Novel Cas12a nuclease-BEST10 and application thereof

Abstract

The invention discloses a novel Cas12a nuclease-BEST10 and an application of the novel Cas12a nuclease-BEST10. The invention provides a CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated protein 12a) system, a Cas12a protein (SEQ ID No. 1) and crRNA (complementary Ribonucleic Acid); the crRNA comprises a guide sequence complementary to a targeting sequence and can be combined with the Cas12a protein; the targeting sequence is located on a target gene to be edited; on the target gene, a PAM motif located on the upstream of the target sequence is 5 'TTN. In the invention, the cleavage activity and the affiliated cleavage activity of BEST10 gene editing are verified, and a CRISPR tool library available for in-vitro detection is expanded, and the method can be applied to multiple fields of nucleic acid detection, gene editing, gene therapy, high-throughput sequencing and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a novel Cas12a nuclease-BEST10 and applications thereof. Background Art

[0002] CRISPR (clustered regularly interspaced short palindromic repeats) systems can be divided into class 1 and class 2 according to homology. Class 1 includes type I, type III and type IV, and class 2 includes type II, type V and type VI. The most obvious feature of class 2 is that it is composed of a single Cas protein (CRISPR-associated protein) and crRNA (CRISPR RNA) to form a complex, perform targeted cutting functions, and is simpler to operate (such as Figure 1 ). Although the Class 2 system has only a single effector protein, the different types of effector proteins that have been discovered have obvious differences in protein molecular weight, structural domain, crRNA, PAM (Protospacer-adjacent motif) preference and nucleic acid cleavage method, providing a more flexible option for gene editing. For example, the well-known Cas9, Cas12, and Cas13a all belong to Class 2 (Makarova et al., 2020). Compared with gene editing technologies such as ZFN (zinc-finger nucleases) and TALEN (transcription activator-like effector nucleases), the CRISPR / Cas system has obvious advantages such as good specificity, wider targeting, simple steps, simultaneous editing of multiple sites, and low cost (Shan Qiwei, 2015).

[0003] In 2015, it was first reported that the new nuclease Cas12a can bind to and cut specific sites of target DNA under the guidance of single-stranded guide RNA, and verified the effectiveness of 8 Cas12a family proteins in genome editing in mammalian cells HEK293FT (Zetsche et al., 2015). The shorter guide RNA backbone part (crRNA only) is easier to identify and predict than Cas9, making the assembly of Cas12a gene editing tools more convenient and efficient. Its own preference for T-rich PAM recognition properties has greatly enriched the site selection of editing tools in genome editing.

[0004] In addition, studies have found that after the Cas12 and Cas13 family Cas proteins exert specific cutting effects, they will activate their non-specific incidental cutting activity (Chen et al., 2018; Liu et al., 2017). If fluorescence-quenched short nucleotide molecules are added to the reaction system, the activated Cas proteins will non-specifically cut these short nucleotide molecules, releasing fluorescent signals to achieve the purpose of detecting the target sequence. The CRISPR / Cas system has been successfully used in nucleic acid detection due to its unique DNA or RNA-specific cutting and non-specific incidental cutting activities (Zhu et al., 2020).

[0005] As an acquired immune mechanism of prokaryotes, the CRISPR / Cas system has RNA-mediated nuclease activity. The earliest discovered system that can be used for gene editing is the Cas9 system mediated by crRNA and tracrRNA (Jinek et al., 2012a). This system uses certain Cas proteins, mainly Cas1 and Cas2, to capture phage virus DNA or exogenous plasmid DNA and insert it into its own positive repeat sequence to form a CRISPR sequence. The CRISPR sequence is transcribed into pre-crRNA, which is processed and modified into crRNA to form RNP with Cas9, which has RNA-guided DNA endonuclease activity (such as Figure 2 ). When the bacteria are infected with the virus again, the invading DNA can be targeted for cutting, and this process also requires the participation of tracrRNA (Trans-activating crRNA) and the presence of PAM for specific recognition (Barrangou et al., 2007). The CRISPR / Cas system is widely used in gene editing because of its RNA-mediated nuclease activity.

[0006] From the laboratory of Jennifer Anna Doudna first proving the gene editing activity of Cas9, to the laboratory of Zhang Feng applying it to mammalian cell gene editing, to the nucleic acid detection methods developed using the accessory cleavage activity of Cas13a / Cas12a: SHERLOCK (Specific High-Sensitivity Enzymatic Reporter UnLOCKing) and DETECTR (Endonuclease Targeted CRISPR Trans Reporter) (Cong et al., 2013; Jinek et al., 2012b; Joung et al., 2020; Patchsung et al., 2020). Especially after the outbreak of the new coronavirus, pathogen detection research based on nucleic acid detection of the CRISPR / Cas system has rapidly emerged. For example, the DETECTR platform of Jennifer Anna Doudna's laboratory is based on RPA (Recombinase Polymerase Amplification) and Cas12a's ssDNA cleavage activity; the SHERLOCKv2 kit of Feng Zhang's laboratory is based on LAMP (loop-mediated isothermal amplification) and lwaCas13a's ssRNA cleavage activity; and the HOLMES (one-HOur Low-cost Multipurpose highly Efficient System) method of Tolo Biotech (such as Figure 3 ).

