Method for mutation breeding of a bacillus velezensis protease for feed use and application

Abstract

The application discloses a bacillus velezensis serine protease variant and application thereof. The serine protease variant is obtained by sequentially mutating a plurality of amino acid residues in a parent serine protease amino acid sequence, and still maintains the ability of the parent serine protease to hydrolyze a peptide bond; the amino acid sequence homology of the two reaches more than 95%. The serine protease variant provided by the application has higher catalytic activity after being incubated for 4 hours under an acid condition of pH 2-5 and for 12 hours under an acid condition of pH 2.2. The serine protease mutant provided by the application has better in-vitro enzymolysis effect on piglet feed than the original protease under the conditions of pH 2.2, a temperature of 40 DEG C, different enzyme addition amounts, different enzymolysis time and different solid-liquid ratios. The serine protease mutant provided by the application has good acid resistance, heat stability and excellent feed enzymolysis effect. When the enzyme addition amount is 400 U, the enzymolysis time is 4 hours, and the solid-liquid ratio is 0.7 g / mL, the enzymolysis benefit of the mutant enzyme is higher than that of other groups.

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering and relates to serine protease variants. Background Technology

[0002] Serine proteases are commonly used proteases in animal feed. They belong to a family of proteases whose function is to break peptide bonds in large proteins, breaking them down into smaller proteins. In mammals, serine proteases play a crucial role, particularly in digestion, blood clotting, and the complement system. Their activation is achieved through changes in a set of amino acid residues at their active site, one of which must be serine.

[0003] There are two types of serine proteases used in feed: bacterial serine proteases and fungal serine proteases. Bacterial serine proteases are mainly derived from Bacillus subtilis and Bacillus licheniformis, and are primarily neutral and alkaline serine proteases, with an optimal pH between 6.0 and 11.0. Fungal serine proteases are mainly produced by fermentation of Aspergillus oryzae and Aspergillus niger, and their optimal pH is between 2.5 and 4.5; they are acidic serine proteases.

[0004] In this invention, to meet the needs of the feed industry, we constructed a series of new serine protease mutants using B. velezensis serine protease as a template, which improved the application efficiency of this enzyme and the efficiency of in vitro enzymatic hydrolysis of piglet feed. Summary of the Invention

[0005] The purpose of this invention is to provide a variant of the serine protease B. velezensis, which enhances the acid resistance of the protease and enables its application in the feed industry, particularly under pH conditions of 2.5–2.8.

[0006] The object of this invention is to provide a gene encoding this serine protease variant. Another object of this invention is to provide a method for producing and using this serine protease variant.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] One serine protease variant is obtained by sequentially mutating positions 228 and 431 of the serine protease protein sequence of B. velezensis, changing glycine to tryptophan and arginine to cysteine, respectively.

[0009] The full-length coding gene sequence of the serine protease of B. velezensis is shown in SEQ ID NO.1; the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0010] The amino acid sequence of the serine protease variant is shown in SEQ ID NO.4 in the sequence listing.

[0011] The nucleotide coding sequence of the serine protease variant is preferably as shown in SEQ ID NO.3.

[0012] An expression vector for expressing the serine protease variants described in this invention, wherein the gene encoding the serine protease variants described in this invention is contained.

[0013] A method for producing a serine protease variant according to the present invention includes culturing a recombinant containing a gene sequence encoding a serine protease variant under suitable conditions for serine protease variant expression, and obtaining the serine protease variant from the recombinant or its culture supernatant.

[0014] The application of the serine protease variant described in this invention in the hydrolysis of peptide bonds in macromolecular proteins; preferably, the application in the hydrolysis of peptide bonds in macromolecular proteins under high temperature and / or low pH conditions; the high temperature is preferably 40°C to 90°C; the low pH is preferably 2.0 to 6.0.

[0015] Beneficial effects

[0016] This invention provides a novel serine protease variant exhibiting high catalytic activity under acidic conditions (pH 2.0-6.0) and high-temperature conditions (above 70°C). The serine protease variant provided by this invention demonstrates superior performance compared to the original protease in in vitro enzymatic hydrolysis of piglet feed. These serine protease variants possess good acid resistance, thermal stability, and excellent feed hydrolysis performance, making them suitable for use in the animal feed industry. Attached Figure Description

[0017] Figure 1 The pET-32a vector contains an ampicillin resistance gene (AmpR) that enables E. coli to tolerate 100 μg / mL of ampicillin. Recombinant host cells containing nucleotide sequences encoding serine protease variants were screened using ampicillin.

