SNP (Single Nucleotide Polymorphism) molecular marker related to anti-pneumonia character of sheep and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pneumonia-resistant character of sheep and application of the SNP molecular marker, and belongs to the field of molecular biology. It is found for the first time that an SNP site on the ADGRD1 gene is remarkably related to the sheep mycoplasma pneumonia resistance character and can serve as a molecular marker of the sheep mycoplasma pneumonia resistance character, and then the site serves as a breeding target for improving the disease resistance character of sheep. The sheep individual identified by the method has relatively strong mycoplasmal pneumonia resistance, and can be used for breeding new sheep strains with mycoplasmal pneumonia resistance.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker associated with sheep pneumonia resistance traits and an application thereof. Background Art

[0002] Sheep is one of the important sources of animal protein for humans. In the sheep farming industry, mycoplasma pneumonia is a common chronic disease in sheep herds. The growth rate of sick sheep is affected, and serious cases may cause death of sheep, which is very harmful to sheep farming. Therefore, improving the disease resistance of sheep is of great significance for sheep farming. Breeding sheep strains resistant to sheep mycoplasma pneumonia can improve the disease resistance of sheep herds. In sheep breeding, molecular markers with disease resistance can be used to identify individuals with better disease resistance for breeding, but there are currently few molecular markers suitable for selecting disease resistance traits in domestic local sheep breeds.

[0003] As an important receptor in the GPCR superfamily, the adhesion G protein-coupled receptors of the B2 family are not very homologous to the B1 subfamily receptors in terms of transmembrane sequence, and their N-terminal extracellular regions have multiple adhesion factor domains. The 33 receptors of the B2 family were separated to form a new subfamily, named Adhesion G protein-coupled receptors (aGPCR / ADGR), to highlight the dual role of this type of receptor in cell adhesion and signal transduction. According to the conservation of the amino acid sequence of its transmembrane region, aGPCR can be subdivided into 9 groups: ADGRL, ADGRE, ADGRA, ADGRC, ADGRD, ADGRF, ADGRB, ADGRG and ADGRV. Like most members of the G protein-coupled receptor family, the ADGRD1 protein consists of a typical extracellular long N-terminal domain (containing a signal peptide and perforin / concanavalin A domain) and an intracellular C-terminal (containing 7 transmembrane regions). Knocking out ADGRD1 can cause changes in bone density in mice. ADGRD1 has been found to be an oncogene for a variety of cancers, but how it is activated and regulated at the molecular level and its related mechanisms of action remain unclear. ADGRD1 The gene may be related to the animal's disease resistance, but the direct effect of the gene on sheep and its mechanism of action have not been reported. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP molecular marker related to sheep pneumonia resistance traits and application thereof.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a SNP molecular marker associated with the anti-pneumonia trait of sheep, wherein the molecular marker contains ADGRD1The gene has a nucleotide sequence with a polymorphism of T / C at position 352 as shown in SEQ ID NO: 1.

[0006] Furthermore, sheep individuals with the genotype TC at the polymorphic site have higher anti-pneumonia (such as anti-mycoplasma pneumonia) performance than sheep individuals with the genotype CC.

[0007] In the present invention, sheep ADGRD1 The reference sequence number of the gene in NCBI is NC_056070.1, ARS-UI_Ramb_v2.0.

[0008] In a second aspect, the present invention provides primers for amplifying the molecular marker, comprising an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.

[0009] In a third aspect, the present invention provides a detection reagent or a kit containing the primers.

[0010] In a fourth aspect, the present invention provides a method for identifying and breeding sheep strains resistant to pneumonia (such as mycoplasma pneumonia), comprising: 1) Extract the total DNA of the sheep to be tested; 2) using DNA as a template and performing PCR amplification using primers shown in SEQ ID NO: 2-3; 3) Analyze the PCR amplification products.

[0011] Preferably, the PCR reaction system is: 2 × Phanta Max Master Mix 12.5 μL, DNA template 50-100 ng, 10 μM upstream and downstream primers 1 μL each, and ddH2O supplemented to 25 μL.

[0012] Preferably, the PCR reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 34 cycles; final extension at 72°C for 5 min.

[0013] Furthermore, step 3) includes: performing Sanger sequencing on the amplified product to obtain the genotype of the site having the polymorphism, and sheep individuals with genotype TC have higher anti-pneumonia performance than sheep individuals with genotype CC.