[0007] CRISPR technology has developed rapidly and can be applied to gene editing in bacteria, archaea and eukaryotic cells, but it has also exposed many problems (Doudna and Charpentier, 2014). The recognition of target sequences by the CRISPR / Cas system is heavily dependent on the presence of PAM sequences. The limitations of PAM greatly limit its application range in cell editing and nucleic acid detection (Walton et al., 2020). Secondly, the problem of off-target rate, off-target effects caused by low specificity, large fragment deletion and complex gene recombination need to be paid attention to (Kosicki et al., 2018; Zheng Wu, 2015). Although the engineered CRISPR / Cas system has significantly improved its specificity and has been applied to gene therapy, such as β-thalassemia and sickle cell anemia, the limitations of its PAM still restrict its application range (Papizan et al., 2020; Slaymaker et al., 2016; Traxler et al., 2016). Currently, the commercialized Cas proteins mainly include SpCas9 restricted by the 3' end PAM NGG and LbCas12a / AsCas12a restricted by the 5' end PAM TTTN (Jinek et al., 2012b; Jinek et al., 2014; Yamano et al., 2016). The T-rich PAM dependence of the Cas12a system greatly limits its application in gene editing and nucleic acid detection.

[0008] For pathogen detection methods based on the CRISPR / Cas system, the target sequence must be conservative, otherwise the detection method will lose its effect when the pathogen mutates in the sequence. For example, for the detection of the new coronavirus, the available sites are very limited. According to statistics from the National Center for Bioinformation, the new coronavirus has produced more than 29,410 single nucleotide variants (such as Figure 4 ). Because the cleavage efficiency of each Cas protein for different nucleotide sequences is different, and due to the limitation of PAM, a Cas protein may find it difficult to achieve a high cleavage efficiency at the only available site, thus affecting the sensitivity of detection. Summary of the invention

[0009] The purpose of the present invention is to provide a novel Cas12a nuclease-BEST10 and applications thereof.

[0010] In a first aspect, the present invention claims a CRISPR-Cas12a system.

[0011] The CRISPR-Cas12a system claimed in the present invention comprises or consists of the following:

[0012] (A1) Cas12a protein (i.e., BEST10), the amino acid sequence of which is shown in SEQ ID No. 1;

[0013] (A2) crRNA; the crRNA comprises a guide sequence complementary to the targeting sequence and is capable of binding to the Cas12a protein;

[0014] The cRNA is composed of the guide sequence and the backbone sequence. The backbone sequence can form a neck loop structure. In a specific embodiment of the present invention, the backbone sequence is specifically shown in positions 1-19 of SEQ ID No.3.

[0015] The targeting sequence is located on the target gene to be edited; on the target gene, the PAM motif located upstream of the targeting sequence is 5'TTN, where N is A or T or C or G.

[0016] Wherein, the Cas12a protein (ie, BEST10) and the crRNA are capable of forming a CRISPR complex, and the CRISPR complex specifically binds to a target nucleic acid containing the targeting sequence and induces modification of the target nucleic acid.

[0017] Furthermore, the PAM motif is not 5'TTTN, and N is A or T or C or G.

[0018] In a second aspect, the present invention claims a composition for gene editing.

[0019] The composition for gene editing claimed in the present invention may be selected from any one of the following:

[0020] 1. A composition comprising or consisting of: a nucleic acid molecule 1 encoding a Cas12a protein (i.e., BEST10), and crRNA;

[0021] II. A composition comprising or consisting of: a Cas12a protein (i.e., BEST10), and a nucleic acid molecule 2 encoding crRNA;

[0022] III. A composition comprising or consisting of: a nucleic acid molecule 1 encoding a Cas12a protein (i.e., BEST10), and a nucleic acid molecule 2 encoding a crRNA;

[0023] IV. A composition comprising or consisting of: a nucleic acid molecule 3 encoding a Cas12a protein (i.e., BEST10) and crRNA;

[0024] The crRNA comprises a guide sequence complementary to the targeting sequence and is capable of binding to the Cas12a protein; the targeting sequence is located on the target gene to be edited; on the target gene, the PAM motif located upstream of the targeting sequence is 5'TTN, and N is A or T or C or G.

[0025] Furthermore, the PAM motif is not 5'TTTN, and N is A or T or C or G.

[0026] In a third aspect, the present invention claims a composition for nucleic acid detection.

[0027] The composition for nucleic acid detection claimed in the present invention may include or consist of the following:

[0028] (B1) the CRISPR-Cas12a system described in the first aspect above or the composition described in the second aspect above;

[0029] (B2) Single-stranded DNA carrying a reporter molecule.