[0018] Figure 2 A schematic diagram of the pET-32a-sprd1 vector.

[0019] Figure 3 Protease expression in BL21(DE3) expression strain and purified SDS-PAGE images

[0020] Figure 4 To compare the protease activity under different pH conditions and incubation at 40°C for two hours.

[0021] Figure 5To compare the protease activity at pH 2.2 and incubation at 40°C for different times.

[0022] Figure 6 To compare the protease activity after incubation at different temperatures for two hours at pH 6.0.

[0023] Figure 7 This study compares the in vitro enzymatic hydrolysis of piglet feed under different enzyme dosages, feed amounts, and hydrolysis times at pH 2.2, 40°C, and a shaker speed of 180 rpm.

[0024] Detailed description of the invention

[0025] In this invention, serine proteases refer to enzymes capable of hydrolyzing peptide bonds in large protein molecules. For example, serine proteases can hydrolyze casein into amino acids containing phenolic groups.

[0026] In this invention, parental serine protease refers to naturally occurring serine protease. Natural serine proteases are bacterial serine proteases, and their sources include, but are not limited to, *Bacillus subtilis*, *B. licheniformis*, *B. amyloliquefaciens*, *G. stearothermophilus*, and *Bacillus cereus*.

[0027] According to the innovation of this invention, the natural serine protease is derived from B. velezensis (isolated from corn kernels in our laboratory), and its full-length coding sequence is shown in SEQ ID NO.1; the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0028] In this invention, the term "serine protease variant" refers to a non-naturally occurring serine protease that has one or more amino acid residues added, deleted, and / or substituted at effective sites in the amino acid sequence of the parental serine protease, while still retaining the parent's ability to hydrolyze peptide bonds.

[0029] In this invention, "hydrolysis" generally refers to the process of breaking down large protein molecules into smaller amino acids. When serine proteases or serine protease variants are added, "hydrolysis" specifically refers to the hydrolysis of peptide bonds in large protein molecules.

[0030] In this invention, "peptide bond" refers to the chemical bond formed by the dehydration condensation of amino and carboxyl groups between amino acid molecules. The condensation product is called a peptide, hence the name peptide bond.

[0031] This invention relates to "serine protease variants" obtained by sequence modification of parental serine proteases. Parental serine proteases are natural serine proteases, particularly those derived from bacteria. According to embodiments of the invention, the serine protease variant is obtained by mutating, adding, or deleting one or more amino acid residues at effective sites in the amino acid sequence of the parental serine protease.

[0032] This invention comprises a series of serine protease variants. According to embodiments of the invention, the amino acid sequences of this series of serine protease variants share at least 95% homology. As an illustrative and non-limiting example of the invention, the serine protease variants are derived from mutations at positions 228 and 431 of the parental serine protease protein sequence of *B. velezensis*, respectively, from glycine to tryptophan and from arginine to cysteine, see SEQ ID NO. 4.

[0033] The serine protease variants of this invention retain the ability to hydrolyze peptide bonds. Furthermore, the performance of these serine proteases meets the requirements of industrial production, such as improved hydrolysis efficiency and stable catalytic activity under acidic pH or high temperature conditions. According to embodiments of the invention, a serine protease variant exhibits stable catalytic activity under acidic conditions below pH 6.0 or at temperatures above 70°C. These improved properties of the serine protease variants are more suitable for the feed industry because the gastric environment in the feed industry is a low-pH, high-temperature environment.

[0034] All serine protease variants of the present invention can be used for hydrolysis reactions. In a preferred embodiment, the serine protease variant is derived from a parental serine protease, specifically a serine protease derived from the parent B. velezensis.

[0035] According to the present invention, any macromolecular protein containing peptide bonds can be used for hydrolysis. Macromolecular proteins containing one or more peptide bonds include, but are not limited to, casein, glycinin, β-conglycinin, and trypsin inhibitors.

[0036] This invention provides a method for hydrolyzing peptide bonds using a serine protease variant under any temperature and pH conditions suitable for industrial production. According to the invention, the hydrolysis reaction can be carried out at high temperatures ranging from 70°C to 90°C, such as 70°C, 80°C, and 90°C.

