.

[0329] Conjugation of RBCEV with EGFR-binding nanobodies promotes specific delivery of immRNA to metastatic EGFR-positive breast cancer cells

[0330] Specific targeting of cancer cells is a crucial feature of EV-based drug delivery as it enhances efficacy while protecting normal cells from toxicity. EGFR is known to be a proto-oncogene in multiple types of cancer and is considered a common cancer biomarker. Mouse breast cancer 4T1 cells were transduced with a lentivirus carrying a human EGFR expression vector. A method for functionalizing the RBCEV surface was previously developed using OaAEP1 ligase to link a peptide with a ligase binding motif (NGL) at the C-terminus to the RBCEV surface (Pham et al., 2021). In this study, the enzymatic ligation method was combined with a streptavidin-biotin conjugation method to conjugate RBCEVs to nanobodies via a linker peptide ( Figure 6 A). Specifically, RBCEV was enzymatically linked with a biotinylated linker peptide (biotin-TRNGL), which was sequentially conjugated with tetrameric streptavidin and biotinylated anti-EGFR nanobody (α-EGFR-VHH) ( Figure 6 A). Flow cytometry analysis showed that α-EGFR-VHH specifically bound to cells expressing human EGFR (CA1a, H358, and 4T1-hEGFR cells), but not to 4T1 cells expressing mouse EGFR ( Fig.11 C). To evaluate the specificity of EGFR-targeted RBCEVs for EGFR-expressing cancer cells, EGFR-VHH-coated RBCEVs were labeled with CFSE and incubated with 4T1 cells expressing human EGFR (4T1-hEGFR) and parental 4T1 cells at suboptimal doses for 2 h. Anti-mCherry nanobody was used as a negative control (Ctrl-VHH). The CFSE fluorescence intensity in 4T1-hEGFR cells treated with EGFR-targeted CFSE-labeled RBCEVs was ~28.6 times higher than that in 4T1-hEGFR cells treated with non-targeted CFSE-labeled RBCEVs ( Figure 6 B). The uptake level of non-targeted CFSE-labeled RBCEV by 4T1-hEGFR cells was similar to the uptake level of non-targeted and EGFR-targeted CFSE-labeled RBCEV by 4T1 cells ( Figure 6 B). Specific uptake of EGFR-targeted RBCEV carrying fluorescent RNA was observed in 4T1-hEGFR cells. FAM fluorescence intensity was consistently significantly higher in hEGFR-positive 4T1 cells treated with EGFR-VHH-coated FAM-ASO-loaded RBCEVs compared to parental 4T1 cells treated with EGFR-VHH-coated FAM-ASO-loaded RBCEVs and 4T1-hEGFR cells treated with non-targeted FAM-ASO-loaded RBCEVs ( Figure 6 C). To verify whether EGFR-targeted RBCEVs delivered functional RNA specifically to 4T1-hEGFR cells, EGFR-VHH-coated RBCEVs were loaded with immRNA. EGFR-VHH-coated immRNA-loaded RBCEVs exhibited higher functional uptake by 4T1-hEGFR cells compared to 4T1 cells, as demonstrated by a significant increase in cellular Ddx58, Rsad2, and Ifnb expression ( Figure 6 D and 16A).

[0331] To generate a lung metastatic breast cancer model, 4T1-hEGFR cells were injected intravenously into the tail vein of BALB / c mice ( Figure 6 E). Seven days later, non-targeted and EGFR-targeted CFSE-labeled RBCEVs were delivered to mice with metastatic breast cancer by intrapulmonary administration. CFSE-labeled RBCEVs were extensively washed using size exclusion chromatography and centrifugation. The effluent from the last wash was used as a negative control. 24 hours after intrapulmonary delivery, the biodistribution of non-targeted and EGFR-targeted CFSE-labeled RBCEVs in the lung was analyzed using flow cytometry. Intrapulmonary delivery of EGFR-targeted and non-targeted RBCEVs was consistent, as shown by the similar percentage of CFSE-positive cells (~16%) in homogenized whole lung cells ( Figure 6 F and 16B). Conjugation of RBCEV with EGFR nanobody increased the percentage of CFSE-positive tumor cells to ∼68% ( Figure 6 F and 16B). No significant changes were observed in alveolar macrophages, which are located in the airway lumen and consistently take up EVs at a high rate ( Figure 6 F and 16B). In addition, a significant decrease in the percentage of CFSE-positive neutrophils and a mild decrease in the percentage of CFSE-positive interstitial macrophages were observed in the lungs of mice treated with EGFR-targeted RBCEV ( Figure 6 F and 16B). This can be attributed to the preferential uptake of hEGFR-specific RBCEVs by hEGFR-positive tumor cells compared to hEGFR-negative cells in the lung parenchyma. These data suggest that EGFR nanobody conjugation can drive RBCEVs to specifically target EGFR-positive metastatic breast cancer cells in vivo.