[0030] Since the Cas12a protein (i.e., BEST10) has the activity of cutting single-stranded DNA of any sequence after cutting double-stranded DNA of a specific sequence under the guidance of the crRNA, it can be used in the field of nucleic acid detection. Among them, the reporter molecule can produce a molecule that can evaluate the signal (such as a visual signal) and does not affect the biological activity of the labeled substance. The reporter molecule can be composed of a fluorescent group and a quenching group. For example, a fluorescent group is labeled at one end of the single-stranded DNA and a quenching group is labeled at the other end; the length of the single-stranded DNA must meet the following conditions: when the single-stranded DNA is not cut, the fluorescent group and the quenching group can be close to not fluoresce. When the single-stranded DNA is cut, the fluorescent group and the quenching group are far away, thereby fluorescing.

[0031] In a fourth aspect, the present invention claims protection for any of the following methods:

[0032] Method I: A method for editing a target gene, comprising: introducing the CRISPR-Cas12a system described in the first aspect of the above text or the composition described in the second aspect of the above text into an organism or a biological cell, so that both the Cas12 protein (i.e., BEST10) and the crRNA are expressed, thereby achieving editing of the target gene in the organism or the biological cell.

[0033] Method II: A method for nucleic acid detection, comprising: adding the composition described in the third aspect above to the sample to be tested, conducting a reaction, and determining whether the sample to be tested contains the target nucleic acid based on whether the reporter molecule generates an evaluable signal (such as a visible signal) after the reaction.

[0034] In the method, the targeting sequence is located on a target gene to be edited or detected; on the target gene, the PAM motif located upstream of the targeting sequence is 5'TTN, where N is A or T or C or G.

[0035] Furthermore, the PAM motif is not 5'TTTN, and N is A or T or C or G.

[0036] In a fifth aspect, the present invention claims protection for any of the following applications:

[0037] (C1) Application of the CRISPR-Cas12a system described in the first aspect or the composition described in the second aspect for non-disease diagnosis and treatment in editing target genes;

[0038] (C2) Use of the CRISPR-Cas12a system described in the first aspect or the composition described in the second aspect in the preparation of a product for editing a target gene;

[0039] (C3) Use of the composition described in the third aspect above in nucleic acid detection;

[0040] (C4) Use of the composition described in the third aspect above in the preparation of nucleic acid detection products.

[0041] In the process of editing or detecting the target gene, the sequence on the target gene that meets the following rules is used as the PAM motif: 5'TTN, N is A or T or C or G.

[0042] Furthermore, the PAM motif is not 5'TTTN, and N is A or T or C or G.

[0043] In a sixth aspect, the present invention claims protection for any of the following applications:

[0044] (D1) Non-disease diagnostic application of the composition described in the third aspect or the method II described in the fourth aspect in pathogen detection;

[0045] (D2) Use of the composition described in the third aspect above in the preparation of a pathogen detection product;

[0046] (D3) Non-disease diagnostic application of the composition described in the third aspect or the method II described in the fourth aspect in biological sample detection;

[0047] (D4) Use of the composition described in the third aspect above in preparing a biological sample detection product;

[0048] (D5) Use of the CRISPR-Cas12a system described in the first aspect or the composition described in the second aspect in the preparation of a gene therapy product;

[0049] (D6) Application of the CRISPR-Cas12a system described in the first aspect above, or the composition described in the second aspect above, or the composition described in the third aspect above, or the method described in the fourth aspect above in high-throughput sequencing.

[0050] In the application, the sequence on the target gene that meets the following rules is used as the PAM motif: 5'TTN, N is A or T or C or G.

[0051] Furthermore, the PAM motif is not 5'TTTN, and N is A or T or C or G.

[0052] In a seventh aspect, the present invention claims protection for a kit for detecting COVID-2019.

[0053] The kit for detecting COVID-2019 claimed in the present invention may include

[0054] (E1) Cas12a protein (i.e., BEST10) or its encoding nucleic acid; the amino acid sequence of the Cas12a protein (i.e., BEST10) is shown in SEQ ID No.1;

[0055] (E2) crRNA, or a nucleic acid encoding the crRNA; the nucleotide sequence of the crRNA is shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, or SEQ ID No.9 followed by SEQ ID No.10;

[0056] (E3) Single-stranded DNA carrying a reporter molecule.

[0057] Wherein, the reporter molecule is the same as described in the third aspect above.

[0058] In a specific embodiment of the present invention, the single-stranded DNA carrying the reporter molecule is specifically: 5'-FAM-AAAAAA-BHQ1.

[0059] In the eighth aspect, the present invention claims protection for the non-disease diagnostic application of the kit described in the seventh aspect above to detect whether the sample to be tested contains COVID-2019, such as blood product quality control, to detect whether the blood products are qualified.

[0060] In the present invention, the crRNA may be further chemically modified as needed.

[0061] In the present invention, the CRISPR-Cas12a system can also be used in combination with PCR amplification or isothermal amplification, for example, for pathogen detection.

[0062] Furthermore, a reverse transcription step can be added for RNA detection.

[0063] Furthermore, a sample lysis and extraction step may be added for the detection of biological samples.