[0037] According to embodiments of the present invention, the hydrolysis reaction catalyzed by the serine protease variant exhibits stable catalytic activity under acidic pH and temperature conditions above 70°C. At pH 2.2 and 40°C, the in vitro enzymatic hydrolysis of piglet feed is superior to the control group.

[0038] According to embodiments of the present invention, recombinant host cells can be genetically engineered to contain nucleic acid sequences encoding one or more serine protease variant genes. Any technique can be used to genetically engineer host cells to contain nucleic acid sequences encoding one or more serine protease variants of the present invention, for example, chromosomal integration. Vectors containing temperature-sensitive origin and resistance selection markers can be used in the integration step. These vectors integrate with specific regions of the genome via the Campbell's mechanism, resulting in recombinant bacteria through resistance selection. The recombinant bacteria then lose the resistance selection markers through homologous recombination during subsequent culture.

[0039] This invention provides a method for producing a serine protease variant. According to embodiments of the invention, the method includes culturing a recombinant host cell containing a nucleotide sequence encoding a serine protease variant under suitable conditions for serine protease variant expression, and obtaining the serine protease variant from the recombinant host cell or its supernatant.

[0040] All recombinant host cells of this invention are capable of producing serine protease variants. The recombinant host cells contain at least one copy of a nucleotide sequence encoding a serine protease variant. These nucleotide sequences encoding the serine protease variant are capable of expressing the serine protease variant under suitable conditions. The serine protease variant secreted from the recombinant host cells can be collected from the recombinants or supernatant. Collection methods include, but are not limited to, filtration, centrifugation, etc.

[0041] The following examples further illustrate the essence of this invention. It should be understood that the following examples do not limit the invention, and the scope of the invention is determined by the appended claims. Detailed Implementation

[0042] Example 1: Construction of pET-32a plasmid

[0043] The pET-32a vector carries an N-terminal His / Thrombin / TrXA protein tag and an optional C-terminal His tag. The single multiple cloning site of the pET-32a vector is shown in the circular plasmid map above. Note: The vector sequence is encoded according to the coding rules of the pBR322 plasmid, so the T7 protein expression region is reversed on the plasmid map. The clones and expression regions initiated by T7 RNA polymerase are also marked in the plasmid map. The F1 replicon of the plasmid is oriented, so under the action of T7 phage polymerase, viral particles containing the protein-coding sequence can be generated and protein expression can be initiated. Protein expression is terminated by the T7 terminator sequence (Cat. No. 69337-3), and selection is performed using ampicillin.

[0044] The construction process of the Pet32a plasmid is as follows: the plasmid pet32a (preserved in our laboratory) is digested with EcoI and XhoI, the 5.3k fragment is recovered and purified, and stored at -20℃ for later use.

[0045] In this invention, the serine protease gene (1353 bp) was cloned and amplified from the total genomic DNA of B. velezensis D1.

[0046] The primers used for the PCR reaction were synthesized by Tsingke. The primer sequences are as follows:

[0047] Pro1353s:ATCCGAATTCATGATGGATAACTATCGTGATGAAAAT

[0048] Pro1353 anti: GGTGCTCGAGAGAAGATGTTTCTTCTTTTTGAGTCAG. The PCR amplification system was 50 μL, and the reaction procedure was as follows:

[0049] (1) Pre-denaturation of Bacillus belye genome DNA at 95°C for 5 minutes;

[0050] (2) 95℃, 30 seconds;

[0051] (3) 50℃, 30 seconds;

[0052] (4) 72℃, 90 seconds; repeat steps 2-4 30-35 times;

[0053] (5) Extend to 72°C for 2 minutes.

[0054] (6) Run the gel on a 1% agarose gel and recover the gel using the Genstar kit.

[0055] (7) The fragment of about 1.3k was recovered and purified by double digestion with EcoI and XhoI and stored at -20℃ for later use.

[0056] The linear plasmids and protease gene fragments recovered from the gel were ligated using T4 DNA ligase (Mona Biotechnology). After ligation, the cells were transformed into DH5α competent *E. coli* cells and cultured overnight on LB agar containing 50 μg / ml ampicillin. Positive clones were picked for colony PCR identification and sent to GE Biotechnology for sequencing, yielding transformant T1353. Transformant T1353 was used to transform BL21(DE3) competent *E. coli* cells and cultured overnight on LB agar containing 50 μg / ml ampicillin. Positive clones were picked for colony PCR identification and sent to GE Biotechnology for sequencing, yielding the protease-expressing strain GAMIO-pro.

