7β-Hydroxysteroid Dehydrogenase Mutant and Its Application in the Preparation of UDCA

Abstract

The present invention belongs to the field of protein rational design and enzyme engineering, and specifically relates to a 7β-hydroxysteroid dehydrogenase mutant and its use in the preparation of UDCA. First, the present invention uses Ruminococcus torques 7β-hydroxysteroid dehydrogenase as a template, and obtains the mutant 7β-HSDH-3M through homology modeling prediction to increase hydrogen bonds and site-directed mutagenesis. The 7β-hydroxysteroid dehydrogenase obtained by the present invention has significantly improved thermal stability at 50°C. The enzyme is used to catalyze 80g / L of L7-KLCA to produce UDCA with a conversion rate of over 99%. The high conversion rate of 7β-HSDH achieves complete conversion of the product substrate (>99%).

Description

Technical Field

[0001] The present invention belongs to the field of protein rational design and enzyme engineering, and particularly relates to a 7β-hydroxysteroid dehydrogenase mutant and its application in the preparation of UDCA. Background Art

[0002] Ursodeoxycholic acid (UDCA), the active ingredient in the precious traditional Chinese medicine bear bile, is chemically known as 3α,7β-dihydroxy-5β-cholestane-24-oic acid, also known as ursodeoxycholic acid. It is an FDA-approved drug for the treatment of primary biliary cirrhosis. It is also used to treat cholestatic liver diseases such as primary sclerosing cholangitis, alcoholic and fatty liver disease, viral hepatitis, and drug-induced hepatitis. It is also the preferred drug for dissolving cholesterol stones and is used to treat various gallstone disorders. In 1902, Swedish chemist Hammarsten first discovered UDCA from polar bear bile. In 1927, Shoda of Okayama University in Japan isolated and crystallized UDCA from Chinese black bear bile and named it. In 1954, Kanazawa synthesized UDCA chemically and began clinical use (Journal of Biotechnology, 2014, 191:11-21).

[0003] UDCA is most abundant in bear bile, while its concentration in the bile of other animals is very low. Currently, UDCA is primarily extracted from bear bile, with a small amount synthesized artificially. "Live bear bile extraction" involves extracting UDCA from captive black bears. This method has low yields, long production cycles, and has been controversial due to its ethical violations. Reports of chemical synthesis of UDCA have been published since the 1950s. With the advancement of biotechnology, biocatalysis and combined chemical methods have garnered significant attention due to their mild reaction conditions, high selectivity, and environmental friendliness. Using bile acid (CA) or chenodeoxycholic acid (CDCA), abundantly available in the bile of poultry and livestock, as substrates, and enzymatic or chemical-enzymatic methods, the synthetic production of high-value UDCA can be achieved, reducing the demand for natural bear bile and aligning with contemporary sustainable development concepts.

[0004] Currently, UDCA is produced industrially using a traditional seven-step synthesis method. Starting from bile acid (CA) from bovine and ovine bile, the carboxyl groups are methylated under acidic conditions, followed by diacetylation at the 3- and 7-positions with pyridine / glacial acetic acid to protect the hydroxyl groups. The 12-position hydroxyl group is oxidized with chromium oxide, followed by Wolff-Kishner-Huang Minglong reduction. CDCA is then hydrolyzed to produce 7-carbonyllithocholic acid (7-KLCA), which is then reduced with alkali metal sodium in n-propanol to yield UDCA. This method is complex, has a long synthetic route, is highly reactive, has poor operational safety, and produces a low overall yield (27%-32%), leading to significant environmental pollution.

[0005] In 2009, Riva et al. reported a method for biocatalytically converting CA to 12-carbonylursodeoxycholic acid, which was then chemically reduced to produce UDCA (Adv Synth Catal, 2009, 351:1303-1311). This bioconversion reaction involved three enzymes: 7α-hydroxysterol dehydrogenase (7α-HSDH) and 12α-hydroxysterol dehydrogenase (12α-HSDH) catalyzed the oxidation of CA to 7,12-dicarbonyllithocholic acid. 7β-hydroxysterol dehydrogenase (7β-HSDH) then catalyzed the reduction of 7,12-dicarbonyllithocholic acid to 12-carbonylursodeoxycholic acid. UDCA was then produced via Wolff-Kishner-Huang Minglong reduction. Due to the poor specificity of the enzymes catalyzing the recycling of the coenzyme during this enzymatic redox process, the conversion was incomplete, resulting in low purity of the final UDCA product.

