Detection kit for FGFR2 gene fusion mutation in cholangiocarcinoma

Abstract

The present invention discloses a kit for detecting FGFR2 gene fusion mutations in cholangiocarcinoma. The kit includes a reagent for reverse transcription of RNA into cDNA and a PCR expression reagent. After reverse transcription of the sample into cDNA, the cDNA is expressed using the PCR expression reagent and then detected using a digital PCR instrument. The kit is easy to operate and has the characteristics of high sensitivity, high accuracy, and low cost, and can be used as a reference for clinical medication.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a detection kit for FGFR2 gene fusion mutation in bile duct cancer. Background Art

[0002] Intrahepatic cholangiocarcinoma (ICC) is a major subtype of cholangiocarcinoma (CCA), accounting for approximately 10%-20% of all primary liver cancers. ICC is a lethal primary liver cancer, but its early symptoms are subtle, and patients are typically diagnosed in the advanced, unresectable stage. Treatment options are limited, and the prognosis is poor. Therefore, timely diagnosis and treatment are urgently needed.

[0003] With the development of sequencing technology, the generation of fusion genes has been found to be a key driver of cancer development and progression. In ICC, fusion genes driven by Fibroblast Growth Factor Receptor 2 (FGFR2) are one of the most common types of mutated genes, with over 15% of ICC patients harboring FGFR2 gene fusion mutations. Furthermore, there are numerous FGFR2 fusion partner genes in ICC, with over 150 currently identified.

[0004] Previously, a number of preclinical and clinical trials have demonstrated that FGFR inhibitors can effectively enhance the therapeutic effect of patients with FGFR2 fusion-positive ICC. Therefore, there is an urgent need for effective FGFR2 fusion mutation detection methods to assist in the diagnosis and treatment of ICC. The current methods for detecting fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), real-time fluorescence PCR (RT-PCR), and next-generation sequencing (NGS). The first two technologies are commonly used clinical auxiliary diagnostic methods, but their sensitivity is very limited. RT-PCR and NGS have high sensitivities, both reaching 1%, but the fusion gene targets detected by RT-PCR are limited and unknown fusions cannot be detected. NGS can detect unknown fusion genes, but the detection cost is high and the detection cycle is long.

[0005] Regarding the RT-PCR detection method, Chinese patent document CN 112143815 B (application number 202011332715.9) discloses a nucleic acid composition, a kit and a detection method for detecting human FGFR2 gene fusion mutations. It is a real-time fluorescence PCR (RT-PCR) detection method: first, the RNA of the test sample is extracted and reverse transcribed into cDNA, and then the cDNA is used as a template to perform a real-time fluorescence PCR reaction using the above-mentioned kit. Finally, the positive or negative of the test sample is determined according to the Ct value. It can simultaneously detect 18 FGFR2-driven fusion genes.

[0006] Regarding NGS detection methods, Chinese patent document CN 112301115 B (application number 202011001862.8) discloses a method and probe sequence for detecting FGFRs gene mutations based on high-throughput sequencing. The method includes the following steps: 1) co-extraction of sample genomic DNA and total RNA; 2) fragmentation of genomic DNA and recovery of fragmented DNA; 3) total RNA shearing and / or primer hybridization based on total RNA quality control; 4) synthesis of first-strand cDNA; 5) synthesis of second-strand cDNA; 6) mixing the fragmented DNA with cDNA to construct a mixed library; 7) hybridization and capture using capture probes; 8) post-capture library amplification and purification; 9) high-throughput sequencing and mutation analysis. This method can detect single-base mutations, insertion-deletion mutations, and fusion mutations in the FGFR1, FGFR2, FGFR3, and FGFR4 genes, as well as relative expression analysis.

[0007] Digital PCR (dPCR) is an emerging absolute quantitative technology that, by miniaturizing samples, can determine the absolute number of target molecules down to a single copy, significantly improving detection accuracy and sensitivity. It is an effective method for fusion gene detection. However, conventional dPCR testing suffers from the same limitations as RT-PCR: limited detection targets and the inability to detect unknown fusions. Summary of the Invention

[0008] The technical problem to be solved by the present invention is that the conventional method of detecting fusion genes using digital PCR can only detect known fusions and has limited detection targets; a kit is provided that can detect known fusion genes and unknown fusion genes with FGFR2 as the driver gene on a digital PCR platform.

[0009] The present invention combines single-end anchor amplification technology and dPCR detection technology to overcome the problem of limited detection targets.