[0057] Colony PCR identification procedure:

[0058] The primers used for the PCR reaction were synthesized by Tsingke. The primer sequences are as follows:

[0059] T7: TAATACGACTCACTATAGGG

[0060] T7ter: TGCTAGTTATTGCTCAGCGG

[0061] The PCR amplification system consisted of 15 μL, and the reaction procedure was as follows:

[0062] (1) Pre-denaturate single colony culture medium at 95°C for 5 minutes;

[0063] (2) 95℃, 30 seconds;

[0064] (3) 52℃, 30 seconds;

[0065] (4) 72℃, 90 seconds; repeat steps 2-4 30-35 times;

[0066] (5) Extend to 72°C for 2 minutes.

[0067] Example 2: First site-directed mutagenesis of pet32a-pro

[0068] The plasmid pet32a-pro of the transformant T1353 was extracted and subjected to site-directed mutagenesis in steps.

[0069] The primers used for the PCR reaction were synthesized by Tsingke. The primer sequences are as follows:

[0070] 228s:CAAGTTTCTGGAGCTCATCCGCTCTCAGAACG

[0071] 228anti: TGAGCTCCAGAAACTTGCTGTTTTTGTCACGTG The PCR amplification system was 50 μL, and the reaction procedure was as follows:

[0072] (1) Plasmid pet32a-pro pre-denaturation at 95℃ for 5 minutes;

[0073] (2) 95℃, 15 seconds;

[0074] (3) 65℃, 15 seconds;

[0075] (4) 72℃, 4 minutes; repeat steps 2-4 25-30 times;

[0076] (5) Extend to 72°C for 2 minutes.

[0077] The PCR product was digested with dpnI and directly transformed into DH5α competent Escherichia coli cells. The cells were cultured overnight on LB solid medium containing 50 μg / ml ampicillin. Positive clones were picked for colony PCR identification and sent to GE for sequencing to obtain transformant MTF1353.

[0078] Example 3: Second site-directed mutagenesis of pet32a-pro

[0079] The plasmid MTF1353 of the transformant was extracted and subjected to a second site-directed mutagenesis via PCR.

[0080] The primers used for the PCR reaction were synthesized by Tsingke. The primer sequences are as follows:

[0081] 431s: GATTATCTGCAACGGCAAGGAAATGACGAAAA

[0082] 431anti: TGCCGTTGCAGATAATCTTCACGTCAACGGTGC PCR amplification system was 50 μL, and the reaction procedure was as follows:

[0083] (1) Plasmid pre-denaturation at 95℃ for 5 minutes;

[0084] (2) 95℃, 15 seconds;

[0085] (3) 65℃, 15 seconds;

[0086] (4) 72℃, 4 minutes; repeat steps 2-4 25-30 times;

[0087] (5) Extend to 72°C for 2 minutes.

[0088] The PCR product was digested with dpnI and directly transformed into DH5α competent Escherichia coli cells. The cells were cultured overnight on LB solid medium containing 50 μg / ml ampicillin. Positive clones were picked for colony PCR identification and sent to GE for sequencing to obtain transformant MTS1353.

[0089] Example 4: Plasmid Transformation

[0090] The plasmid of transformant MTS1353 was extracted and transformed into competent BL21(DE3) Escherichia coli cells. The cells were cultured overnight on LB solid medium containing 50 μg / ml ampicillin. Positive clones were identified by colony PCR and sent to GE for sequencing to obtain the protease expression strain GAMIM-pro.

[0091] Colony PCR identification procedure:

[0092] The primers used for the PCR reaction were synthesized by Tsingke. The primer sequences are as follows:

[0093] T7: TAATACGACTCACTATAGGG

[0094] T7ter: TGCTAGTTATTGCTCAGCGG

[0095] The PCR amplification system consisted of 15 μL, and the reaction procedure was as follows:

[0096] (1) Pre-denaturate single colony culture medium at 95°C for 5 minutes;

[0097] (2) 95℃, 30 seconds;

[0098] (3) 52℃, 30 seconds;

[0099] (4) 72℃, 90 seconds; repeat steps 2-4 30-35 times;

[0100] (5) Extend to 72°C for 2 minutes.