[0006] In 2011, Rolf D. Schmid and CellPharma GmbH of Germany efficiently expressed the 7β-HSDH gene in Escherichia coli, characterized the enzyme's properties, and used it to reduce 7,12-diketo-LCA or 7-KLCA to 12-keto-UDCA or UDCA (Appl Microbiol Biotechnol, 2011, 90:127-135). This enzyme exhibited high selectivity and no byproduct formation. Further optimization yielded mutants with enhanced activity and eliminated substrate inhibition (CN201080062617, CN201180067680). The high conversion rate and specificity of the recombinant enzyme made large-scale enzymatic production of UDCA possible. Furthermore, Xu Jianhe from East China University of Science and Technology cloned and expressed the 7β-HSDH gene from Ruminococcus torques ATCC35915. This enzyme also exhibited high conversion and specificity for the substrate 7-KLCA, similar to the 7β-HSDH from Collinsella aerogenes. However, the UDCA synthesis reaction catalyzed by these different 7β-HSDH sources used low substrate concentrations (4–40 g / L), and at a substrate concentration of 40 g / L, the conversion rate was only 90%, resulting in a product yield of only 71%.

[0007] In 2015, Li Chunxiu and others from East China University of Science and Technology cloned a new 7β-hydroxysteroid dehydrogenase (7β-HSDHRt) from Ruminococcus torques. Through evolutionary modification, they obtained a mutant with a 5.5-fold increase in activity, a 3-fold increase in half-life at 40°C, and a shift in the optimal pH from weakly acidic to weakly alkaline. CDCA was efficiently converted to UDCA through a two-step enzymatic cascade reaction, with a final conversion rate exceeding 99% at a substrate concentration of 100 mM (Process Biochem, 2015, 50:598-604; JAgric Food Chem, 2017, 65:1178-1185; CN107099516A).

[0008] Generally, enzymatic conversion processes are considered viable for industrial production only when they use a substrate concentration of 80 g / L or higher and achieve a conversion rate approaching 100%. However, the original 7β-hydroxysteroid dehydrogenase is difficult to meet the requirements of industrial production due to its low feed rate. At a substrate concentration of 40 g / L, the conversion rate is only 90%, and the product yield is only 71%. The enzyme is also unstable, requiring new enzymes to be used as soon as possible. Long-term storage leads to a sharp decrease in enzyme activity, requiring higher requirements for enzyme preservation and hindering industrial production. This indicates that this enzymatic reaction is still some distance away from industrial large-scale production. Summary of the Invention

[0009] The present invention aims to overcome the shortcomings of the above-mentioned prior art and provide a 7β-hydroxysteroid dehydrogenase mutant and a method for constructing the same. The enzyme is used to catalyze 80 g / L of L7-KLCA to produce UDCA with a conversion rate exceeding 99%, which basically meets the requirements of industrial production.

[0010] The technical solution of the present invention is achieved as follows:

[0011] A 7β-hydroxysteroid dehydrogenase mutant, the amino acid sequence of the 7β-hydroxysteroid dehydrogenase mutant is as follows:

[0012] Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala ThrGlu Gly Val Gly Lys Ala

[0013] Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly ArgArg Glu Glu Lys Leu Gln

[0014] Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val IleArg Ala Asp Phe Ala Gln

[0015] Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met GlyPhe Met Ser Tyr Val Ala

[0016] Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His GluGln Met Ile Asn Val Asn

[0017] Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala LysGln Asp Arg Gly Ala Val

[0018] Ile Asn Val Ser Ser Leu Thr Ala Ile Lys Ser Ser Pro Tyr Asn Ala GlnTyr Gly Ala Gly Lys Ser Tyr

[0019] Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn ValAsp Val Glu Val Ile Thr

[0020] Leu Gly Thr Val Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly ProAla Gly Glu Ala Met Met

[0021] Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn LeuGly Lys Ser Leu Ser Val

[0022] Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala Asn LysThr Asp Asp Glu Tyr Ile

[0023] Arg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0024] As an approach, the 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the threonine at position 189 to valine, the valine at position 207 to methionine, and the serine at position 148 to lysine in the amino acid sequence of the wild-type 7β-hydroxysteroid dehydrogenase SEQ ID NO.2.