[0014] In a fifth aspect, the present invention provides any of the following applications of the molecular marker or its detection reagent: (1) Used for early prediction of pneumonia resistance (such as mycoplasma pneumonia) in sheep; (2) Used for molecular marker-assisted breeding of sheep.

[0015] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention was first discovered in ADGRD1 There is a SNP site on the gene that is significantly associated with the sheep's resistance to mycoplasma pneumonia, which can be used as a molecular marker for the sheep's resistance to mycoplasma pneumonia, and then the site can be used as a target for breeding sheep to improve disease resistance. The sheep individuals identified by this method have relatively strong resistance to mycoplasma pneumonia, which can be used to breed new sheep strains with resistance to mycoplasma pneumonia. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 In a preferred embodiment of the present invention, significant signal sites associated with anti-mycoplasma pneumonia are obtained through whole genome association analysis.

[0017] Figure 2 This is a diagram showing the PCR amplification results of the target SNP site in a preferred embodiment of the present invention, wherein the leftmost band is a DNA marker, and the remaining bands are PCR amplification bands of sheep DNA. DETAILED DESCRIPTION

[0018] The present invention aims to provide a major gene locus and a corresponding detection method that can be used to screen the resistance to mycoplasma pneumonia in local sheep in China.

[0019] The present invention also provides a sheep ADGRD1 Gene SNP molecular markers and their application in sheep breeding.

[0020] The present invention adopts the following technical solution: The invention provides a method for breeding sheep with high resistance to mycoplasma pneumonia. The genotype of position 46115517 of chromosome 17 of sheep is detected, and the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1. Individuals with genotype TC at the site have higher resistance to mycoplasma pneumonia than individuals with genotype CC.

[0021] The present invention also provides the use of a material for detecting the genotype of a SNP site in auxiliary breeding of sheep anti-mycoplasma pneumonia traits, wherein the SNP site is located at position 46115517 of chromosome 17 of the sheep, located at position 352 of the nucleotide sequence described in SEQ ID NO: 1, and has a T / C polymorphism (n=t or c).

[0022] Furthermore, the substance is a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0023] The present invention also provides a primer pair, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0024] The invention also provides a kit, which contains the primer pair.

[0025] The present invention was first discovered in ADGRD1 There is a SNP on the gene that is significantly correlated with the sheep's anti-mycoplasma pneumonia trait. The SNP is located at position 46115517 on chromosome 17 of the sheep and has a T / C polymorphism. When the genotype of the SNP site is TC, it has better anti-mycoplasma pneumonia performance than CC, and can be used as a molecular marker for the sheep's anti-mycoplasma pneumonia trait.

[0026] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0027] Example 1 ADGRD1 Discovery of gene SNP molecular markers A total of 538 Hu sheep tested for mycoplasma pneumonia were resequenced, and combined with the load data of Mycoplasma pneumoniae in sheep nasal swabs obtained by detection, the whole genome association analysis method was used to locate ADGRD1 Gene( Figure 1 ).exist ADGRD1 There is a SNP on the gene that is significantly correlated with the sheep's anti-mycoplasma pneumonia trait. The SNP is located at position 46115517 on chromosome 17 of the sheep (the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) and has a T / C polymorphism. When the genotype of the SNP site is TC, it has better anti-mycoplasma pneumonia performance than CC, and can be used as a molecular marker for the sheep's anti-mycoplasma pneumonia trait.

[0028] Example 2 Detection of SNP Molecular Markers The detection method of SNP molecular markers provided in this embodiment includes: (1) The SNP is located at position 352 of the nucleotide sequence shown in SEQ ID NO: 1. Based on the upstream and downstream sequences of the SNP site, specific primers for amplifying the fragment were designed: Upstream primer ADGRD1F1: 5′-GAAGTCCTGCCAACACAGGAAT -3′ (SEQ ID NO: 2) Downstream primer ADGRD1R1: 5′- AGGTGACAGAGAGCCACTTGT -3′ (SEQ ID NO: 3) (2) PCR amplification was performed on the sheep DNA sample using the specific primers in (1) to obtain an amplification product of the region containing the mutation. The amplification product was 563 bp ( Figure 2). The sequence is as follows (the 352nd base is the mutation sequence), which is a T>C mutation: 5'--3' (SEQ ID NO: 1).