[0010] The present invention utilizes a kit to detect FGFR2 gene fusion mutations. The principle behind this method is that a fixed sequence (Uni) is introduced at the 5' end of the cDNA during the reverse transcription (RT) phase to serve as the binding site for the upstream primer (Universal primer-F). After reverse transcription into cDNA, a sequence is selected before the 3' end of FGFR2 exon 17 as the binding site for the downstream primer (GSP primer-R). This allows for complete amplification of the entire sequence after FGFR2 exon 17 during dPCR. Furthermore, a sequence is selected between the downstream primer binding site and the 3' end of FGFR2 exon 17 as the binding site for the mutation probe (Fusion probe, labeled with a fluorescent group at the 5' end), and a sequence is selected on FGFR2 exon 18 as the binding site for the wild-type probe (WT probe, labeled with a fluorescent group at the 5' end). The 5'-end fluorescent groups labeled on the Fusion probe and the WT probe are different. When FGFR2 wild-type transcripts are amplified, dual fluorescence labeled by the Fusion probe and the WT probe is generated simultaneously. When FGFR2 fusion transcripts are amplified, only single fluorescence labeled by the Fusion probe is generated, allowing the FGFR2 fusion transcripts to be distinguished from the FGFR2 wild-type transcripts.

[0011] The technical solution for achieving the purpose of the present invention is a detection kit for FGFR2 gene fusion mutation in cholangiocarcinoma, comprising a reverse transcription reagent and a PCR expression reagent.

[0012] The reverse transcription reagent is a reagent for reverse transcription of RNA into cDNA, including reverse transcription primer Uni-N6, reverse transcription buffer, reverse transcriptase and enzyme-free water; wherein the Uni sequence in Uni-N6 is any artificially synthesized fixed sequence, and N represents a random primer.

[0013] PCR expression reagents include primers, probes, DNA polymerase, buffer and enzyme-free water, and the primers and probes include Universal primer-F, GSP primer-R, Fusion probe and WT probe.

[0014] The Universal primer F is a sequence that is identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6.

[0015] The GSP primer-R primer and the Fusion probe are two sequences on exons 1-17 of the FGFR2 transcript. The Fusion probe is located in the downstream region of the GSP primer-R primer position and does not overlap. On the cDNA template, the Fusion probe is located in the upstream region of the GSP primer-R primer position and does not overlap.

[0016] The WT probe is any sequence on exon 18 of the FGFR2 transcript.

[0017] The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and WT probe sequences are different.

[0018] The 3' end of the Fusion probe sequence is modified with a quencher group, and the 3' end of the WT probe sequence is modified with a quencher group.

[0019] As an option, the reverse transcription reagent includes reverse transcription buffer 2-5μL, reverse transcriptase 0.5-2μL, Uni-N6primer 2X10 -11 Up to 5x10 -11 mol, 5.5-15.5 μL of enzyme-free water.

[0020] As an option, PCR expression reagents include Universal primer-F 1.0X10 -11 to 3.0X10 -11 mol, GSP primer-R1.0X10 -11 to 3.0X10 -11 mol, Fusion probe 5.0X10 -12 to 1.0X10 -11 mol, WT probe5.0X10 -12 to 1.0X10 -11 mol.

[0021] Alternatively, the PCR expression reagents include 5X DNA Master mix, which includes DNA polymerase and buffer.

[0022] Optionally, in the PCR expression reagent, the GSP primer-R and the Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript NM_022970.3; and the WT probe is any sequence on exon 18 of the FGFR2 transcript NM_022970.3.

[0023] Optionally, in the PCR expression reagent, the fluorescent group at the 5' end of the Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, or Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, or Cyc5.5 fluorescent groups.

[0024] Optionally, in the PCR expression reagent, the quenching group at the 3' end of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; the quenching group at the 3' end of the WTprobe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; wherein MGB is a minor groove binder modified with an NFQ quenching group.

[0025] Optionally, in the PCR expression reagent, the molar ratio of Universal primer F, GSP primer-R, Fusion probe, and WT probe is 1:1:0.5:0.5.

[0026] Preferably, the length of the Uni-N6 sequence in the RNA reverse transcription into cDNA reagent is greater than or equal to 8 bases; in the PCR expression reagent, the length of each primer or probe sequence is greater than or equal to 8 bases.