[0025] The amino acid sequence of wild-type 7β-hydroxysteroid dehydrogenase, SEQ ID NO.2, is as follows: Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala Thr Glu Gly Val Gly Lys Ala Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly Arg Arg Glu Glu Lys Leu Gln Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val Ile Arg Ala Asp Phe Ala Gln Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met Gly Phe Met Ser Tyr Val Ala Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His Glu Gln Met Ile Asn Val Asn Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala Lys Gln Asp Arg Gly Ala Val Ile Asn Val Ser Ser Leu Thr Ala Ile Ser Ser Ser Pro Tyr Asn Ala Gln Tyr Gly Ala Gly Lys Ser Tyr Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn Val Asp Val Glu Val Ile Thr Leu Gly Thr Thr Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly Pro Ala Gly Glu Ala Val Met Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn Leu Gly Lys Ser Leu Ser Val Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala AsnLys ThrAsp Asp Glu Tyr IleArg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0026] As another embodiment, the 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the serine at position 148 in the amino acid sequence of SEQ ID NO. 3 of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant to lysine.

[0027] The amino acid sequence of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant is as follows:

[0028] Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala ThrGlu Gly Val Gly Lys Ala

[0029] Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly ArgArg Glu Glu Lys Leu Gln

[0030] Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val IleArg Ala Asp Phe Ala Gln

[0031] Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met GlyPhe Met Ser Tyr Val Ala

[0032] Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His GluGln Met Ile Asn Val Asn

[0033] Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala LysGln Asp Arg Gly Ala Val

[0034] Ile Asn Val Ser Ser Leu Thr Ala Ile Ser Ser Ser Pro Tyr Asn Ala GlnTyr Gly Ala Gly Lys Ser Tyr

[0035] Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn ValAsp Val Glu Val Ile Thr

[0036] Leu Gly Thr Val Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly ProAla Gly Glu Ala Met Met

[0037] Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn LeuGly Lys Ser Leu Ser Val

[0038] Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala Asn LysThr Asp Asp Glu Tyr Ile

[0039] Arg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0040] The nucleotide sequence SEQ ID of the wild-type 7β-hydroxysteroid dehydrogenase NO.1 is as follows: ATGAACCTGCGCGAAAAATATGGCGAATGGGGTATTATTCTGGGCGCCACCGAAGGCGTGGGTAAAGCCTTTGCAGAAAAAATTGCAAGCGAAGGTATGAGCGTTGTGCTGGTTGGCCGCCGGAAGAAAACTGCAGGAACTGGGCAAAAGTATTAGCGAAACCTATGGCGTTGATCATATGGTGATTCGC GCCGATTTTGCACAGAGTGATTGTACCGATAAAATTTTTGAAGCCACCAAAGATCTGGATATGGGCTTTATGAGTTATGTTGCCTGCTTTCATACCTTTGGTAAACTGCAGGATACCCCGTGGGAAAAACATGAACAGATGATTAATGTGAACGTTATGACCTTTCTGAAATGTTTTTTACCATTACATGGGTATTTTCGC AAAACAGGATCGCGGCGCCGTGATTAATGTTAGCAGCCTGACCGCCATTAGTAGTAGTCCGTATAATGCCCAGTATGGCGCAGGCAAAAGCTATATTAAAAAAACTGACCGAAGCCGTTGCAGCCGAATGTGAAAGTACCAATGTTGATGTGGAAGTGATTACCCTGGGTACCACCATTACCCCGAGTCTGCTGAGCAATC TGCCGGGCGGCCCGGCTGGTGAAGCAGTTATGAAAACCGCCATGACCCCGGAAGCCTGTGTTGAAGAAGCCTTTGATAATCTGGGTAAAAGCCTGAGCGTTATTGCAGGTGAACATAATAAAAGCCAATGTTCATAATTGGCAGGCCAATAAAACCGATGATGAATATATTCGCTACATGGGTAGCTTTTATAGTAATAAT

[0041] The present invention also provides a gene encoding any of the above-mentioned 7β-hydroxysteroid dehydrogenase mutants.

[0042] The present invention also provides a recombinant expression plasmid comprising the above encoding gene.

[0043] The present invention also provides a recombinant expression transformant comprising the above coding gene or the above recombinant expression plasmid.