[0029] The amplification system is shown in Table 1: Table 1 ADGRD1 amplification system

[0030] 2 × Phanta® Max Master Mix is ​​a high-fidelity PCR enzyme from Nanjing Novozymes Biotech Co., Ltd., catalog number P525-02.

[0031] Amplification conditions: amplification using a PCR amplification instrument, first stage: 95℃ pre-denaturation for 5min; second stage: 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 34 cycles; third stage: 72℃ final extension for 5min, 4℃ storage. The gel electrophoresis of the amplified product is shown in Figure 2 shown.

[0032] (3) Perform Sanger sequencing on the amplified product to obtain the genotype of the SNP site.

[0033] Example 3 Verification of SNP Molecular Markers The genomes of 127 sheep (Hu sheep breed) were amplified, and the amplification primers, amplification conditions, and amplification system were the same as those in Example 2. The results of PCR product sequencing are shown in Table 2. Five sheep were heterozygous individuals (genotype TC) containing the SNP site, 122 were homozygous mutant individuals (genotype CC), and no wild-type individuals with a genotype of TT were found.

[0034] Table 2 Typing results of different genotypes

[0035] The CT values ​​of all individual Mycoplasma pneumoniae tests (CT values ​​exceeding 32 were negative) were compared, where the CT value size reflected the copy number of the Mycoplasma pneumoniae genome in sheep.

[0036] The comparison results are shown in Table 3. The CT value of heterozygous individuals containing this molecular marker is higher than that of homozygous individuals, that is, the copy number of the Mycoplasma pneumonia genome is lower, which is significantly different, indicating that the Mycoplasma ovis pneumonia load in individuals with genotype TC is low, and this type of individuals has a strong ability to resist Mycoplasma pneumonia.

[0037] The quantitative results of mycoplasma in Hu sheep of different genotypes were statistically analyzed, and the results are shown in Table 3: Table 3 Quantitative results and statistical analysis of different genotypes of Mycoplasma ovis

[0038] Note: Different lowercase letters in the same group indicate significant differences (P<0.05).

[0039] From the above experimental results, it can be seen that the 46115517 site on chromosome 17 of sheep (the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) has a T / C polymorphism. There are two genotypes, CC and TC, in sheep. When the genotype of this SNP site is TC, the copy number of mycoplasma in sheep is significantly reduced. Sheep with genotype TC have better anti-mycoplasma pneumonia performance than CC, and can be used as a molecular marker for sheep anti-mycoplasma pneumonia traits.

[0040] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A SNP molecular marker associated with the pneumonia resistance trait in sheep, characterized in that: The molecular marker contains sheep ADGRD1 The gene has a nucleotide sequence with a polymorphism of T / C at position 352 as shown in SEQ ID NO:

1.

2. The molecular marker according to claim 1, characterized in that Sheep individuals with the TC genotype at the polymorphic site have higher anti-pneumonia performance than sheep individuals with the CC genotype; Preferably, the pneumonia is mycoplasma pneumonia.

3. A primer for amplifying the molecular marker according to claim 1 or 2, characterized in that: It includes an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primer according to claim 3.

5. A method for identifying and breeding a pneumonia-resistant sheep strain, characterized in that: include: 1) Extract total DNA from the sheep to be tested; 2) Using the DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NOs: 2-3; 3) Analyze the PCR amplification products.

6. The method according to claim 5, characterized in that The PCR reaction system was as follows: 12.5 μL of 2 × Phanta Max MasterMix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O added to 25 μL.

7. The method according to claim 5, characterized in that The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; 34 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; and final extension at 72°C for 5 min.

8. The method according to claim 5 or 6, characterized in that Step 3) comprises: performing Sanger sequencing on the amplified product to obtain the genotype of the site having the polymorphism, wherein sheep individuals with the genotype TC have higher anti-pneumonia performance than sheep individuals with the genotype CC; Preferably, the pneumonia is mycoplasma pneumonia.

9. Any of the following uses of the molecular marker or detection reagent thereof according to claim 1 or 2: (1) For early prediction of pneumonia-resistant sheep; (2) Used for molecular marker-assisted breeding of sheep.

10. The use according to claim 9, characterized in that The pneumonia is mycoplasma pneumonia.

Images