[0027] As an option, in the reagent for reverse transcription of RNA into cDNA, the gene sequence of Uni-N6 is SEQ ID NO.1, SEQ ID NO.6 or SEQ ID NO.11, wherein N represents a random primer.

[0028] Optionally, in the PCR expression reagent, the gene sequence of Universal primer F is SEQ ID NO.2, SEQ ID NO.7 or SEQ ID NO.12.

[0029] The gene sequence of the GSPprimer-R primer is SEQ ID NO.3, SEQ ID NO.8 or SEQ ID NO.13.

[0030] The gene sequence of the fusion probe is SEQ ID NO.4, SEQ ID NO.9 or SEQ ID NO.14.

[0031] The gene sequence of the WTprobe probe is SEQ ID NO.5, SEQ ID NO.10 or SEQ ID NO.15.

[0032] In the Fusion probe and WT probe, "+" indicates locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, 3'BHQ1 is a quencher modification, and 3'MGB is a 3'-terminal minor groove binder (MGB) plus NFQ quencher modification.

[0033] The present invention has positive effects:

[0034] (1) The kit of the present invention includes an RNA reverse transcription reagent to convert to cDNA and a PCR expression reagent. The sample RNA is first reverse transcribed into cDNA using the reverse transcription reagent, and then expressed using the PCR expression reagent and detected using a digital PCR instrument.

[0035] The principle of the kit of the present invention for detecting FGFR2 gene fusion mutations is to utilize the characteristic that the breakpoints of most FGFR2-driven fusion genes are located at the 3' end of FGFR2 exon 17 (the composition structure of most FGFR2-driven fusion genes has a fixed pattern: at the N-terminus, the fusion genes share an almost identical FGFR2 portion, including the complete kinase domain (FGFR2 exon 1-17); at the C-terminus, there is a dimerization / oligomerization domain provided by different fusion partner genes, such as Bicaudal family RNA-binding protein 1 (BICC1), adenosine homocysteinease 1 (AHCYL1), and periphilin 1 (PPHLN1). This pattern shows that the breakpoints of most FGFR2-driven fusion genes in cholangiocarcinoma are located at the 3' end of FGFR2 exon 17). Combined with single-end anchored amplification technology and dPCR detection technology, it enables the detection of known and unknown fusion genes with FGFR2 as the driving gene on a digital PCR platform, solving the problem of limited detection targets for digital PCR.

[0036] (2) The kit of the present invention is easy to operate and has the characteristics of high sensitivity, high accuracy and low cost, and can be used as a reference for clinical medication. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a diagram showing the working principle of the kit for this application.

[0038] Figure 2 Results of RNA fragmentation testing of FGFR2-Casp7 fusion cell lines.

[0039] Figure 3 Results of RNA fragmentation testing of FGFR2-BICC1 fusion cell lines.

[0040] Figure 4 This is the positive sample detection result of the primer-probe system of Example 2 in Experimental Example 2.

[0041] Figure 5 This is the positive sample detection result of the primer-probe system of Example 3 in Experimental Example 2.

[0042] Figure 6 The results show the repeatability of the assay under different RNA input amounts.

[0043] Figure 7 These are the sensitivity test results at different FGFR2 fusion copy number inputs.

[0044] Figure 8 This is the test result of clinical positive samples. DETAILED DESCRIPTION

[0045] Introduced below are some of the multiple possible embodiments of the present invention, which are intended to provide a basic understanding of the present invention, and are not intended to identify the key or decisive elements of the present invention or to limit the scope of protection. It is easy to understand that according to the technical solution of the present invention, without changing the essential spirit of the present invention, those skilled in the art can propose other mutually interchangeable implementations. Therefore, the following specific embodiments are only exemplary descriptions of the technical solution of the present invention, and should not be regarded as the entirety of the present invention or as a limitation or restriction of the technical solution of the present invention.

[0046] (Example 1)

[0047] The primer probe sequence information used in this example is as follows: the Universal primer-F sequence is a sequence that is partially identical to the Uni sequence of the RT primer (Uni-N6); the GSP primer-R sequence is the base sequence of positions 2886-2905 of the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2920-2941 of the Exon1-17 region of the FGFR2 transcript (NM_022970.3); and the WT probe sequence is the base sequence of positions 11-28 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0048]

[0049]

[0050] The kit of this embodiment includes a reagent for reverse transcription of RNA into cDNA and a reagent for PCR expression.