[0332] Intrapulmonary delivery of immRNA targeting EGFR using RBCEVs inhibits breast cancer metastasis in the lung

[0333] To treat metastatic breast cancer in the lung, multiple doses of immRNA-loaded RBCEVs targeting EGFR were delivered via intrapulmonary administration every other day. Figure 7 A). After 5 treatments, mice were sacrificed and lungs were removed for subsequent analysis. As expected, non-targeted and EGFR-targeted immRNA-loaded RBCEVs inhibited the implantation of metastatic tumor cells, as shown by a decrease in the percentage of hEGFR-positive cells in the lungs ( Figure 7 B, C and 17A). In particular, RBCEVs loaded with immRNA targeting EGFR inhibited tumor growth in the lung, an effect attributed to the increase in apoptosis in this treatment. H&E staining of lung sections showed that the area of ​​lung metastasis was significantly lower in mice treated with RBCEVs loaded with immRNA targeting EGFR ( Figure 7 DE). qPCR analysis of whole lung lysates revealed that immRNA-loaded RBCEVs triggered RIG-I cascade activation by upregulating Ddx58, Mda5, Rsad2, Irf7, Ifnb, and Isg56. Although RLR genes were not significantly increased, Ifnb and IFN-stimulated genes Isg56 and Rsad2 were significantly increased after EGFR-targeted RBCEV treatment compared to non-targeted RBCEV treatment ( Figure 7 F). According to FACS analysis, increased infiltration of neutrophils, NK cells, interstitial macrophages, cDCs, and T cells (including CD8+ T cells but not CD4+ T cells) was observed in the lungs of mice treated with immRNA-loaded RBCEVs ( Figure 7 G and 17A). EGFR-targeted RBCEV further increased the number of infiltrating neutrophils, interstitial macrophages, cDCs, T cells, and CD8+ T cells ( Figure 7 G and 17A). Alveolar macrophages were nearly eliminated from the airways of mice treated with control and EGFR-targeting immRNA-containing RBCEVs ( Figure 7 G and 17A). TUNEL staining of lung sections further confirmed that treatment with EGFR-targeted immRNA-loaded RBCEVs increased apoptosis in the lungs compared with non-targeted immRNA-loaded RBCEVs ( Figure 7 HI). To explore whether the inflammatory state of the mouse airway affects metastasis, the concentration of cytokines in lung homogenates was detected. All tested cytokines were significantly increased in the lungs of mice treated with EGFR-targeted and non-targeted immRNA-loaded RBCEVs compared to control mice ( Figure 7 J). Compared with mice receiving non-targeted immRNA-loaded RBCEVs, mice receiving EGFR-targeted immRNA-loaded RBCEVs showed even higher levels of IFNα (~17.97 pg / mL), IFNβ (~22.47 pg / mL), TNFα (~312.86 pg / mL), IL-12p40 (~72.73 pg / mL), IL-10 (~16.91 pg / mL), and IL-12 / IL-10 ratio, while IL-6 levels did not differ significantly ( Figure 7 J). qPCR analysis of lung lysates showed that immRNA-loaded RBCEVs increased the mRNA levels of Il2, Ifng, Il1b, and Il18, while decreasing the levels of Il4, Il5, and Tgfb1 ( Fig.17 B), indicating Th1-dominated immunity in the lung. Compared with non-targeted RBCEV, EGFR-targeted RBCEV further enhanced the expression of Il2 and Ifng, and decreased the expression of Tgfb1 ( Fig.17 B). Taken together, these data suggest that EGFR-targeted RBCEVs enhance the specificity of delivery to EGFR-positive cancer cells, leading to improved immRNA efficacy in vivo.

