SNP-C682T related to grain number per ear of wheat and application of SNP-C682T

Abstract

The invention discloses SNP-C682T related to the number of grains per ear of wheat and application of the SNP-C682T. An SNP site corresponds to a 682th basic group from the 5'tail end of a sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A; when the locus is T / T homozygous, the corresponding genotype is B; the grain number per ear is as follows: the wheat with the homozygous genotype A is greater than or candidate to be greater than the wheat with the homozygous genotype B. The SNP has high effectiveness and potential application value, the wheat with the large grain number per ear can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to SNP-C682T related to wheat grain number and application thereof. Background Art

[0002] As an important food crop in my country, the continuous increase in wheat yield is of great significance to ensuring food security. Wheat yield is a complex trait composed of the number of effective ears per unit area, the number of grains per ear, and the grain weight. In a high temperature and drought environment, the number of grains per ear is easily affected. Therefore, the discovery of the QTL (quantitative traitloci) segment controlling the number of wheat grains per ear and its excellent allele variation provides a theoretical basis for the genetic improvement of the number of grains per ear using molecular marker-assisted selection, and is also of great significance for improving the yield potential of wheat and achieving high and stable yields.

[0003] Huang Lin et al. created a RIL population by crossing Shumai 126, a white-grain wheat variety approved by Sichuan Province with high yield potential, with Taichang 29 for genotypic analysis. A genetic linkage map was constructed using the wheat 55KSNP chip, and phenotypic data of yield-related traits under multiple years and multiple environments were combined: in terms of spike type traits, a major locus QSL.sicau-TS-6D controlling spike length and a major locus QSNS.sicau-TS-2D controlling spikelet number were identified. In addition, they located a major QTL controlling grain width and a major QTL controlling thousand-grain weight on wheat chromosome 1B, and the two were co-located at 2.73Mb between 667.64-670.37Mb on chromosome 1B.

[0004] Lin Yu et al. used H461 and Chinese Spring as parents to construct 300 recombinant inbred line populations, and detected three QTL loci for grain number per ear under multiple environments, which were located on chromosomes 2B, 2DS and 2DL, respectively. These loci explained 3.07% to 26.57% of the phenotypic variation; among them, the major effect locus QGns.sicau-2D-2 located in the AX-109316972-AX-110906716 interval of chromosome 2D was detectable in all environments, explaining 19.59% to 26.57% of the phenotypic variation; another stable locus QGns.sicau-2B was located in the AX-108770043-AX-108927717 interval of chromosome 2B, which was also detectable in all environments and explained 3.32% to 9.36% of the phenotypic variation. Xu et al. constructed 248 recombinant inbred line populations using Bima4 and Aikang 58 as parents and found a QTL for grain number per ear on chromosome 4A, which explained an average of 9.78% to 24.24% of the phenotypic variation.

[0005] Deng S. et al. constructed a population by hybridizing the introgression line 05210 with the wheat variety Laizhou953 and identified that the QTLs for the number of ears per plant, ear length and number of grains per ear were co-located on chromosome 4BL, explaining 30.1% to 67.6% of the phenotypic variation, and were the key QTLs affecting the number of ears and large ear phenotype.

[0006] Yang L. et al. constructed a RIL containing 266 strains through the wheat variety ZM871 and its sister line ZM895, constructed a genetic linkage map using the wheat 660KSNP chip and identified a new QTL for the number of grains per ear on chromosome 5BS in combination with phenotypic data. The map was then verified in the BC1F4 population, laying the foundation for the genetic positioning study of wheat yield traits. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide SNP-C682T related to wheat grain number and application thereof.

[0008] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0009] A SNP site associated with the number of grains per ear in wheat, the SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the size of the number of grains per ear is: the wheat homozygous for the genotype A is greater than or is candidate to be greater than the wheat homozygous for the genotype B.

[0010] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the wheat grain number trait, which is used to detect the SNP site described in claim 1, and the reagent or kit contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0011] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 561-711 bp at the 5' end of SEQ ID NO.1.