[0044] The present invention also provides the use of the 7β-hydroxysteroid dehydrogenase mutant in the preparation of UDCA. The 7β-hydroxysteroid dehydrogenase mutant is coupled with glucose dehydrogenase to achieve cyclic regeneration of the coenzyme NADPH. The amino acid sequence of glucose dehydrogenase SEQ ID NO.5 is as follows: Met Met Thr Glu Gln Lys Ala Ile Val Thr AspAla Pro Lys Gly Gly Val Lys Tyr Thr Thr Ile AspMet Pro Glu Pro Glu His TyrAsp Ala Lys Leu Ser Pro Val Tyr Ile Gly Ile Cys Gly Thr Asp ArgGly Glu ValAla Gly Ala Leu Ser Phe Thr Tyr Asn Pro Glu Gly Glu Asn Phe Leu Val Leu GlyHisGlu Ala Leu Leu Arg Val Asp Asp Ala Arg Asp Asn Gly Tyr Ile Lys Lys GlyAsp Leu Val Val ProLeu Val Arg Arg Pro Gly Lys Cys Ile Asn Cys Arg Ile GlyArg Gln Asp Asn Cys Ser Ile Gly AspPro Asp Lys His Glu Ala Gly Ile Thr GlyLeu His Gly Phe Met Arg Asp Val Ile Tyr Asp Asp IleGlu Tyr Leu Val Lys ValGlu Asp Pro Glu Leu Gly Arg Ile Ala Val Leu Thr Glu Pro Leu Lys AsnVal MetLys Ala Phe Glu Val Phe Asp Val Val Ser Lys Arg Ser Ile Phe Phe Gly Asp AspSer ThrLeu Ile Gly Lys Arg Met Val Ile Ile Gly Ser Gly Ser Glu Ala Phe LeuTyr Ser Phe Ala Gly Val AspArg Gly Phe Asp Val Thr Met Val Asn Arg His AspGlu Thr Glu Asn Lys Leu Lys Ile MetAspGlu Phe Gly Val Lys Phe Ala Asn TyrLeu Lys Asp Met Pro Glu Lys Ile Asp Leu Leu Val Asp ThrSer Gly Asp Pro ThrThr Thr Phe Lys Phe Leu Arg Lys Val Asn Asn Asn Gly Val Val Ile Leu PheGlyThr Asn Gly Lys Ala Pro Gly Tyr Pro Val Asp Gly Glu Asp Ile Asp Tyr Ile ValGlu Arg AsnIle Thr Ile Ala Gly Ser Val Asp Ala Ala Lys Ile His Tyr Val GlnAla Leu Gln Ser Leu Ser Asn TrpAsn Arg Arg His Pro Asp Ala Met Lys Ser IleIle Thr Tyr Glu Ala Lys Pro Ser Glu Thr Asn Ile PhePhe Gln Lys Pro His GlyGlu Ile Lys Thr Val Ile Lys Trp Gln Leu Glu

[0045] The cyclic regeneration of the coenzyme NADPH can effectively, efficiently and specifically convert 7-KLCA into UDCA, thereby realizing the industrial production of enzymatic UDCA synthesis.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] 1. The present invention uses homology modeling and amino acid sequence alignment of the three-dimensional structure of Ruminococcus torques 7β-hydroxysteroid dehydrogenase (PDB: 5FYD), and uses site-directed mutagenesis technology to molecularly modify the existing 7β-hydroxysteroid dehydrogenase, thereby screening and obtaining a 7β-hydroxysteroid dehydrogenase with higher thermal stability.

[0048] 2. The S148K / T189V / V207M triple mutant obtained by screening is based on the original T189V / V207M double mutant SEQ ID NO.3, in which the S148 residue is changed to the K148 residue, forming a hydrogen bond with P199, thereby enhancing the stability of the dimer.

