A zeaxanthin adenine dinucleotide synthetase gene ZmFADS1 and its encoded protein and application

Abstract

The present invention relates to a zeaxanthin adenine dinucleotide synthetase gene ZmFADS1 and its encoded protein and application, belonging to the technical field of plant genetic engineering, wherein the ZmFADS1 gene has a nucleotide sequence as shown in SEQ ID NO.1, and the zeaxanthin adenine dinucleotide synthetase encoded by the gene has an amino acid sequence as shown in SEQ ID NO.2, and the gene is overexpressed in plants to improve the quality of corn kernels. The present invention clones the ZmFADS1 gene from corn for the first time, and finds that ZmFA DS1 can improve the ability of plant leaves to synthesize FAD by overexpression in corn, thereby improving the ability of leaves to enrich heavy metal arsenic, thereby reducing the arsenic content in corn kernels, providing a theoretical basis for breeding corn varieties with low arsenic content kernels.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a zeaxanthin adenine dinucleotide synthetase gene ZmFADS1 and its encoded protein and application. Background Art

[0002] With the development of industrialization, arsenic pollution in groundwater is becoming more and more serious. In the process of corn absorbing nutrients through the root system, it absorbs harmful heavy metal arsenic. After the organism eats arsenic-containing corn kernels and related foods, arsenic will be enriched in the organism and cannot be excreted from the body. The accumulation of arsenic in the organism will directly damage the health of the organism. Therefore, corn absorbs arsenic during its growth, which makes arsenic enriched in corn kernels, which will lead to food safety problems. In the prior art, there are few reports on the problem of arsenic enrichment in corn kernels for the purpose of improving the safety of corn kernel-related foods for organisms. In this regard, the present application proposes a zeaxanthin adenine dinucleotide synthetase gene ZmFADS1 and its encoded protein and application. Summary of the invention

[0003] The purpose of the present invention is to provide a zeaxanthin adenine dinucleotide synthetase gene ZmFADS1 and its encoded protein and application in order to solve the above problems.

[0004] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0005] The present invention provides a ZmFADS1 gene, which has a nucleotide sequence as shown in SEQ ID NO.1.

[0006] The present invention also provides a protein encoded by the ZmFADS1 gene, which is zeaxanthin adenine dinucleotide synthetase, and the enzyme has an amino acid sequence as shown in SEQ ID NO.2.

[0007] The present invention also provides an application of the ZmFADS1 gene in improving the quality of corn grains.

[0008] As a further optimization scheme of the present invention, overexpression of the ZmFADS1 gene in plants can improve the quality of corn kernels.

[0009] As a further optimization scheme of the present invention, the improvement of corn kernel quality includes enriching arsenic in plant leaves to reduce the arsenic content in corn kernels.

[0010] As a further optimization scheme of the present invention, improving the quality of corn kernels also includes increasing the molybdenum content in the corn kernels.

[0011] As a further optimization scheme of the present invention, overexpression of the ZmFADS1 gene in plants can increase the content of FAD in plant leaves, thereby improving the redox state of plant leaves and enriching arsenic in plant leaves.

[0012] The present invention also provides a plasmid vector, which is a pTF102 vector in which an exogenous promoter, a ZmFADS1 gene and a 35S-bar-Tnos herbicide selection marker are sequentially connected in cis in a multiple cloning site region.

[0013] As a further optimization scheme of the present invention, the exogenous promoter is any one of rbcS1 pro promoter, Ubiqutin promoter and 35S promoter.

[0014] The beneficial effects of the present invention are:

[0015] The ZmFADS1 gene proposed in the present invention is a new gene cloned from corn for the first time. The present invention also finds that overexpression of ZmFADS1 in corn plants can increase the ability of plant leaves to synthesize FAD, thereby improving the redox state of plant leaves, and further improving the leaves' ability to enrich heavy metal arsenic. When the total arsenic content in the aerial part of the plant remains unchanged, arsenic in the plant is more likely to be enriched in the leaves of the plant, thereby effectively reducing the arsenic content in the plant's kernels, thereby achieving the effect of improving the safety of corn kernel-related foods. At the same time, overexpression of ZmFADS1 can also increase the molybdenum content in corn kernels, thereby comprehensively achieving the effect of improving the quality of corn kernels. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results of expression and protein enrichment analysis of ZmFADS1 in wild-type maize (a: tissue expression spectrum of ZmFADS1, b: enrichment analysis of ZmFADS1 protein in different tissues);

[0017] Figure 2 The results of subcellular localization analysis of ZmFADS1 protein;

[0018] Figure 3 ZmFADS1 in maize seedlings is regulated by As III Results of induced expression (a: ZmFADS1 gene fluorescence quantitative PCR detection, b: ZmFADS1 protein immunoblot analysis);

[0019] Figure 4 The results of the ZmFADS1 overexpression strains (a: relative expression of ZmFADS1, b: immunoblot analysis of ZmFADS1 protein, c: FAD content analysis);

[0020] Figure 5The test results of ZmFADS1 overexpression lines planted in Sanya Damao (a: arsenic content in grains, b: molybdenum content in grains, c: yield per plant, d: 100-grain weight, e: number of grains per ear, f: number of ear rows, g: ear phenotype, h: field plant phenotype);