[0101] The BL21(DE3) engineered strain that produces serine protease variants was stored at -80°C.

[0102] Example 5: Liquid culture for the production of serine protease variants

[0103] An activated bacterial single clone (containing a serine protease variant expression cassette) was inoculated into 20 ml of liquid culture medium (LB liquid medium and 0.25% ampicillin; LB liquid medium formulation: 1% peptone, 0.5% yeast extract, 1% NaCl) and cultured at 37°C until the OD value was between 0.4 and 0.6. IPTG (isopropyl-β-D-thiogalactoside) was added to a final concentration of 0.8 mmol / L, and the culture was incubated at 25°C with shaking at 180 rpm for 12 hours. The culture was then sonicated at 300 W for 30 minutes, and the supernatant was collected by centrifugation for SDS-PAGE analysis. The results showed that the molecular weight of the serine protease variant plus the solubilization tag was approximately 70 kDa.

[0104] Example 6: Purification of Protease

[0105] 1. The supernatant from the examples was transferred in batches to a 12 mL affinity chromatography column containing 2 mL of Protein Iso Ni-NTA Resin. Each batch was incubated on ice for 1 h, and the column was inverted and mixed every 10 min until the supernatant was completely affinityized by Ni-NTA Resin. The collected eluent was named the flow-through.

[0106] 2. Rinse the Ni column in batches with imidazole solutions of different concentrations.

[0107] 3. Incubate the Ni column on ice with 1.5 mL of 500 mM imidazole solution for 20 min, shaking to mix every 2 min, and collect the eluent.

[0108] 4. Take 20 μL of each of the above samples, add 4 μL of 6xSDS-PAGE Loading Buffer, boil for 6 min, and then perform SDS-PAGE gel electrophoresis.

[0109] 5. After electrophoresis, stain with Coomassie Brilliant Blue solution for 3 hours, then destain with destaining solution until clear protein bands are visible.

[0110] 6. Select a protein solution free of impurities and add it to the dialysis bag. Place the dialysis bag in the dialysis solution and dialyze at 4°C with stirring for 8 hours.

[0111] Example 7: Protease Activity Assay

[0112] Definition of enzyme activity unit: The amount of enzyme that hydrolyzes casein to produce 1 μmol / L of tyrosine in 1 minute under conditions of pH 7.4 and 37°C is defined as one enzyme activity unit (U / mL).

[0113] The enzyme activity assay is performed as follows: Take the purified protease and dilute it to a specific concentration with the appropriate buffer solution (recommended concentration range: 10 U / mL-15 U / mL). Preheat the casein solution in a 40℃±0.2℃ water bath for 5 min. Separately, add 1 mL of the diluted enzyme solution to a clean test tube and incubate at 40℃±0.2℃ for 2 min. For the blank group, add 2 mL of trichloroacetic acid, shake well, and incubate at 40℃±0.2℃ for 10 min to terminate the reaction. Simultaneously, add 1 mL of casein solution to the experimental group, shake well, and incubate at 40℃±0.2℃ for 10 min to initiate the reaction. Add 1 mL of casein to the blank group and 2 mL of trichloroacetic acid to the experimental group, shake well, and allow to stand for 10 min. Filter using slow-speed qualitative filter paper. Take 1 mL of the filtrate, add 5 mL of sodium carbonate solution and 1 mL of Folin-Ciocalteu solution, shake well, and incubate at 40℃±0.2℃ for 20 min for color development. Measure the absorbance at 680 nm.

[0114] Example 8: Enzymatic properties of proteases

[0115] First, we determined the acid resistance of the protease and simultaneously tested its activity under different pH conditions. The hydrolysis conditions were the same as described above, with pH values ​​of 2.0, 3.0, 4.0, and 5.0, and an enzyme dosage of 50 μL. GAMIO-pro was used as a control. The results are shown in Table 1 and [Table data would be inserted here]. Figure 4 At pH 2.0, the serine protease variant of the present invention can still be hydrolyzed normally, indicating that the serine protease variant of the present invention has strong tolerance to low pH, while the original protease GAMIO-pro has weak tolerance to low pH.