[0012] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0013] As a preferred technical solution of the present invention, the enzyme cutting component is the restriction endonuclease SalⅠ.

[0014] On the other hand, the present invention also includes a primer combination for detecting the single nucleotide polymorphism of the following SNP site in the wheat genome, wherein the SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ IDNO.5; this primer combination is used to detect the SNP site described in claim 1.

[0015] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment in the wheat genomic DNA to be tested, including the SNP site described in claim 1, is amplified by PCR, and the PCR amplification product is identified by enzyme digestion.

[0016] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 561-711bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0017] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify a PCR product; diluting the PCR product 100 times, using it as a template, and amplifying a PCR product with primers 2F and 2R as a primer pair to obtain a PCR product; using the restriction endonuclease SalⅠ to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is T / T and the genotype is B; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is A; the size of the number of grains per ear is: the wheat homozygous for genotype A is greater than or the candidate is greater than the wheat homozygous for genotype B.

[0018] In the last aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the trait of wheat grain number per ear.

[0019] The beneficial effect of adopting the above technical solution is that: the research and development team of the present invention has found a SNP, corresponding to the 682nd position from the 5' end of Sequence Table 1, through genetic variation analysis of genes in the natural variation population of wheat. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis has proved that in the homozygous types of these two genotypes, the number of grains per ear is: the wheat homozygous for genotype A is greater than or is a candidate to be greater than the wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of grains per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a schematic diagram of the gene structure pattern and SNP site of the present invention;

[0021] Figure 2 It is the electrophoresis detection result of the SNP development dCAPS marker digestion product of the present invention; wherein, M is used as a molecular weight standard; lane T is a band cut by SalⅠ, and lane C is a band that cannot be cut by SalⅠ;

[0022] Figure 3 This is a schematic diagram of the correlation analysis of the number of grains per ear of the present invention;

[0023] Figure 4 It is a schematic diagram of gene SNP sites and typing in the wheat population material of the present invention. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial sources. It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0025] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0026] Example 1: Detection of SNPs associated with wheat grain number and their PCR-enzyme polymorphism

[0027] 1. Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0028] A SNP was found in the wheat genome, corresponding to position 682 from the 5' end of sequence table 1, see Figure 1 ; There are two genotypes at this locus in the natural variation population of wheat:

[0029] Genotype A: C

[0030] Genotype B: T

[0031] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0032] F1: CCATTGAACGGCGAGCTCCAGTTGTTGGAGTACC (SEQ ID NO. 2);

[0033] R1: GGTTAGATCTTCTATATATATGTTGCCCTATGG (SEQ ID NO.3)

[0034] F2: CCCTTGGATGATCAGCGACCTCCTTGGGGCGCCTCG (SEQ ID NO.4)

[0035] R2: TACGACATCGCGGCGATCAAGTTCCGTCG (SEQ ID NO.5)

[0036] The target sequence amplified by PCR using F1 and R1 as primers is the 8-1049 sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 561-711 sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by SalⅠ, respectively.

[0037] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0038] 1) Extracting genomic DNA of wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCRBuffer, 0.3 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0040] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0041] 3) The PCR product of step 2) was diluted 100 times and used as a template for PCR amplification with primers F2 and R2. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCR Buffer, 0.3 μL each of primer F2 (5 μmol / L) and primer R2 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0042] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 10 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 4) The PCR product obtained in step 3) is digested with SalⅠ to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the said site is determined and recorded according to the following method:

[0044] If the enzyme digestion product is 121 bp, the wheat to be tested is T homozygous (expressed as T / T) at the site (e.g. Figure 2 Lane T in the middle);

[0045] If the enzyme cleavage product is 151 bp, the wheat to be tested is C homozygous (expressed as C / C) at the site (e.g. Figure 2 Lane C in the figure).