[0334] RBCEVs loaded with immRNA targeting EGFR induce DC activation, promote M1 macrophage polarization, and enhance tumor-specific CD8+ T cell activity

[0335] To evaluate the ability of EGFR-targeted immRNA-loaded RBCEVs to induce DC activation and modulate macrophage polarization in the lung, flow cytometry was used to determine the expression of DC activation markers and macrophage M1 / M2 markers. The data showed that non-targeted and EGFR-targeted immRNA-loaded RBCEV treatment increased the percentage of MHCII+CD11c+DCs in CD45+ cells ( Figure 8 AB). Compared with non-targeted immRNA-loaded RBCEV treatment, EGFR-targeted immRNA-loaded RBCEV treatment further increased the percentage of MHCII+CD11c+DCs ( Figure 8 AB). In addition, treatment of immRNA-loaded RBCEVs resulted in a lower percentage of CD206+F4 / 80+M2-like macrophages and a higher percentage of CD86+F4 / 80+M1-like macrophages among CD11b+CD45+ cells ( Figure 8 AB). Compared with non-targeted immRNA-loaded RBCEV treatment, the M1 / M2 ratio was significantly increased after treatment with EGFR-targeted immRNA-loaded RBCEV ( Figure 8 B). To quantify the activity of CD8+ tumor-infiltrating lymphocytes (TILs) against tumor-associated antigens, CD8+ TILs were isolated from the lungs for cytotoxicity analysis. The results showed that CD69 and granzyme B levels in CD8+ TILs were significantly increased after treatment with immRNA-loaded RBCEVs ( Figure 8 CD). Given that tumor-specific immune responses are a key factor in cancer immunotherapy, tumor-specific T cell responses were evaluated. CD8+ TILs were incubated with 4T1-hEGFR-luciferase cells at a ratio of 50:1 for 48 hours. Re-stimulation of CD8+ TILs isolated from mice treated with immRNA-loaded RBCEVs with tumor antigens significantly enhanced IFNγ production, which was associated with a significant increase in cytotoxic T lymphocyte (CTL) activity ( Figure 8 EF). RBCEVs loaded with immRNA targeting EGFR further enhanced the cytotoxicity of CD8+ TILs, as demonstrated by increased cellular expression of CD69 and granzyme B, secretion of IFNγ, and CTL activity ( Figure 8 CF). In summary, these data correlate with increased expression of Th1 cytokines and decreased expression of Th2 cytokines in the lungs of mice treated with immRNA-RBCEV targeting EGFR ( Figure 7 J and 17B), indicating Th1-related and CTL-mediated antitumor immune responses.

[0336] Specific knockdown of mutant KRAS and EGFR in multiple types of cancer using RBCEV-delivered ASOs

[0337] Cancer cells induce multiple genetic alterations to support tumor progression by providing survival and proliferation advantages and forming a weakly immunogenic tumor microenvironment (TME). The most common oncogenic driver in cancer is the KRAS activating mutation, which is found in ~30% of lung and colorectal cancer patients and almost 100% of pancreatic cancer patients. Most KRAS mutant cancer cells carry mismatch mutations at glycine 12 (G12). Although ARS1620 (a small molecule drug) was recently invented as an effective inhibitor of KRAS-G12C, it is not applicable to other KRAS mutants or even other G12 mismatches. In this paper, RBCEVs were used to deliver ASO drugs targeting oncogenic driver genes (including KRAS G12D, KRAS G12V, EGFR L858R, and EGFR T790M), in which the combination of ASO and immRNA targeting oncogenes achieved excellent anti-cancer effects.

[0338] The ASO was designed using the Gapmer approach. Both ends of the ASO were chemically modified with locked nucleic acids (LNA) and the nucleotides were matched to the missense mutation to improve specificity. In addition, phosphorothioate (PS) modifications were included in each nucleotide, and 2'-O-methoxyethyl (2'MOE) modifications were added to the five nucleotides of each wing to increase the stability of the ASO ( Fig. 9 A and 18A). Cancer cell lines A427 (KRAS G12D), AsPC-1 (KRAS G12D), and H441 (KRASG12V) carrying KRAS mutants were used to examine the specific knockdown of RBCEVs by the corresponding ASO-loaded cells. H1975 and DU145 cells with WT KRAS genes were used as control cell lines. Western blot and qPCR analysis revealed that KRAS G12D ASO 2 and KRAS G12V ASO 2 showed significant knockdown effects on the corresponding mutant genes in A427, AsPC-1, and H441 cells, respectively, resulting in a significant decrease in the viability of cells with mutants as determined by CCK-8 assay, while minimizing cross-reactions in H1975 and DU145 cells with WT genes ( Fig. 9 BI).