[0116] Table 1: Comparison of protease activity at different pH levels after incubation at 40℃ for 2 hours.

[0117]

[0118] Secondly, the protease activities of the two proteases were determined after incubation at pH 2.2 for different times, specifically at 4, 8, 12, 16, and 20 hours. The results are shown in Table 2 and [Table data would be inserted here]. Figure 5 After 8 hours of incubation, the activity of the original protease GAMIO-pro was significantly reduced; after 12 hours of incubation, the activity of the complex mutant enzyme GAMIO-pro was 36 kU / mL, still possessing a certain protease activity, which was higher than that of the original protease GAMIO-pro.

[0119] Table 2: Comparison of protease activity after incubation at pH 2.2 at different time points.

[0120]

[0121] We then determined the thermostability of the two proteases. They were incubated at pH 6.0 at 70°C, 80°C, 85°C, and 90°C for 2 hours, respectively. The results are shown in Table 3. Figure 6 The protease mutant GAMIO-pro still has certain enzymatic activity, while the original protease GAMIO-pro can withstand temperatures up to 80°C.

[0122] Table 3: Comparison of protease activity after incubation at different temperatures for 2 hours at pH 6.0.

[0123]

[0124] Example 9: Application of protease in feed

[0125] The feed formulation for piglets was obtained by enzymatic hydrolysis with proteases before and after the mutation, as shown in Table 4 below.

[0126] The release of amino acids from enzymatically hydrolyzed feed was compared. Two experimental groups were set up, both of which were 3-factor, 3-level orthogonal experiments. The other group was a mutant protease experimental group. The optimal temperature was 40℃, pH 2.0-2.5, and further optimized pH 2.2, with a rotation speed of 180 rpm.

[0127] Table 4: Piglet Feed Formulation

[0128]

[0129] Different masses of piglet feed were dissolved in 20 ml of simulated gastric juice, and the pH was adjusted to a specific value with 2 mol / L hydrochloric acid. Under different enzyme dosages (100 U, 200 U, 400 U), different hydrolysis times (4 h, 5 h, 6 h), and solid-liquid ratios (solid: pulverized piglet feed; liquid: simulated gastric juice) (0.3 g / ml, 0.5 g / ml, 0.7 g / ml), the hydrolysis effect (release of amino acids in the supernatant) was compared. The results are shown in Table 5. Figure 7 The results indicate that the enzymatic hydrolysis efficiency of the mutant proteasome was higher than that of the original proteasome. Furthermore, at an enzyme dosage of 400 U, a solid-liquid ratio of 0.7 g / ml, and a hydrolysis time of 4 hours, the hydrolysis efficiency was higher than that of other groups.

[0130] In summary, based on the experimental results of this invention, this series of protease variants exhibits good heat resistance, acid resistance, and excellent feed enzymatic hydrolysis effect, and can be applied in the feed industry.

[0131] Table 5: In vitro feed enzymatic hydrolysis effect

[0132]

[0133] The embodiments of this invention, in addition to employing technical methods within the art, are inseparable from the guidance of the inventive spirit. Therefore, this invention is not limited to the specific embodiments disclosed, but also covers the revised provisions within the spirit and scope of this invention, as detailed in the claims.

Claims

1. A variant of Bacillus belye serine protease for animal feed, characterized in that... The amino acid sequence of the serine protease variant is shown in SEQ ID NO.4 in the sequence listing.

2. A gene encoding the serine protease variant as described in claim 1.

3. The gene according to claim 2, characterized in that... The nucleotide sequence of the serine protease variant is shown in SEQ ID NO.3 in the sequence listing.

4. A recombinant for expressing the serine protease variant of claim 1, characterized in that... It includes the gene encoding a serine protease variant as described in claim 3.

5. A method for producing the serine protease variant as described in claim 1, characterized in that... This includes culturing recombinants containing gene sequences encoding serine protease variants under suitable conditions for serine protease variant expression, and obtaining serine protease variants from the recombinants or their culture supernatants.

6. The use of the serine protease variant of claim 1 in the hydrolysis of peptide bonds in macromolecular proteins.

7. The application according to claim 6, characterized in that... The application of the serine protease variant in the hydrolysis of peptide bonds in macromolecular proteins under high temperature and low pH conditions, wherein the high temperature is 40-70°C and the low pH is 2.0-6.0.

Images