[0049] 3. The original 7β-hydroxysteroid dehydrogenase is difficult to meet the needs of industrial production. The feed amount is low, and the conversion rate is only 90% at a substrate concentration of 40g / L, and the product yield is only 71%. The enzyme has poor stability, and the newly produced enzyme needs to be used as soon as possible. The enzyme activity decreases sharply after long-term storage, and higher requirements are required for the preservation of the enzyme, which is not conducive to industrial production. The triple mutant enzyme of the present invention (7β-HSDH-3M mutant enzyme) retains 91.5% of the original activity after incubation at 50°C for 4h, while the original double mutant (7β-HSDH-2M mutant enzyme) retains 15.6%, and the wild type (7β-HSDH-WT wild type enzyme) only retains 8.8%. The triple mutant enzyme has significantly improved thermal stability at 50°C. The enzyme catalyzes 80g / L of L7-KLCA to produce UDCA with a conversion rate of over 99%. The high conversion rate of 7β-HSDH achieves complete conversion of the product substrate (>99%), and the high conversion rate achieves a single product in the system, which facilitates the separation and purification of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0051] Figure 1 The dimer structure of the T189V / V207M double mutant 7β-HSDH-2M (SEQ ID NO. 3) is shown;

[0052] Figure 2 The dimer structure of the S148K / T189V / V207M triple mutant 7β-HSDH-3M (SEQ ID NO. 4);

[0053] Figure 3 The SDS-PAGE images of 7β-HSDH wild-type and mutant protein expressions are shown;

[0054] Figure 4 This is the HPLC chromatogram of substrate 7-KLCA (80 g / L);

[0055] Figure 5 The figure shows the high performance liquid chromatogram of 7-KLCA (80 g / L) converted by the combined use of 7β-HSDH-3M (SEQ ID NO. 4) and glucose dehydrogenase SEQ ID NO. 5. DETAILED DESCRIPTION

[0056] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0057] Example 1: Site-directed mutagenesis of 7β-HSDH

[0058] 7β-Hydroxysteroid dehydrogenase needs to form a dimer to exert its catalytic activity. The monomer has no catalytic activity. Therefore, the stability of the dimer largely determines the stability of 7β-dehydrogenase.

[0059] (1) Homology modeling and site inference:

[0060] Based on 7β-hydroxysteroid dehydrogenase (PDB: 5FYD), homology modeling analysis using Uniprot and NCBI BLAST revealed that, in the three-dimensional structure of 7β-HSDH (SEQ ID No. 2), serine 148 and proline 199 are hypothesized to be key residues connecting the dimer. Site-directed mutagenesis based on SEQ ID No. 2 allowed for hydrogen bonding between lysine 148 and proline 199. Furthermore, positions 189 to 210 are conserved, so positions 203 and 210 were selected for site-directed mutagenesis.

[0061] The theoretical spatial distance between Serine 148 and Proline 199 before mutation is ( Figure 1 ); Sequence SEQ ID No. 4 was subjected to S148K mutation based on SEQ ID No. 3, and the spatial distance theoretically became ( Figure 2 ).

[0062] (2) Primer design

[0063] Four pairs of mutagenesis primers were designed. One pair was used to construct the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme from the nucleotide sequence of the wild-type 7β-HSDH enzyme. The other three pairs were used to construct the nucleotide sequence of the S148K / T189V / V207M triple mutant 7β-HSDH-3M enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme, the nucleotide sequence of the S148K / A203QV207M triple mutant 7β-HSDH-3M1 enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme, and the nucleotide sequence of the S148K / V207M / T210A triple mutant 7β-HSDH-3M2 enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme.

[0064] V207M-F:

[0065] GCAATCTGCCGGGCGGCCCGGCTGGTGAAGCAATGATGAAAACCGCCAT GACCC (SEQ ID NO. 6);

[0066] T189V-R:

[0067] GGCCGCCCGGCAGATTGCTCAGCAGGCTCGGGGTAATCACGGTGCCCAG GGTAAT(SEQ IDNO.7);

[0068] S148K-F: ACCGCAATTAAAAGCAGCCCGTATAATGCAC (SEQ ID NO. 8); S148K-R: ATACGGGCTGCTTTTTAATTGCGGTCAGACTACTAACAT (SEQ ID NO. 9);

[0069] A203Q-F: CGGCCCGCAGGGTGAAGCAATGATGAA (SEQ ID NO.10)

[0070] A203Q-R:TTCACCCTGCGGGCCGCCCGG(SEQ ID NO.11)

[0071] T210A-F: ATGAAAGCCGCCATGACCCCGGAA (SEQ ID NO.12)

[0072] T210A-R: GGTCATGGCGGCTTTCATCATTGCTTCACC (SEQ ID NO.13)