[0051] RNA reverse transcription to cDNA reagents include: reverse transcription buffer, reverse transcriptase, Uni-N6 primer and enzyme-free water. Optional, reverse transcription buffer 2-5μL, reverse transcriptase 0.5-2μL, Uni-N6 primer 2X10 -11 Up to 5x10 -11 mol.

[0052] For example, the reverse transcription reagents in this embodiment include 2 μL of 5X PrimeScript Buffer, 0.5 μL of PrimeScript RT Enzyme Mix I, 2 μL of Uni-N6 primer (10 μM), and 10 μL of enzyme-free water; the enzyme-free water is stored separately from the 5X PrimeScript Buffer, PrimeScript RT Enzyme Mix I, and Uni-N6 primer.

[0053] PCR expression reagents include: primers, probes, DNA polymerase, buffer and enzyme-free water; the primers and probes include Universal primer-F, GSP primer-R, Fusion probe, WT probe. PCR expression reagents include Universal primer-F1.0X10 -11 to 3.0X10 -11 mol, GSP primer-R1.0X10 -11 to 3.0X10 -11 mol, Fusion probe 5.0X10-12 to 1.0X10 -11 mol, WT probe5.0X10 -12 to 1.0X10 -11 mol.

[0054] For example, the PCR expression reagents in this embodiment include 6 μL of 5X DNA Master mix, 1.2 μL of Universal primer-F (10 μM), 1.2 μL of GSP primer-R (10 μM), 0.6 μL of Fusion probe (10 μM), 0.6 μL of WT probe (10 μM), and 25-35 μL (30 μL in this embodiment) of enzyme-free water. The enzyme-free water is stored separately from the DNA Master mix, Universal primer-F, GSP primer-R, Fusion probe, and WT probe. The 5X DNA Master mix contains DNA polymerase and buffer.

[0055] See Figure 1 The method for detecting RNA fusion mutation of FGFR2 in cholangiocarcinoma using a kit comprises the following steps:

[0056] S1. Extraction of genomic RNA from the sample to be tested.

[0057] The paraffin blocks of the samples to be tested were cut into 10 μm tissue sections and, after dewaxing, were sliced ​​using Qiagen The DSP FFPEKit RNA Extraction Kit (Cat. No. 73604) was used to extract genomic RNA from the sample to be tested, obtaining 20 μL of total RNA with a concentration of 100-300 ng / μL.

[0058] Any extraction method that extracts RNA including mRNA can be used.

[0059] Specifically, the RNA extraction method can be any one of the extraction methods such as the phenol-chloroform method, silica gel column method, magnetic bead method, Trizol method and RNeasy method, or a commercial RNA extraction kit can be directly used.

[0060] S2. RNA is reverse transcribed into cDNA. During the reverse transcription (RT) stage, a fixed sequence Uni-N6 is introduced into the 5' end of the cDNA as the upstream primer (Universal primer-F) binding site.

[0061] First, add 20 ng of RNA template to the RNA reverse transcription to cDNA reagent on ice to obtain the following reverse transcription reaction mixture: 5X PrimeScript Buffer 2 μL, PrimeScript RT Enzyme Mix I 0.5 μL, Uni-N6 primer (10 μM) 2 μL, 20 ng of RNA template, and add enzyme-free water to 10 μL.

[0062] In Uni-N6, the Uni sequence is any artificially synthesized fixed sequence, and N represents a random primer.

[0063] In the kit prepared in this example, the sequence number of Uni-N6 is SEQ ID NO. 1, and the gene sequence is: 5'TTCCCTACACGACGCTCTTCCGATCTNNNNNN3', where N represents a random primer.

[0064] Reverse transcription buffer (5X PrimeScript Buffer) and reverse transcriptase (PrimeScript RT Enzyme) were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd. (Cat. No. RR037A). The amount of RNA template input can be adjusted depending on the sample type and experimental purpose; in this example, 20 ng was used.

[0065] Then perform the reverse transcription reaction according to the following conditions:

[0066] temperature time 37℃ 15min 85℃ 5s 4℃ Keep warm until the reverse transcription is completed

[0067] S3, digital PCR reaction: the present invention adopts digital PCR based on chip board.