[0064] Experiments have shown that the BEST10 system was found in the Moraxella bovoculi 58086 strain, which has a wider range of PAM sites than lbCas12a. In the present invention, the cleavage and accessory cleavage activities of BEST10 gene editing have been verified, expanding the CRISPR tool library available for in vitro detection. The present invention can be applied to multiple fields such as nucleic acid detection, gene editing, gene therapy, and high-throughput sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 Schematic diagram of the gene editing principle of the CRISPR / Cas12a system.

[0066] Figure 2 The typical CRISPR locus structure of the Class 2 CRISPR / Cas system consists of CRISPR and a series of Cas proteins. The tracrRNA is located before the Cas operon and encodes a unique non-coding RNA that is homologous to the CRISPR repeat sequence (Jiang and Doudna, 2017).

[0067] Figure 3 For the SHERLOCK and DETECTR technical process (Mustafa and Makhawi, 2021).

[0068] Figure 4 Annotation information for novel coronavirus mutations [https: / / ngdc.cncb.ac.cn / ncov / variation / annotation].

[0069] Figure 5 The PAM preference results of the chip detection Cas12a system.

[0070] Figure 6 Electrophoresis diagram of dsDNA cleavage by Cas12a system in vitro. M DL2000; +Cas+crRNA+dsDNA; -dsDNA.

[0071] Figure 7 It is an assay for the accessory cleavage activity of the Cas12a system. DETAILED DESCRIPTION

[0072] Using the applicant's own bioinformatics prediction process (see patent "A method and device for screening new CRISPR-Cas systems" application number: 201610741844.0), new wild-type Cas12a is predicted in the database. Combining the previous and unique optimized molecular experimental techniques, a variety of new Cas12a proteases with potential gene editing functions are obtained and evaluated. The method of Example 1 was used to express and purify the mutant protease, the method of Example 2 was used to identify the PAM sequence, and Example 3 was used to evaluate the substrate cleavage ability. Then in Example 4, the accessory cleavage ability of each mutant, the enzymatic reaction activity in nucleic acid detection, and other angles were evaluated. The results show that BEST10 found in the Moraxella bovoculi 58086 strain has a wider PAM site than lbCas12a.

[0073] When nucleic acid detection is performed based on Cas12a, the design of the target site and the corresponding crRNA follows the following rules: (1) Select a conserved sequence in the target gene, (2) Then select possible target sites in the conserved sequence based on the PAM restriction of the Cas nuclease, and (3) Design a one-to-one corresponding crRNA for the target site. The enzymatic reaction activity of the Cas nuclease at different target sites is then evaluated using a fluorescent reporter system. For the reaction system, the crRNA buffer system, ionic strength, and Mg concentration are adjusted. 2+ ion concentration to achieve improved crRNA stability and fluorescence signal response intensity.

[0074] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0075] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0076] Example 1: Experiment of expressing and purifying Cas12a system effector protein

[0077] Before protein expression and purification, the physicochemical properties of the protein, including isoelectric point, relative molecular mass, extinction coefficient, etc., were analyzed based on the protein sequence using the ProtParam tool provided by ExPasy (https: / / web.expasy.org / protparam / ) to adjust the purification process and buffer.

[0078] The protein coding sequence was obtained by PCR amplification, and the NcoI and SacI sites were inserted into the pET28a(+) vector and constructed by restriction endonuclease ligation. The obtained recombinant plasmid was introduced into the competent cells BL21(DE3) (Takara) by heat shock transformation, and 300μL of antibiotic-free medium was added for 60min. The plate (LB plate, kanamycin resistance) was cultured at 37℃ overnight, and a single colony was selected for expansion. The protein-expressing BL21(DE3) cells were cultured in LB medium (supplemented with 50mg / L kanamycin) at 37℃ until OD600 reached 0.6, and protein expression was induced by adding 0.5mM isopropyl β-D-thiogalactopyranoside (IPTG). BL21(DE3) cells were further cultured at 16℃ overnight (low temperature induction). The cells were collected by centrifugation at 6000rpm and 4℃ for 10min, and the collected cells were resuspended in 1g:20mL binding buffer (formula: 50mMTris-HCl, pH7.8, 500mM NaCl, 5mM imidazole), and the cells were lysed by ultrasonic disruption. Lysozyme (10mg / mL) and PMSF (0.1M) were added at a volume ratio of 1:100 before ultrasonic disruption. The cells after ultrasonic disruption were centrifuged at 12000rpm and 4℃ for 60min, and the supernatant was collected.

[0079] (1) Affinity chromatography. Because the target protein carries a His tag, a Ni-NTA gravity column is first used for affinity chromatography to purify the protein. Before use, the filler should be washed three times with water and once with binding buffer. The filler is combined with the bacterial supernatant for 30 minutes, and is fully shaken every 5 minutes to allow as many target proteins as possible to bind to the Ni on the filler. Collect the flow-through. Wash with 5% elution buffer (formula: 50mM Tris-HCl, pH7.8, 500mM NaCl, 500mM imidazole) and collect the washed components. Elute the target protein with 50% elution buffer. Collect the target protein. Rinse the filler with elution buffer and collect the components. All collected components are sampled for SDS-PAGE to confirm the purification efficiency and recovery efficiency of the target protein.