[0073] (3) Construction of mutant plasmid pET28a-7βHSDH-2M

[0074] The whole plasmid PCR was performed using the recombinant plasmid pET28a-7βHSDH-WT containing SEQ ID No. 2 as a template to obtain the corresponding mutant plasmid pET28a-7βHSDH-2M containing SEQ ID No. 3. After gel recovery, the plasmid was incubated with T5 Exonuclease in an ice bath for 5 minutes, and the linearized pET28a plasmid containing the mutant gene was transformed into E. coli TOP10 competent cells. The transformed E. coli TOP10 was evenly spread on an LB agar plate containing 50 μg / ml kanamycin and incubated inverted at 37°C overnight. The linearized plasmid was recircularized with the help of the E. coli plasmid repair mechanism. Then, a single colony was picked and cultured in LB containing 50 μg / ml kanamycin. The plasmid was extracted and sent to Wuhan Jinkairui Bioengineering Co., Ltd. for sequencing. The plasmid that met the sequencing requirements was named pET28a-7βHSDH-2M, and the double mutant 7βHSDH sequence contained was SEQ ID No. 3, the corresponding expressed 7β-hydroxysteroid dehydrogenase is named as 7βHSDH-2M mutant enzyme.

[0075] (4) Construction of mutant plasmids pET28a-7βHSDH-3M, pET28a-7βHSDH-3M1, and pET28a-7βHSDH-3M2

[0076] Whole-plasmid PCR was performed using the plasmid pET28a-7βHSDH-2M as a template to obtain the corresponding linearized plasmid pET28a-7βHSDH-3M containing the mutant of SEQ ID No. 4. The above operation was repeated to obtain the plasmid pET28a-7βHSDH-3M containing the mutant of SEQ ID No. 4. The corresponding expressed 7β-hydroxysteroid dehydrogenase was named 7βHSDH-3M mutant enzyme.

[0077] The mutant plasmids pET28a-7βHSDH-3M1 and pET28a-7βHSDH-3M2 were constructed using the same method and named as 7βHSDH-3M1 mutant enzyme and 7βHSDH-3M2 mutant enzyme, respectively.

[0078] (5) Protein expression of mutant enzymes

[0079] The constructed plasmid was transformed into E. coli BL21 (DE3) competent cells and evenly spread on LB agar plates containing 50 μg / ml kanamycin. The cells were placed in a 37°C incubator and cultured for about 12 hours. A single colony was picked and cultured in LB containing 50 μg / ml kanamycin. The cells were then transferred to LB containing 50 μg / ml kanamycin for expansion. When the OD600 was about 0.8, IPTG at a final concentration of 0.8 mM was added and induced at 18°C ​​for 18 hours at a speed of 220 rpm. After induction, the cells were collected by centrifugation. A small amount of cells was ultrasonically disrupted and protein samples were prepared. The SDS-PAGE graph showed that the expression and solubility of the three proteins were good ( Figure 3 ).

[0080] Example 2: 7β-HSDH enzyme thermal stability test

[0081] The expression cells of 7β-HSDH-WT, 7β-HSDH-2M, 7β-HSDH-3M, 7βHSDH-3M1 and 7βHSDH-3M2 were weighed respectively, resuspended with an appropriate amount of 50mM phosphate buffer (pH 8.0), and ultrasonically disrupted and centrifuged at 12000rpm for 30min. The supernatant was taken to obtain the crude enzyme solution sample, and the crude enzyme solution sample to be tested was incubated in a 50℃ water bath for 0, 0.5, 1, 2h, and 4h, respectively. After incubation, the enzyme solution was quickly cooled to 25℃ and the enzyme activity was detected.

[0082] 2.7 mL of 50 mM phosphate buffer (pH 8.0) warmed at 25°C, 0.2 mL of 7-ketolithocholic acid (7-KLCA) (2 mg / mL) (dissolved in buffer), and 0.05 mL of a 7β-HSDH crude enzyme sample diluted a certain multiple with 50 mM phosphate buffer (pH 8.0) were mixed in a cuvette, placed in a UV spectrophotometer, and the absorbance value was returned to zero.

[0083] Take 0.05 ml of NADPH (50 mg / mL) and add it to the cuvette, mix well and start timing for 2 minutes. Read the absorbance change at a wavelength of 340 nm within 2 minutes and calculate △OD / min.

[0084] Blank control: The operation process is the same as above, but the enzyme in the reaction system is replaced by an equal amount of Tris / HCl buffer, and the measured result is the negative control.