[0068] After conversion to cDNA, the upstream primer (Universal primer-F) binds to a fixed sequence (Uni) introduced at the 5' end of the cDNA, and the downstream primer (GSP primer-R) binds to a sequence before the 3' end of FGFR2 exon 17. This allows for complete amplification of the entire sequence after FGFR2 exon 17 during dPCR. Simultaneously, the mutation probe (Fusion probe, 5' end VIC labeled) binds to a sequence between the downstream primer binding site and the 3' end of exon 17, and the wild-type probe (WT probe, 5' end FAM labeled) binds to a sequence on FGFR2 exon 18.

[0069] The Universal primer F is a sequence that is identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6, and the primer length is greater than or equal to 8 bases.

[0070] In this embodiment, the GSP primer-R primer and the Fusion probe are two sequences on exons 1-17 of the FGFR2 transcript NM_022970.3. The Fusion probe is located downstream of the GSP primer-R primer position and does not overlap. On the cDNA template, the Fusion probe is located upstream of the GSP primer-R primer position and does not overlap. The GSP primer-R primer is greater than or equal to 8 bases in length, and the Fusion probe is greater than or equal to 8 bases in length. Any two sequences within the exon 1-17 region that meet the above position and length relationship can be the GSP primer-R primer and the Fusion probe.

[0071] The WT probe is any sequence on exon 18 of the FGFR2 transcript NM_022970.3, and the length of the WT probe is greater than or equal to 8 bases.

[0072] The specific operations in this embodiment are as follows.

[0073] S3-1. After reverse transcription is complete, take 2.5 μL of the reaction product as an amplification template, add it to the PCR expression reagent, and prepare the following PCR system at room temperature:

[0074] Components Volume (μL) Final concentration 5X DNA Master mix 6 1X Universal primer-F (10 μM) 1.2 400nM GSP primer-R (10 μM) 1.2 400nM Fusion probe (10μM) 0.6 200nM WT probe (10 μM) 0.6 200nM cDNA 2.5 <![CDATA[H2O]]> up to 30

[0075] In this system, the gene sequence of Universal primer-F is: 5'TTCCCTACACGACGCTCT3'.

[0076] The gene sequence of GSP primer-R is: 5'CAGAGACCAACGTTCAAGCA3'.

[0077] The gene sequence of the fusion probe is: 5'VIC TGGA+TCG+AATT+CTCAC+TCTCAC 3'BHQ1.

[0078] The gene sequence of the WT probe is: 5'FAM ACC+TCA+GCCA+ACCT+CTCG 3'BHQ1.

[0079] The “+” indicates locked nucleic acid (LNA) modification, 5’VIC and 5’FAM are fluorescent group modifications, and 3’BHQ1 is a quencher group modification.

[0080] The fluorescent group at the 5' end of the Fusion probe and the WT probe is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups, and the fluorescent groups at the 5' end of the Fusion probe and the WT probe are different; in this embodiment, the fluorescent group at the 5' end of the Fusion probe is VIC, and the fluorescent group at the 5' end of the WT probe is FAM.

[0081] In addition to BHQ1 mentioned above, the quenching group at the 3' end of the Fusion probe and WT probe can also be one of the BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the 3' end of the Fusion probe and WT probe can also be modified with MGB, which is a minor groove binder modified with an NFQ quenching group.

[0082] In addition, the 5X DNA Master mix in the kit prepared in this example was ordered from Roche (Cat. No. 09393544001). The input amounts of cDNA template and primer probe can be adjusted according to experimental requirements.

[0083] S3-2. The obtained PCR reaction system was prepared into droplets of uniform size using a Roche Digital LC sample splitter. The droplet size was approximately 1 nL.

[0084] S3-3, for droplets, use the following conditions on Roche Digital Light Perform amplification reaction and fluorescence signal detection on a digital PCR instrument:

[0085]

[0086] After the reaction was completed, the digital PCR analysis software (Roche Digital Light The indel analysis method using the Gene Expression Development Software (Gene Expression Software) calculates the copy number of FGFR2 wild-type and fusion transcripts, and makes a judgment based on the droplet fluorescence distribution: when FGFR2 wild-type transcripts are amplified, both VIC and FAM fluorescence are produced, while when FGFR2 fusion transcripts are amplified, only VIC fluorescence is produced. This allows the distinction between FGFR2 fusion transcripts and FGFR2 wild-type transcripts. A positive call is considered if the total mutant gene copy number calculated by indel analysis is ≥1; a negative call is considered if the total mutant gene copy number is <1.