[0080] (2) Molecular sieve chromatography. Use a 50K ultrafiltration tube to concentrate the target protein component to a volume of <2 mL and filter with a 0.56μm filter membrane. Use AKTA (Cytiva) to separate proteins of different molecular weights through HiLoad 16 / 600Superdex 200pg (Cytiva). Load the sample with a 2mL sample loop and pass through the chromatography column in a low-salt buffer (formula: 30mM phosphate, pH 7.0, 150mM NaCl, 0.4mM DTT) at a flow rate of 0.5mL / min. The collection plate is continuously collected. Samples are taken from the collection tubes at all UV peaks for SDS-PAGE electrophoresis to confirm the target protein component.

[0081] (3) Ion exchange chromatography. The target protein fraction was supplemented with low-salt buffer to 20 mL. Filtered with a 0.56 μm filter membrane, the protein was separated and purified by HiTrap Capto SPImpRes (Cytiva) using AKTA. The target protein was loaded onto the column and gradient eluted with 50% high-salt buffer (formula: 30 mM phosphate, pH 7.0, 1 M NaCl, 0.4 mM DTT). The collection plate was continuously collected. Samples were collected from each tube for SDS-PAGE electrophoresis to confirm the purification efficiency and recovery efficiency. For systems with poor purity (<90%), cation exchange was used for further purification. The main peak collection tube fraction was concentrated using a 50 kDa ultrafiltration tube to a volume of <3 mL, and supplemented with low-salt buffer to 20 mL. The above process was repeated to reduce the NaCl content in the target protein fraction. The protein was separated and purified by HiTrap Capto Q ImpRes (Cytiva) using AKTA. The target protein was loaded onto the column and gradient eluted with 50% high-salt buffer. The collection plate is continuously collected. Samples from each tube are collected and subjected to SDS-PAGE electrophoresis to confirm the purification efficiency and recovery efficiency.

[0082] Use 50K ultrafiltration tube to concentrate protein, measure absorbance A280 (1Abs = 1mg / mL) with ELISA, divide by extinction coefficient to get the real protein concentration. Add 70% sterile glycerol at a volume ratio of 1:1 and store at -20°C.

[0083] In this example, the Cas12a system effector protein, BEST10 protein, was screened, and its specific information is shown in Table 1. The amino acid sequence is shown in SEQ ID No. 1, and the corresponding coding gene sequence is shown in SEQ ID No. 2.

[0084] Table 1. Protein sequences expressed and purified in Example 1

[0085]

[0086]

[0087]

[0088]

[0089] Example 2, Experiment for Identifying Cas12a PAM Sequences

[0090] The PAM of each Cas12a nuclease was identified using the DocMF (Li et al., 2020) method published by the applicant. The specific DocMF experimental process includes DNA library and DNB preparation, on-machine sequencing, and protein cleavage and imaging. The DNA library consists of a 23nt fixed sequence region and 15nt random base regions on both sides. The fixed sequence is used as the gRNA target sequence, and the random base region is used as the PAM recognition site. As shown in Table 2, the PAM sequence identified by BEST10 is TTN according to bioinformatics analysis, and N is A or T or G or C (such as Figure 5 ).

[0091] Among them, the nucleic acid sequences used in PAM identification are shown in Table 2.

[0092] Table 2. Nucleotide sequences used in PAM identification

[0093]

[0094] Example 3, in vitro cleavage experiment of Cas12a system

[0095] The in vitro cleavage experiment of the Cas12a system was performed according to the following scheme:

[0096] 1. For in vitro synthesis of crRNA and double-stranded DNA substrates used in in vitro cleavage experiments, the DNA concentration was not less than 40 ng / μL and the crRNA concentration was not less than 800 ng / μL.

[0097] Among them, the target double-stranded DNA sequence (bold is Spacer) is as follows:

[0098]

[0099] The corresponding crRNA is shown in Table 2 (SEQ ID No. 3).

[0100] 2. Mix 2 μL 10×NEB buffer 3.1, 2 μL 10-30 μM Cas12a protein (prepared in Example 1), and 1-2 μL crRNA, add RNase-free water to 16 μL, shake and mix, incubate at room temperature for 15 min, add 4 μL substrate DNA, and incubate at 37 ° C for 3-4 hours. Lba Cas12a (Cpf1) (New England Biolabs, M0653T) was used as a positive control.

[0101] 3. Take 10 μL of the cleavage product and perform electrophoresis on 1% agarose gel.

[0102] Agarose electrophoresis showed ( Figure 6 ), after BEST10 binds to the corresponding crRNA, it can cut the target double-stranded DNA, and the size of the cleavage product fragment is consistent with expectations.

[0103] Example 4, experiment of Cas12a system accessory cutting

[0104] 1. Preparation of crRNA

[0105] RNA via MEGAshortscript TM The RNA was transcribed by T7 Transcription Kit, and the corresponding DNA template was synthesized by BGI Liuhe. 2 pmol of double-stranded DNA template was added and transcribed using Bio-rad S1000TM polymerase chain reaction (PCR) instrument at 37°C for 12 hours. RNA was purified by saturated phenol, chloroform and isopropanol solution. TM RNA HS Assay Kit was used for quantification.