[0339] Similarly, in H1975 cells carrying EGFR L858R and T790M mutations, the specific knockdown of these two mutations by ASOs delivered by RBCEV was examined. A549 cells carrying WT EGFR were used as a control cell line ( Fig.18 A). Fig.18 BG shows that EGFR L858R ASO4 and T790M ASO4 specifically inhibited EGFR protein expression in target cells, while showing limited effects on EGFR WT in A549 control cells. Based on these data, KRAS G12D ASO 2, KRASG12V ASO 2, EGFR L858R ASO 4, and EGFR T790M ASO 4 were selected for further examination.

[0340] Combination of oncogene addiction-targeting ASO and immRNA synergistically enhances RIG-I pathway activation in cancer cells

[0341] The anticancer efficacy of the combined regimen of oncogene addiction inhibition and RIG-I activation was investigated by co-delivering ASO and immRNA to a variety of mutant-carrying cancer cell lines, including A427 (KRAS G12D) lung cancer cells, CT26 (Kras G12D) colorectal cancer cells, AsPC-1 (KRAS G12D) pancreatic cancer cells, H441 (KRAS G12V) lung cancer cells, and H1975 (EGFR L858R / T790M) lung cancer cells, using the RBCEV and LNP platforms. The expression levels of DDX58 and IFN-β in treated cells were first quantified using qPCR. Notably, cells treated with immRNA in combination with KRAS ASO or EGFR ASO showed the highest expression of DDX58 and IFN-β than cells receiving single treatment ( Fig.19 AD). Next, the viability of cancer cells after various treatments with RBCEV preparations was determined by CCK-8 assay ( Fig.19 EH), and the results showed that this combination exerted significantly enhanced cytotoxicity against pancreatic AsPC-1 cells expressing KRAS G12D ( Fig.19 G). Similar observations were found when AsPC-1 cells were treated with ASO and immRNA delivered via LNPs ( Fig.19 IJ).

[0342] Next, activation of THP-1 monocytes co-cultured with pretreated AsPC-1 cells was examined ( Fig.19 K). Flow cytometry analysis revealed that AsPC-1 cells pretreated with KRAS ASO and immRNA expressed elevated levels of CD86, an activation marker for monocytic THP-1 cells ( Fig.19 L).

[0343] RBCEVs delivered with EGFR ASO effectively inhibit lung tumor growth

[0344] To investigate the therapeutic potential of mutant-specific ASOs in vivo, H1975 tumor cell xenograft mice were generated by intravenous injection. EGFR L858R ASOs were loaded onto EVs and delivered intratracheally into tumor-bearing mice every 3 days ( Fig. 20 A). Notably, EVs loaded with EGFR L858R ASO showed a significant tumor suppressive effect, as indicated by significantly lower luciferase signal than mice receiving EVs loaded with NC ASO ( Fig. 20 BC). By immunohistochemistry (IHC) staining, it was observed that the EGFR level in the L858R ASO-EV treated group was significantly decreased compared with that in mice treated with EVs loaded with NC ASO (EV-NC ASO) ( Fig. 20 D).

[0345] The combination of RBCEV-mediated immRNA and ASO targeting oncogenes exhibits potent anticancer effects in vivo

[0346] A syngeneic CT26 colorectal cancer mouse model with the KRAS G12D mutation was generated by subcutaneously (sc) inoculating CT26 colorectal cancer cells into BALB / c mice. RBCEVs loaded with KRAS ASO, immRNA, or a combination of KRAS ASO and immRNA were injected into the tumor every two days. It was observed that the combination of KRAS G12D ASO and immRNA exhibited excellent tumor inhibitory effects, which were reflected by tumor volume reduction ( Fig.21 A) and tumor weight reduction ( Fig.21 In addition, H&E staining ( Fig.21 C) and TUNEL assay ( Fig.21 D) It was also observed that tumor cell density decreased and necrotic areas were formed in tumors collected from mice receiving the combination treatment. These results suggest the potential of a combination regimen of KRAS-inhibiting ASOs and RIG-I activation using the RBCEV platform for KRAS-driven cancers.