[0087] Because both the wild-type probe (FAM) and the fusion probe (VIC) are present in the system, theoretical detection results will show double-positive droplets (droplets that produce both FAM and VIC fluorescence), single-positive VIC droplets (droplets that produce only VIC fluorescence), and negative droplets (droplets with no excitation fluorescence). Double-positive droplets represent wild-type transcripts or the presence of both wild-type and fusion transcripts, while single-positive VIC droplets represent fusion transcripts. Copy number calculation is based on Roche's indel analysis algorithm. Theoretically, a single-positive VIC droplet count greater than 1 indicates the presence of an FGFR2 fusion target.

[0088] (Example 2)

[0089] The primer probe sequence information used in the kit of this embodiment is as follows: the Universal primer-F sequence is a sequence identical to the fixed sequence of the RT primer (Uni-N6); the GSP primer-R sequence is the base sequence of positions 2876-2892 of the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2905-2923 of the Exon1-17 region of the FGFR2 transcript (NM_022970.3); and the WT probe sequence is the base sequence of positions 97-113 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0090]

[0091] (Example 3)

[0092] The primer probe sequence information used in the kit of this embodiment is as follows: the Universal primer-F sequence is a sequence identical to the fixed sequence portion of the RT primer (Uni-N6); the GSP primer-R sequence is the base sequence of positions 2850-2870 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2883-2906 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); and the WT probe sequence is the base sequence of positions 135-162 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0093]

[0094] (Experimental Example 1, Effectiveness Experiment 1)

[0095] 20 ng of fragmented RNA from FGFR2-Casp7 fusion cell lines and FGFR2-BICC1 fusion cell lines were used as positive templates (the fragmented RNA length was 200-2000 nt), and 20 ng of normal liver cell line LO2 RNA was used as negative control. Reverse transcription and PCR amplification were performed according to the RT system of Example 1. After the program was completed, the results were analyzed using Roche Digital PCR Analysis Software (DigitalLight Data analysis was performed using the ELISA software. The presence of a positive detection was determined based on the droplet fluorescence distribution and the insertion / deletion analysis method. For experimental results, see Figure 2 and Figure 3 .

[0096] Results were interpreted primarily based on fluorescence intensity readings, with cluster analysis performed using 2D scatter plots. First, using the fluorescence intensity of the negative experimental group as a reference, thresholding was performed on both fluorescence channels (FAM + VIC). After thresholding, the resulting graph was divided into four quadrants: the first quadrant contained double-positive droplets, where both FAM and VIC fluorescence were simultaneously excited; the second quadrant contained single-positive droplets, where only FAM fluorescence was excited; the third quadrant contained droplets without any excited fluorescence, i.e., the negative droplet region; and the fourth quadrant contained single-positive droplets, where only VIC fluorescence was excited.

[0097] According to the principle of this technology, the amplification of the FGFR2 wild-type template will simultaneously excite FAM and VIC fluorescence, and the droplets will gather in the first quadrant. When the FGFR2 fusion template is amplified, only VIC will be excited, and the droplets will gather in the fourth quadrant. Negative droplets without any excited fluorescence should gather in the third quadrant.

[0098] from Figure 2 and Figure 3 As can be seen, no positive droplets appeared in the negative experimental group, indicating that this system lacks nonspecific amplification. However, the first and fourth quadrants of the fusion-positive template experimental group (first left) showed obvious droplet aggregation, namely the presence of double-positive droplets and VIC single-positive droplets, corresponding to FGFR2 wild-type detection and FGFR2 fusion detection, respectively. The fusion copy number calculated by the indel method is greater than 1. This result is consistent with expectations and is valid.

[0099] The above experimental results show that this protocol can simultaneously detect and distinguish FGFR2 wild-type targets and FGFR2 fusion targets. In addition to the two groups of FGFR2-driven fusion genes verified in the above experiments, this protocol is also applicable to the detection of other FGFR2-driven fusion targets.

[0100] (Experimental Example 2, Effectiveness Experiment 2)

[0101] 20 ng of the disrupted FGFR2-Casp7 fusion cell line RNA was used as a positive template, and 20 ng of the normal liver cell line LO2 RNA was used as a negative control. Reverse transcription was performed according to the RT system of Example 1. 2.5 μL of the RT product was taken and PCR amplified using the primer-probe system of Examples 2 and 3. After the program was completed, the results were analyzed using Roche Digital PCR Analysis Software (Digital Light Data analysis was performed using the ELISA software. The presence of a positive detection was determined based on the droplet fluorescence distribution and the insertion / deletion analysis method. For experimental results, see Figure 4 (Example 2) and Figure 5 (Example 3).