[0046] According to the result of step 4), the wheat is divided into two types, I and II, as follows:

[0047] I: C / C (i.e., homozygous for genotype A);

[0048] II: T / T (i.e., homozygous for genotype B);

[0049] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0050] 3. Use dCAPs markers to genotype natural populations and conduct association analysis with the trait of grain number per ear

[0051] Each wheat in the natural population consisting of 320 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0052] Table 1 The situation of the polymorphic sites in natural wheat populations

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2

[0059] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials, including genotyping for genotype A homozygous C / C and genotype B homozygous T / T. Figure 4 Among all 385 materials, 373 materials could be clearly distinguished as homozygous C / C of genotype A or homozygous T / T of genotype B, and the remaining 12 materials could not complete genotyping.

[0060] In addition, 320 of the 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials cannot meet the requirements of subsequent analysis due to insufficient data. Figure 3 As shown, only these 320 data points were used in the association analysis between the genetic polymorphism sites in natural populations and the number of panicles per plant.

[0061] In 2018, the above-mentioned natural population wheat was planted in arid-hot land and dry land, hydrothermal land and water land at the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei); in 2019, it was planted in water land and dry land at the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Hengshui, Hebei); in 2020, it was planted in arid-hot land and dry land, hydrothermal land and water land at the Institute of Crop Sciences of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of grains per ear of each wheat variety was investigated, and the Tassel2.1 software was used to perform association analysis on the situation of the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and Table 2. Figure 3 shown.

[0062] Table 2 Results of association analysis between gene polymorphisms in natural populations and number of grains per ear

[0063]

[0064]

[0065] The results of association analysis in Table 2 show that the difference in the number of grains per ear of the two types formed by the natural population composed of 320 hexaploid wheats shown in Table 1 reached a significant level in eight of the environmental species (P<0.05). Among them, the number of grains per ear of wheat of type I is higher than that of wheat of type II. In these eight environments, the number of grains per ear of wheat materials of type I is 2.74, 2.42, 1.58, 1.96, 3.10, 3.25, 3.24 and 3.31 higher than that of wheat of type II, respectively. Studies on natural populations have shown that type I is an excellent genotype for increasing the number of grains per ear of wheat.

[0066] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0067] From the above embodiments, it can be seen that the present invention has found a SNP through genetic variation analysis of genes of natural variation population of wheat, corresponding to the 682nd position from the 5' end of sequence table 1, and the SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis has proved that in the homozygous types of these two genotypes, the number of grains per ear is: wheat homozygous for genotype A> wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of grains per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0068] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with wheat grain number, characterized in that: The SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for T / T, the corresponding genotype is B; the size of the number of grains per ear is: the wheat homozygous for genotype A is greater than or is candidate to be greater than the wheat homozygous for genotype B.

2. A reagent or kit for identifying or assisting in identifying the wheat grain number trait, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and the reagent or kit comprises a PCR amplification specific primer combination and an enzyme cutting component corresponding to the SNP site, as well as a template DNA, a buffer, dNTPs and other necessary components for gene detection.

3. The reagent or kit according to claim 2, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 561-711 bp at the 5' end of SEQ ID NO.

1.

4. The reagent or kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

5. The reagent or kit according to claim 2, characterized in that: The enzyme cutting component is the restriction endonuclease SalⅠ.

6. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the wheat genome, the SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence table, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

7. A method for identifying or assisting in identifying wheat genotypes, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion.

8. The method for identifying or assisting in identifying wheat genotypes according to claim 7, characterized in that: The DNA fragment amplified by PCR is 561-711 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

9. The method for identifying or assisting in identifying wheat genotypes according to claim 7, characterized in that: The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease SalⅠ to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is T / T and the genotype is B; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is A; the size of the number of grains per ear is: the wheat homozygous for genotype A is greater than or the candidate is greater than the wheat homozygous for genotype B.

10. Use of the SNP locus according to claim 1 in identifying or assisting in identifying the trait of wheat grain number per ear.

Images