[0347] In summary, a robust platform for localized and targeted delivery of immunomodulatory RIG-I agonists using RBCEVs was demonstrated. Treatment of orthotopic and metastatic breast cancer with RBCEVs loaded with immRNA and 3p-125b-ASO achieved activation of RIG-I signaling, resulting in a three-pronged attack: (i) strong tumor growth inhibition; (ii) enhanced levels of type I IFN and proinflammatory cytokines; and (iii) IFN-mediated recruitment of innate immune cells (macrophages, neutrophils, NK cells), dendritic cell activation and M1 macrophage polarization, as well as cross-priming of adaptive immune effectors (CD8+ T cells) via antigen-presenting cells (dendritic cells and macrophages) ( Fig.10 ), indicating that the immunosuppressive tumor microenvironment is reversed. Polarization of Th1 / Th2 immune factors promotes anti-tumor immunity. Th1 cytokines, such as IL-1β, IL-2, IL-12, IL-18, TNFα and IFNγ, are associated with pro-inflammation, while Th2 cytokines, such as IL-4, IL-5 and TGFβ, play an inhibitory role in the tumor immune microenvironment. The data show that RBCEVs loaded with immRNA and 3p-125b-ASO change the Th1 / Th2 balance in the tumor microenvironment, making Th1 dominant, thereby contributing to tumor suppression. Effective cancer immunotherapy requires T cell priming, activation and tumor infiltration. Therefore, intratumoral delivery of RBCEVs loaded with immRNA and 3p-125b-ASO induced massive cell apoptosis in the tumor body, while the tumor stroma showed no signs of apoptosis.

[0348] RBCEV loaded with immRNA was combined with anti-PD-L1 to enhance anti-tumor activity. However, a mortality rate of ~50% was observed in tumor-bearing mice that received repeated doses of systemic anti-PD-L1 administration. Mouse deaths may be due to hypersensitivity reactions caused by anti-PD-L1. These findings highlight the previously uncharacterized adverse toxicity of anti-PD-L1, which has not been reported in previous studies of RIG-I agonists and anti-PD-L1 combinations. In fact, multiple clinical studies have demonstrated that anti-PDL1 as a single therapy greatly induces systemic IFNβ release and cytokine storm. Systemic administration of RIG-I agonists may also trigger cytokine release syndrome, and based on the data disclosed herein, local administration of immRNA is safe and sufficiently effective.

[0349] Combination approaches have been demonstrated to simultaneously inhibit oncogenic miR-125b and activate the RIG-I pathway. Due to their genetic and epigenetic plasticity, tumor cells tend to evade single targeted therapies, such as specific kinase / oncogene inhibitors or immunotherapy. Therefore, multi-target therapies are needed. 3p-125b-ASO offers advantages over combinations of multiple single-target therapies. It is small and easy to synthesize. It contains two different and independent properties of RIG-I activator and oncogene inhibitor. In addition, RIG-I-induced cancer cell apoptosis is synergistic with apoptosis induced by ASO-mediated miR-125b inhibition. This bifunctional ASO can be adapted to different tumor entities by targeting key oncogenes that drive tumorigenicity. In addition, synergistic anticancer effects were observed when targeting both KRAS-G12D mutants and the RIG-I pathway in pancreatic cancer, at least in vitro. These results suggest the potential of immRNA to inflame the poorly immunogenic "cold" state of pancreatic tumors, which is largely caused by KRAS mutations. Together, these data suggest the potential of immRNA, 3p-125b-ASO, and KRAS-G12D ASO for clinical application.

[0350] The biosafety and reproducibility of drug delivery systems are crucial for their clinical translation. In vivo-jetPEI is the delivery system widely used for RIG-I agonists and other types of RNA therapeutics in preclinical and clinical studies to date. However, it has been reported to be associated with fatal hepatotoxicity in mice. Due to its biocompatibility, stability and limited immunogenicity, EVs as delivery systems offer multiple advantages over traditional synthetic delivery vehicles. RBCEVs are highly available and scalable, and have no risk of horizontal gene transfer. They have been shown to be biosafe, efficient, and can be modified for therapeutic delivery in cancer treatment. Using RBCEVs as a delivery vehicle for RIG-I agonists, effective immunomodulation of the tumor microenvironment as well as potent antitumor activity were achieved without any observable side effects, indicating the advantages of RBCEVs for clinical applications.