[0102] from Figure 4 and Figure 5 As can be seen, both positive experimental groups produced double-positive droplets and VIC single-positive droplets, while the negative experimental group produced almost no positive droplets. Furthermore, the fusion copy number calculated by indel analysis was greater than 1. This indicates that the above two sets of primer-probe systems can also effectively detect and distinguish between FGFR2 wild-type and FGFR2 fusion targets.

[0103] (Test Example 3, Repeatability Experiment)

[0104] To determine the detection stability of the FGFR2 fusion detection kit, the disrupted FGFR2-Casp7 fusion cell line RNA was used as the positive template, and three gradient RNA input experimental groups of 20ng, 10ng, and 5ng were set up. At the same time, 20ng of normal liver cell line LO2 RNA was used as the negative control, with 5 replicates per group. The RT system was prepared and reverse transcription was performed according to Example 1, and then 2μL of RT product was taken for PCR amplification. After the program was completed, the results were analyzed using Roche Digital PCR Analysis Software (Digital Light Data analysis was performed using the PCR-based Development Software. The number of wild-type and fusion copies of FGFR2 in each experimental group was counted using the insertion / deletion analysis method. The experimental results are shown in Figure 6 and Table 1.

[0105] Table 1: Repeated detection copy number at different RNA input amounts

[0106]

[0107] from Figure 6 It can be seen that this protocol can achieve specific detection of FGFR2 wild-type and fusion targets for positive samples of 5-20 ng.

[0108] Table 1 shows that the wild-type detection variability among replicate groups at a 5 ng input reached 20%, likely due to the low input amount of wild-type target RNA. However, at 10 ng and 20 ng input, the variability in fusion and copy number detection across five replicate groups was essentially less than 10%, demonstrating good reproducibility within the detection limit of this kit.

[0109] (Test Example 4, Sensitivity Experiment)

[0110] To further determine the sensitivity of the FGFR2 fusion detection kit, the disrupted FGFR2-Casp7 fusion cell line RNA was used as a positive template. Experimental groups with 1000 copies, 100 copies, 10 copies, 5 copies, and 1 copy were set up. Normal liver cell line LO2 RNA was used to supplement the total RNA to 20 ng. At the same time, 20 ng LO2 RNA was used as a negative control. Each group was repeated twice. The RT system was prepared according to Example 1 and reverse transcription and PCR amplification were performed. After the program was completed, the data were analyzed using Roche Digital PCR Analysis Software (Digital PCR). Data analysis was performed using the PCR-based Development Software. The number of FGFR2 fusion copies in each experimental group was counted using the insertion / deletion analysis method. The experimental results are shown in Figure 7 and Table 2.

[0111] Table 2: Detected copy numbers at different FGFR2-BICC1 copy number inputs

[0112] Fusion target input copy number 1000 100 10 5 1 Fusion target copy number detection 961.1862 99.5287 8.2419 3.7209 0 Detection rate (%) 96.12％ 99.53％ 82.41％ 74.42％ 0.00％

[0113] from Figure 7 As can be seen, even when the FGFR2-BICC1 fusion copy number was as low as 5 copies, single-positive VIC droplets were still produced in the system, indicating that the fusion target was detected. The total system copy number detected in each experimental group, calculated based on the copy number calculated using the indel analysis method, is shown in Table 2. When the input fusion copy number was 100 or greater, the kit's fusion detection rate approached 100%. When the input fusion copy number was 10 or less, the kit's fusion detection rate fell below 85%, but was still detectable. No positive detection was detected at an input of 1 copy.

[0114] These results indicate that this kit can detect FGFR2 fusion-positive samples with as few as 5 copies. Because this kit is a single-tube FGFR2 known and unknown fusion detection kit, its sensitivity may be lower than that of a single-tube, single-plex FGFR2 fusion detection kit.

[0115] (Test Example 5, Clinical Positive Sample Detection)

[0116] Three clinical RNA samples (clinical samples 1-3) with confirmed FGFR2-BICC1 and FGFR2-Casp7 fusion positive were collected, each containing 20 ng. 20 ng of normal liver cell line LO2 RNA was used as a negative control. Reverse transcription and PCR amplification were performed according to the RT system and PCR amplification system of Example 1. The results were analyzed using Roche Digital PCR Analysis Software (Digital PCR). Development Software) for data analysis, and the results are shown in Figure 8 and Table 3.