[0085] Definition of enzyme activity unit:

[0086] Enzyme activity (U / mL) = △OD / min*Vt*df / (6.22*1.0*Vs)

[0087] Where Vt: total reaction volume 3.05 mL; df: dilution factor;

[0088] 6.22: NADPH extinction coefficient at 340 nm; 1.0: measurement pathlength;

[0089] Vs: 7β-HSDH enzyme solution volume (0.05 mL)

[0090] The enzyme activities of each enzyme after incubation in a 50°C water bath were measured using the above method and are shown in the following table:

[0091]

[0092] It can be seen that the activity of the 7β-HSDH-3M mutant enzyme retained 91.5% of the original after incubation at 50°C for 4 h, while that of the 7β-HSDH-2M mutant enzyme was 15.6% and that of the 7β-HSDH-WT wild-type enzyme was only 8.8%. The stability of the 7β-HSDH-3M mutant enzyme after incubation at 50°C for 4 h was 9.4 times that of the wild-type enzyme and 4.9 times that of the 7β-HSDH-2M mutant enzyme. The site-directed mutagenesis of the 7β-HSDH-3M1 mutant enzyme based on the 7β-HSDH-2M mutant enzyme did not cause significant changes in activity and stability, while the activity and stability of the 7β-HSDH-3M2 mutant enzyme based on the 7β-HSDH-2M mutant enzyme were significantly decreased. Therefore, among the three triple-point mutants, the 7β-HSDH-3M mutant enzyme had the best mutation effect, and its thermal stability at 50°C was significantly improved.

[0093] Example 3: 7β-HSDH combined with SYGDH catalyzes 7-KLCA to produce UDCA

[0094] 2 g of 7β-HSDH bacterial slurry and 1 g of SYGDH bacterial slurry (glucose dehydrogenase expressing bacteria, E. coli BL21 (DE3)) were weighed and resuspended in 40 mL of 100 mmol / L potassium phosphate buffer (pH 8.0), and ultrasonically disrupted to prepare a crude enzyme solution.

[0095] 10 g crude 7-KLCA, 11.2 g glucose, 30 mg NADP+, and 20 ml n-hexanol were weighed and diluted to 125 ml with 100 mmol / L potassium phosphate buffer (pH 8.0). The reaction was carried out at 35°C and 220 rpm for 8 h. The pH was controlled between 7.9 and 8.1 during the reaction. After 4 h of reaction, the conversion rate of catalyzed 7-KLCA (80 g / L) was 99.21% as determined by liquid chromatography. However, after 6 h of reaction, the conversion rate of the original double mutant 7β-HSDH-2M mutant enzyme (SEQ ID NO. 3) was only 95.71%. The HPLC chromatogram of the substrate 7-KLCA (80 g / L) is shown below. Figure 4The HPLC chromatogram of the combined use of mutant 7β-HSDH-3M (SEQ ID NO.4) and glucose dehydrogenase (SEQ ID NO.5) to convert 7-KLCA (80 g / L) is shown in FIG. Figure 5 shown.

[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A 7β-hydroxysteroid dehydrogenase mutant, characterized in that The amino acid sequence of the 7β-hydroxysteroid dehydrogenase mutant is shown in SEQ ID NO.

4.

2. The 7β-hydroxysteroid dehydrogenase mutant according to claim 1, characterized in that The 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the threonine at position 189 to valine, the valine at position 207 to methionine, and the serine at position 148 to lysine in the amino acid sequence of the wild-type 7β-hydroxysteroid dehydrogenase SEQ ID NO.

2.

3. The 7β-hydroxysteroid dehydrogenase mutant according to claim 1, characterized in that The 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the serine at position 148 in the amino acid sequence SEQ ID NO. 3 of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant to lysine.

4. A coding gene, characterized in that The encoding gene encodes the 7β-hydroxysteroid dehydrogenase mutant according to any one of claims 1 to 3.

5. A recombinant expression plasmid, characterized in that: Comprising the coding gene according to claim 4.

6. A recombinant expression transformant, characterized in that: Comprising the coding gene according to claim 4 or the recombinant expression plasmid according to claim 5.

7. Use of the 7β-hydroxysteroid dehydrogenase mutant according to any one of claims 1 to 3 in the preparation of UDCA, characterized in that: The 7β-hydroxysteroid dehydrogenase mutant and glucose dehydrogenase are coupled to react to realize the cyclic regeneration of the coenzyme NADPH.

Images