[0106] The final crRNA sequence information is shown in Table 3.

[0107] Table 3. crRNA sequences used in Example 4

[0108] BEST10-COVID-23ntp84-1R AAUUUCUACUGUUUGUAGAUAAUAGAAAAGUCCUAGGUUGAAG SEQ ID No.6 BEST10-COVID-23ntp84-2R AAUUUCUACUGUUUGUAGAAUCUACAGUGAAGGAUUUCAACGUA SEQ ID No.7 BEST10-COVID-23ntp84-3R AAUUUCUACUGUUUGUAGAUGGGAAGUUUUUAACGCCACCAG SEQ ID No.8 BEST10-COVID-23nt-g11.2R AAUUUCUACUGUUUGUAGAUCAACCAGUAUCUGAAUUACUUAC SEQ ID No.9 BEST10-COVID-23nt-g202R AAUUUCUACUGUUUGUAGAUAAUAGUAGUUGUCUGAUUGUCCU SEQ ID No.10

[0109] 2. Preparation of cleavage substrate

[0110] (1) PCR was used to amplify the cleavage substrate from the PMV plasmid containing the cleavage substrate sequence (the insertion site was located between the M13 fwd and M13 rev sites) for experimental use. The amplified product was identified by 1.5% agarose gel electrophoresis, and the gel was cut according to the corresponding band size and analyzed by Qubit TM The dsDNA HS Assay Kit was used for gel recovery and purification to obtain a high concentration of cleavage substrate, which was stored in 1×NEBuffer 2.1. The sequences of the cleavage substrate and its PCR primers are as follows.

[0111] COVID-2019primerF: 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID No. 11);

[0112] COVID-2019 primer R: 5’-CCAGTATCGACAAAGGAC-3’ (SEQ ID No.12).

[0113] COVID-2019 substrate:

[0114] TGTAAAACGACGGCCAGTCGAACCACGCAATGCGTCTCGATCCGCAGTGTCTTGCGTCTCTTTTCATTATATTTTAATAGAAAAGTCCTAGGTTGAAGTTCCTTTTTCTACAGTGAAGGATTTCAACGTATGCCCTTTTGGTGAAGTTTTTAACGCCACCAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCATGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACAGGACAATCAGACAACTACTATTCAAACAATTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGTATTTCTACTACCTAGGAACTGGGCCAGAATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTAGAGACGGAGTCACTGCCAACCGAGACGGTCATAGCTGTTTCCTG (SEQ ID No.13).

[0115] 3. Cleavage experiment and results

[0116] The purified crRNA and 40U / μL RNase inhibitor were diluted to a final concentration of 2μM with 10×NEB Buffer 2.1 and enzyme-free water, where the final concentration of RNase inhibitor was 4U / μL and the final concentration of NEB Buffer 2.1 was 1×. Then, the Cas12a protein was diluted to a final concentration of 1μM with 10×NEB Buffer 2.1, 50mM DTT and enzyme-free water, where the final concentrations of NEB Buffer 2.1 and DTT were 1× and 0.5mM, respectively. Take 1μL of the diluted Cas protein and 1μL of crRNA and react in 1×NEB Buffer 2.1 at 37°C for 15 minutes to form 8μL RNP. After that, 1 μL of 50 ng / μL cleavage substrate and 1 μL of CRISPR reporter buffer 2.1 (prepared as shown in Table 4 below) were added to a final system of 10 μL, and incubated at 45°C for 30 minutes in a qPCR instrument. The detection mode was set to FAM fluorescence in the qPCR software, and the fluorescence value at the set wavelength was recorded every minute to reflect the progress of the BEST10 accessory cleavage reaction.

[0117] Table 4. CRISPR reporter buffer2.1 configuration table

[0118]

[0119] Among them, the FAM-reporter sequence is 5'-FAM-AAAAAA-BHQ1-3'.

[0120] BEST9-COVID-23ntp84-1R (SEQ ID No.6), BEST9-COVID-23ntp84-2R (SEQ ID No.7), BEST9-COVID-23ntp84-3R (SEQ ID No.8), BEST9-COVID-23nt-g11.2R (SEQ ID No.9) and BEST9-COVID-23nt-g 202R (SEQ ID No.10) were taken. Each gRNA was tested in parallel with BEST10 three times, and the FAM fluorescence value at 60 min was statistically analyzed to draw a bar graph ( Figure 7 ). The results showed that BEST10 observed significant accessory cleavage activity, and there was no significant difference with the control LbCas12a, indicating that BEST10 can be used for nucleic acid detection.

[0121] References

[0122] Barrangou,R.,Fremaux,C.,Deveau,H.,Richards,M.,Boyaval,P.,Moineau,S.,Romero,DA,and Horvath,P.(2007).CRISPR Provides Acquired Resistance AgainstViruses in Prokaryotes.Science(New York,NY)315,1709-1712.