[0351] Also described is a method for functionalizing the surface of RBCEVs with nanobodies targeting EGFR, which can enhance the delivery of RIG-I agonists to EGFR-positive cancer cells, thereby improving efficacy and reducing side effects. In the experiment, depletion of alveolar macrophages in the respiratory tract was observed after intrapulmonary delivery of non-targeted and EGFR-targeted RBCEVs containing immRNA. According to the biodistribution data of RBCEVs delivered intrapulmonary, alveolar macrophages are the main receptors for non-targeted and EGFR-targeted RBCEVs. Obviously, RBCEV itself has no effect on alveolar macrophages, because CFSE-labeled or NC-RNA-loaded RBCEVs do not cause rapid death of these cells. Alveolar macrophages play an important role in clearing antigens in the lungs through nonspecific phagocytosis. The depletion of alveolar macrophages may be due to the effect of RIG-I-mediated immune responses caused by engulfed RBCEVs containing immRNA. Therefore, this article describes the delivery of therapeutic RNA mediated by EVs administered intrapulmonary. The data show that RNA-loaded RBCEVs are stable and can penetrate deeply into the lung parenchyma to deliver immRNA. The compositions described herein can be used for therapeutic RNA delivery, not only for cancer metastasis, but also for other lung diseases (e.g., influenza and asthma).

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359] References

[0360] Ho,V.,Yong,H.Y.,Chevrier,M.,Narang,V.,Lum,J.,Toh,Y.-X.,Lee,B.,Chen,J.,Tan,E.Y.,Luo,D.,&Fink,K.(2019).RIG-I activation by a designer short RNAligand protects human immune cells against dengue virus infection withouteausing cytotoxicity.Journal of Virology93,e00102-e00119.

[0361] Kasinski,A.L.,&Slack,F.J.(2013).Generation of mouse lung epithelalcells.Bio Protocol 3,e837.

[0362] Luo,D.,Kohlway,A.,Vela,A.,&Pyle,A.M.(2012).Visualizing thedeterminants of viral RNA recognition by innate immunc sensor RIG-I.Structure20,1983-1988.

[0363] Pham,C.T.,Jayasinghe,M.K.,Pham,T.T.,Yan,Y.,Wei,L.,Usman,W.M.,Chen,H.,Pirisinu,M.,Gong,J.,Kim.S.,Peng,B.,Wang,W.,Chan,C.,Ma,V.,Nguyen,N.T.H.,Kappi,D.,Nguyen,X.-H.,Cho,W.C.,Shi,J.,&Le,M.T.N.(2021).Covalent conjugation ofextracellular vesicles with peptides with nanobodies for targeted therapeuticdelivery.Journal of Extracellular Vesicles 10,e12057.

[0364] Usman,W.M.,Pham,T.C.,Kwok,Y.Y.,Vu,L.T.,Ma,V.,Peng,B.,Chan,Y.S.,Wei,L.,Chin,S.M.,Azad,A.,He,A.B.-L.,Leung,A.Y.H.,Yang,M.,Shyh-Chang,N.,Cho,W.C.,Shi,J.,&Le,M.T.N.(2018).Efficient RNA drug delivery using red blood cellextracellular Vesicles.Nature Communications 9,2359.

[0365] Yong,H.Y.,Zheng,J.,Ho,V.C.Y.,Nguyen,M.T.,Fink,K.,Griffin,P.R.,&Luo,D.(2019).Structure-guided design of immunomodulatory RNAs specificallytargeting the cytoplasmic viral RNA sensor RIG-I.FEBS Letters 593,3003-3014. < / scid>

Claims

1. A composition comprising a vesicle for delivering a retinoic acid inducible gene I receptor (RIG-I) agonist to a cell.

2. The composition of claim 1, wherein the RIG-I agonist is selected from the group consisting of immunomodulatory RNA (immRNA), antisense oligonucleotides (ASO), small interfering RNA (siRNA), and combinations thereof.

3. The composition of claim 2, wherein the RIG-I agonist comprises an immunomodulatory RNA (immRNA) and / or an antisense oligonucleotide (ASO). 4 . The composition according to claim 2 or 3 , wherein the immunomodulatory RNA (immRNA) comprises the sequence 5′-GGAUUUCCACCUUCGGGGGAAAUCC-3′ (SEQ ID NO: 1).

5. according to the composition described in any one of claims 2-4, wherein said immunomodulatory RNA (immRNA) further comprises modification at 5' and / or 3' end, optionally wherein said modification is selected from the group consisting of 5' triphosphate cap, phosphorylation, methylation, adenylation and combination thereof.

6. The composition according to claim 2 or 3, wherein the antisense oligonucleotide (ASO) comprises miRNA-125b-ASO, KRAS-ASO or EGFR targeting ASO.