[0117] Table 3: FGFR2 fusion and wild-type transcript copy numbers in clinically positive samples

[0118] sample Fusion (copies / μL) Wild type (copies / μL) Fusion (copies / ng) Wild type (copies / ng) Clinical Sample 1 2.9564 0.0364 17.7384 0.2184 Clinical Sample 2 0.4313 0.0719 2.5878 0.4314 Clinical Sample 3 2.3193 1.5912 13.9158 9.5472

[0119] from Figure 8 As can be seen, there is a more obvious VIC single-positive droplet aggregation in the fourth quadrant of the result diagram of the three clinical samples, indicating that FGFR2 fusion targets exist in all three samples, which is consistent with the clinical test results.

[0120] The FGFR2 wild-type and fusion copy numbers in each sample, obtained after data analysis and conversion, are shown in Table 3. Fusion / wild-type (copies / μL) represents the analysis software output, and fusion / wild-type (copies / ng) represents the converted target concentration in the sample. The results show that in a 30 μL volume, the calculated total mutant gene copy number for all three clinical samples was greater than 1 (total copy number = concentration (copies / μL) × volume (30 μL)), indicating FGFR2 fusion positivity. These experimental results demonstrate the consistency of the detection results of this protocol with clinical test results.

Claims

1. A kit for detecting FGFR2 gene fusion mutations in cholangiocarcinoma, characterized by: Including reverse transcription reagents and PCR expression reagents; The reverse transcription reagent includes reverse transcription primer Uni-N6, reverse transcription buffer and reverse transcriptase; wherein the Uni sequence in Uni-N6 is any artificially synthesized fixed sequence, and N represents a random primer; The PCR expression reagents include primers, probes, DNA polymerase and PCR buffer, wherein the primers and probes include Universalprimer-F, GSP primer-R, Fusion probe and WT probe; Among them, the Universal primer F is a sequence that is identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6; the GSP primer-R primer and the Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript; The WT probe is any sequence on exon 18 of the FGFR2 transcript; When the gene sequence of Uni-N6 is SEQ ID NO.1, the gene sequence of Universal primer F is SEQ ID NO.2, the gene sequence of GSP primer-R is SEQ ID NO.3, the gene sequence of Fusion probe is SEQ ID NO.4, and the gene sequence of WT probe is SEQ ID NO.5; When the gene sequence of Uni-N6 is SEQ ID NO.6, the gene sequence of Universal primer F is SEQ ID NO.7, the gene sequence of GSP primer-R is SEQ ID NO.8, the gene sequence of Fusion probe is SEQ ID NO.9, and the gene sequence of WT probe is SEQ ID NO.10; When the gene sequence of Uni-N6 is SEQ ID NO.11, the gene sequence of Universal primer F is SEQ ID NO.12, the gene sequence of GSP primer-R is SEQ ID NO.13, the gene sequence of Fusion probe is SEQ ID NO.14, and the gene sequence of WT probe is SEQ ID NO.15; The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and WT probe sequences are different; The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WT probe sequence is modified with a quenching group; In the Fusion probe and WT probe, "+" indicates locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are modified with fluorescent groups, 3'BHQ1 is modified with a quencher, and 3'MGB is modified with a 3'-terminal minor groove binder plus an NFQ quencher.

2. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The reverse transcription reagent includes reverse transcription buffer 2-5μL, reverse transcriptase 0.5-2μL, Uni-N6 primer 2X10 -11 Up to 5x10 -11 mol.

3. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: PCR expression reagents include Universal primer-F 1.0X10 -11 to 3.0X10 -11 mol, GSP primer-R1.0X10 -11 to 3.0X10 -11 mol, Fusion probe 5.0X10 -12 to 1.0X10 -11 mol, WT probe 5.0X10 -12 to 1.0X10 -11 mol.

4. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the GSP primer-R and the Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript NM_022970.3; the WT probe is an arbitrary sequence on exon 18 of the FGFR2 transcript NM_022970.

3.

5. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the molar ratio of Universal primer F, GSP primer-R, Fusion probe, and WT probe is 1:1:0.5:0.

5.

6. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to any one of claims 1 to 5, characterized in that: The length of the Uni-N6 sequence in the RNA reverse transcription into cDNA reagent is greater than or equal to 8 bases; in the PCR expression reagent, the length of each primer or probe sequence is greater than or equal to 8 bases.

Images