[0123] Chen,JS,Ma,E.,Harrington,LB,Da Costa,M.,Tian,X.,Palefsky,JM,andDoudna,JA(2018).CRISPR-Cas12a target binding unleashes indiscriminatesingle-stranded DNase activity.Science(New York,NY)360,436-439.

[0124] Cong,L.,Ran,FA,Cox,D.,Lin,S.,Barretto,R.,Habib,N.,Hsu,PD,Wu,X.,Jiang,W.,Marraffini,LA,et al.(2013).Multiplex Genome Engineering UsingCRISPR / Cas Systems.Science(New). York,NY)339,819-823.Doudna,JA,andCharpentier,E.(2014).Genome editing.The new frontier of genome engineeringwith CRISPR-Cas9.Science(New York,NY)346,1258096.

[0125] Annu Rev Biophys 46,505-529.Jinek,M.,Chylinski,K.,Fonfara,I.,Hauer,M.,Doudna,JA,and Charpentier,E.(2017).A programmable dual-RNA-guidedDNA endonuclease in adaptive bacterial immunity.Science(New York,NY)337,816-821.Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, JA, and Charpentier, E. (2012b). York,NY)337,816-821.Jinek, M., Jiang, F., Taylor, DW, Sternberg, SH, Kaya, E., Ma, E., Anders, C., Hauer, M., Zhou, K., Lin, S., et al conformationalactivation.Science(New York,NY)343,1247997.

[0126] Joung,J.,Ladha,A.,Saito,M.,Kim,N.G.,Woolley,A.E.,Segel,M.,Barretto,R.P.J.,Ranu,A.,Macrae,R.K.,Faure,G.,et al.(2020).Detection of SARS-CoV-2withSHERLOCK One-Pot Testing.N Engl J Med 383,1492-1494.Kosicki,M.,Tomberg,K.,andBradley,A.(2018).Repair of double-strand breaks induced by CRISPR-Cas9 leadsto large deletions and complex rearrangements.Nature biotechnology 36,765-771.

[0127] Li,Z.,Wang,X.,Xu,D.,Zhang,D.,Wang,D.,Dai,X.,Wang,Q.,Li,Z.,Gu,Y.,Ouyang,W.,et al.(2020).DNB-based on-chip motif finding:A high-throughputmethod to profiledifferent types of protein-DNA interactions.Science Advances6,eabb3350.

[0128] Liu,L.,Li,X.,Ma,J.,Li,Z.,You,L.,Wang,J.,Wang,M.,Zhang,X.,and Wang,Y.(2017).The Molecular Architecture for RNA-Guided RNA Cleavage by Cas13a.Cell170,714-726e710.

[0129] Makarova,K.S.,Wolf,Y.I.,Iranzo,J.,Shmakov,S.A.,Alkhnbashi,O.S.,Brouns,S.J.J.,Charpentier,E.,Cheng,D.,Haft,D.H.,Horvath,P.,et al.(2020).Evolutionary classification of CRISPR-Cas systems:a burst of class 2andderived variants.Nat Rev Microbiol 18,67-83.

[0130] Mustafa,M.I.,and Makhawi,A.M.(2021).SHERLOCK and DETECTR:CRISPR-CasSystems as Potential Rapid Diagnostic Tools for Emerging InfectiousDiseases.J Clin Microbiol 59.

[0131] Papizan,J.B.,Porter,S.N.,Sharma,A.,and Pruett-Miller,S.M.(2020).Therapeutic gene editing strategies using CRISPR-Cas9 for theβ-hemoglobinopathies.J Biomed Res 35,115-134.

[0132] Patchsung,M.,Jantarug,K.,Pattama,A.,Aphicho,K.,Suraritdechachai,S.,Meesawat,P.,Sappakhaw,K.,Leelahakorn,N.,Ruenkam,T.,Wongsatit,T.,et al.(2020).Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2RNA.Nature biomedical engineering 4,1140-1149.

[0133] Slaymaker,I.M.,Gao,L.,Zetsche,B.,Scott,D.A.,Yan,W.X.,and Zhang,F.(2016).Rationally engineered Cas9nucleases with improved specificity.Science(New York,NY)351,84-88.

[0135] Traxler,E.A.,Yao,Y.,Wang,Y.D.,Woodard,K.J.,Kurita,R.,Nakamura,Y.,Hughes,J.R.,Hardison,R.C.,Blobel,G.A.,Li,C.,et al.(2016).A genome-editingstrategy to treatβ-hemoglobinopathies that recapitulates a mutationassociated with a benign genetic condition.Nature medicine 22,987-990.

[0136] Walton,R.T.,Christie,K.A.,Whittaker,M.N.,and Kleinstiver,B.P.(2020).Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9variants.Science(New York,NY)368,290-296.

[0137] Yamano,T.,Nishimasu,H.,Zetsche,B.,Hirano,H.,Slaymaker,I.M.,Li,Y.,Fedorova,I.,Nakane,T.,Makarova,K.S.,Koonin,E.V.,et al.(2016).CrystalStructure of Cpf1 in Complex with Guide RNA and Target DNA.Cell 165,949-962.