7. The composition of claim 6, wherein the miRNA-125b-ASO comprises the sequence 5'-GGAAGUUAGGGUCUCAGGCCCUAACUUCC-3' (SEQ ID NO: 2).

8. The composition of claim 6, wherein the KRAS-ASO is selected from the group consisting of KRAS-G12D ASO, KRAS-G12VASO, KRAS-G12C ASO and KRAS-G12SASO, optionally wherein the KRAS-G12D ASO comprises any one of the following sequences or wherein the KRAS-G12V ASO comprises any one of the following sequences 9. The composition according to claim 6, wherein the EGFR targeting ASO is selected from the group consisting of EGFR L858R targeting ASO or EGFR T790M targeting ASO, optionally wherein the EGFR L858R targeting ASO comprises any one of the following sequences or wherein the EGFR T790M targeting ASO comprises any one of the following sequences 10. The composition according to any one of claims 6-9, wherein the antisense oligonucleotide (ASO) further comprises a modification at the 5' and / or 3' end.

11. The composition of claim 10, wherein the modification is selected from the group consisting of a 5' triphosphate cap, phosphorylation, methylation, adenylation, locked nucleic acid, phosphorothioate, 2-methoxyethyl, and combinations thereof.

12. The composition of any one of claims 1-11, wherein the vesicle for delivering the retinoic acid inducible gene I receptor (RIG-I) agonist to cells comprises an extracellular vesicle or a lipid nanoparticle.

13. The composition of claim 12, wherein the extracellular vesicles are selected from the group consisting of erythrocyte-derived extracellular vesicles (RBCEVs), milk-derived EVs, plasmid-derived EVs, and cancer cell-derived EVs.

14. The composition of claim 13, wherein the extracellular vesicles are further conjugated to an antibody, optionally wherein the antibody is selected from the group consisting of a nanobody, a monoclonal antibody and a single chain antibody.

15. The composition of claim 14, wherein the antibody is a Nanobody that binds to a cancer marker, optionally wherein the cancer marker is selected from the group consisting of epidermal growth factor receptor (EGFR), HER1, HER2, HER3, human growth factor (HGF), CXCR4, PD-L1, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, ITGA7, ITGA8, ITGA9, ITGA10, ITGA11, CD11D, CD103, CD11a, CD11b, CD51, CD41, CD11c, CD29, CD18, CD61, CD104, ITGB5, ITGB6, ITGB, ITGB8, FOLR1, FOLR2 or FOLR3.

16. A composition comprising: - Red blood cell-derived extracellular vesicles (RBCEVs); - an immunomodulatory RNA (immRNA) comprising or consisting of 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1), wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or - an antisense oligonucleotide (ASO) comprising or consisting of 5'-GGAAGUUAGGGUCUCAGGCCCUAACUUCC-3' (SEQ ID NO: 2), wherein the antisense oligonucleotide (ASO) further comprises a 5' triphosphate cap.

17. A composition comprising: - lipid nanoparticles; - an immunomodulatory RNA (immRNA) comprising 5'-GGAUUUCCACCUUCGGGGGAAAUCC-3' (SEQ ID NO: 1), wherein the immunomodulatory RNA (immRNA) further comprises a 5' triphosphate cap; and / or -KRAS-ASO.

18. A method of delivering a retinoic acid inducible gene I receptor (RIG-I) agonist into a cell, comprising administering to the cell a pharmaceutically effective amount of the composition of any one of claims 1 to 17.

19. A method for treating a disease, comprising administering a pharmaceutically effective amount of the composition of any one of claims 1 to 17 to a subject in need thereof.

20. The method of claim 19, wherein the disease is cancer, or a lung disease or disorder.

21. The method of claim 20, wherein the cancer is selected from the group consisting of breast cancer, lung cancer, pancreatic cancer, brain cancer, head and neck cancer, liver cancer, stomach cancer, colon cancer, prostate cancer, cervical cancer, and bone cancer.

22. The method of claim 21, wherein the method further comprises administering a pharmaceutically effective amount of an anti-cancer drug.

23. The method of claim 22, wherein the anti-cancer drug is selected from the group consisting of anti-PD1 antibodies, one or more anti-oncogene ASOs, and one or more anti-cancer cell factors.

24. The method of claim 20, wherein the pulmonary disease or disorder is asthma or pneumonia.

Images