[0138] Zetsche,B.,Gootenberg,JS,Abudayyeh,OO,Slaymaker,IM,Makarova,KS,Essletzbichler,P.,Volz,SE,Joung,J.,van der Oost,J.,Regev,A.,et al.(2015).Cpf1 is a single RNA-guided endonuclease of a class 2CRISPR-Cassystem.Cell 163,759-771.

[0139] Zhu, C.-s., Liu, C.-y., Qiu,

[0140] Shan, Q. W., Gao, J. (2015). Latest research progress on plant genome editing and its derivative technologies. Heredity 37, 953-973.

[0141] Wang Huiyuan, Fan., Chu Xin, Yu Jianrong (2018). Analysis of the development trend of CRISPR gene editing technology. Life Science 30, 1019-1029.

[0142] Zheng, W., Gu. (2015). Research progress on the application and off-target effects of CRISPR / Cas9. Heredity 37, 1003-1010.

[0143] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range of equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes made in the art that are out of the scope of the disclosure in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. CRISPR-Cas12a system, including: (A1) Cas12a protein, the amino acid sequence of which is shown in SEQ ID No. 1; (A2) crRNA; the crRNA comprises a guide sequence complementary to the targeting sequence and is capable of binding to the Cas12a protein; The target sequence is located on the target gene to be edited; on the target gene, the PAM motif located upstream of the target sequence is 5'TTN, where N is A or T or C or G.

2. The CRISPR-Cas12a system according to claim 1, characterized in that: The PAM motif is not TTTN, and N is A or T or C or G.

3. A composition for gene editing, selected from any of the following:

1. A composition comprising: a nucleic acid molecule 1 encoding a Cas12a protein, and crRNA; II. A composition comprising: a Cas12a protein, and a nucleic acid molecule 2 encoding crRNA; III. A composition comprising: a nucleic acid molecule 1 encoding a Cas12a protein, and a nucleic acid molecule 2 encoding a crRNA; IV. A composition comprising: a nucleic acid molecule 3 encoding a Cas12a protein and a crRNA; The crRNA comprises a guide sequence complementary to the targeting sequence and is capable of binding to the Cas12a protein; the targeting sequence is located on the target gene to be edited; on the target gene, the PAM motif located upstream of the targeting sequence is 5'TTN, and N is A or T or C or G.

4. The composition according to claim 3, characterized in that: The PAM motif is not 5'TTTN, and N is A or T or C or G.

5. A composition for nucleic acid detection, comprising: (B1) the CRISPR-Cas12a system of claim 1 or 2 or the composition of claim 3 or 4; (B2) Single-stranded DNA carrying a reporter molecule.

6. Either of the following methods: Method I: A method for editing a target gene, comprising: Introducing the CRISPR-Cas12a system of claim 1 or 2 or the composition of claim 3 or 4 into an organism or a biological cell, so that both the Cas12 protein and the crRNA are expressed, thereby editing the target gene in the organism or the biological cell; Method II: A method for nucleic acid detection, comprising: adding the composition of claim 5 to a sample to be tested, carrying out a reaction, and determining whether the sample to be tested contains a target nucleic acid based on whether the reporter molecule generates an evaluable signal after the reaction.

7. Any of the following applications: (C1) Use of the CRISPR-Cas12a system of claim 1 or 2 or the composition of claim 3 or 4 for non-disease diagnosis and treatment in editing target genes; (C2) Use of the CRISPR-Cas12a system of claim 1 or 2 or the composition of claim 3 or 4 in the preparation of a product for editing a target gene; (C3) Use of the composition of claim 5 in nucleic acid detection; (C4) Use of the composition described in claim 5 in the preparation of nucleic acid detection products.

8. Any of the following applications: (D1) Non-disease diagnostic application of the composition of claim 5 or the method II of claim 6 in pathogen detection; (D2) Use of the composition of claim 5 in the preparation of pathogen detection products; (D3) Non-disease diagnostic application of the composition of claim 5 or the method II of claim 6 in biological sample detection; (D4) Use of the composition of claim 5 in preparing a biological sample detection product; (D5) Use of the CRISPR-Cas12a system of claim 1 or 2 or the composition of claim 3 or 4 in the preparation of a gene therapy product; (D6) Use of the CRISPR-Cas12a system of claim 1 or 2, the composition of claim 3 or 4, the composition of claim 5, or the method of claim 6 in high-throughput sequencing.

9. A kit for detecting COVID-2019, comprising (E1) Cas12a protein or its encoding nucleic acid; the amino acid sequence of the Cas12a protein is shown in SEQ ID No.1; (E2) crRNA, or a nucleic acid encoding the crRNA; the nucleotide sequence of the crRNA is shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, or SEQ ID No.10; (E3) Single-stranded DNA carrying a reporter molecule.

10. Non-disease diagnostic application of the kit according to claim 9 in detecting whether a sample to be tested contains COVID-2019.

Images