[0021] Figure 6 The results of the ZmFADS1 overexpression strain planted in Sanshigang, Hefei (a: arsenic content in seeds, b: arsenic content in leaves above ground);

[0022] Figure 7 are the detection results of zmfads1 heterozygous mutants (a: gene editing target site, b: zmfads1 heterozygous mutant phenotype, f: ZmFADS1 relative expression, g: ZmFADS1 immunoblot, h: arsenic content determination);

[0023] Figure 8 This is the detection result of ZmFADS1 overexpressing material in the zmfads1(+ / -) heterozygous mutant background. DETAILED DESCRIPTION

[0024] The present application is described in further detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Materials

[0026] Unless otherwise specified, the methods used in the present invention are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0027] (1) ZmFADS1 antibody was prepared by the company;

[0028] (2) rbcS1 pro promoter (GenBank: AH005359.3) is the abbreviation of the promoter of the 1,5-bisphosphate ribulose small subunit of the bundle sheath cell-specific expression gene (Bundle sheath-specific Rubisco small subunit1 promoter). The sequence number is available at http: / / www.ncbi.nlm.nih.gov / nuccore / 339635306. This promoter is from maize. There is a signal peptide of about 20 bp after the promoter, which targets the expressed protein to the bundle sheath cells, achieving tissue cell-specific expression and avoiding the toxicity of exogenous proteins to the plant due to accumulation in non-functional tissues.

[0029] (3) The culture medium formula used is as follows:

[0030] YEP medium: 5 g L -1 Yeast extract, 10 g L -1 Peptone, 5 g L -1 NaCl 2 ,15g L -1 Agar powder, pH 6.8, add corresponding antibiotics after the culture medium is cooled to 50 degrees;

[0031] Infection liquid MS-Inf (+AS): Liquid culture medium for resuspension infection (1L): 4.3g MS basal salt, 1ml 1000X vitamin mixture, 0.5ml dicamba, 0.7g proline, 0.1g hydrolyzed casein, 0.1g inositol, 68.5g sucrose, 36g glucose, pH 5.2, filter sterilized, the culture medium was stored at 4 degrees, and 100uM acetosyringone was added before use;

[0032] Co-culture medium (1 L): 4.3 g MS basal salts, 0.5 ml dicamba, 0.7 g proline, 0.1 g hydrolyzed casein, 0.1 g inositol, 30 g sucrose, pH 5.8, 3.15 g vegetable gum, after sterilization, add: 1 ml 1000x Vit stock, 1.76 ml silver nitrate (final concentration 88 μM), 1 ml acetosyringone, 3 ml cysteine;

[0033] The first screening medium (1L): 4.3g MS basal salt, 0.5ml dicamba, 0.7g proline, 0.5g 2-(4-morpholino)-ethane sulfonic acid (MES), 0.1g hydrolyzed casein, 0.1g inositol, 30g sucrose, pH 5.8, 2.8g vegetable gum, after sterilization, add: 1ml 1000X vitamin complex solution, 1.76ml silver nitrate, 1ml thiophanate, 0.7ml bialaphos;

[0034] Second screening medium: N6 salts and vitamins, 1.5 mg L -1 2,4-Dichlorophenoxyacetic acid (2,4-D), 0.7 gL -1 L-Proline, 30g L -1 Sucrose, 0.5 g MES, 3 g L -1 Plant gel, (pH 5.8), silver nitrate 0.85 mg L -1 , thiophanate-methyl (250 mg L -1 ), 2.0 mg L -1 Bialaphos;

[0035] Differentiation medium (1L): 4.3g MS basal salt, 0.1g inositol, 30g sucrose, 3g plant gel, pH 5.8, add 1ml 1000X vitamin complex solution, 1.76ml silver nitrate, 1ml thiophanate, 2ml bialaphos, 0.5ml zeatin, 0.1ml IAA, 0.01mg TDZ after sterilization;

[0036] Rooting medium (1 L): 1 / 2 MS salt, 30 g sucrose, 2.8 g plant gel, pH 5.8, after sterilization, add 1 ml MS1000X vitamin complex solution, 0.5 ml IAA, 0.2 ml paclobutrazol, and 1 ml thiophanate-methyl.

[0037] 2. Methods

[0038] 1. ZmFADS1 expression profile analysis

[0039] RNA was extracted from different tissues of maize inbred line B73 and reverse transcribed into cDNA. The expression of ZmFADS1 gene in different tissues of maize was analyzed by fluorescence quantitative PCR. The results showed that ZmFADS1 gene was mainly expressed in leaves and pollen ( Figure 1 a).

[0040] The primers used for fluorescence quantitative PCR are:

[0041] SEQ ID NO.3: ZmFADS1-F1 5-AAGGGTATACTTCCATTGGG-3;

[0042] SEQ ID NO. 4: ZmFADS1-R1 5-CTTTCAAGCCTTCCATCAGTTAGCA-3.

[0043] The internal reference gene used is Actin, and the corresponding primers are:

[0044] SEQ ID NO.5: Actin-F: 5-GCTACGAGATGCCTGATGGTC-3;

[0045] SEQ ID NO. 6: Actin-R:5-CCCCCACTGAGGACAACG-3.

[0046] Then, protein immunoblotting analysis was performed using ZmFADS1 antibody, and the internal reference gene used in protein immunoblotting analysis was GADPH. The results showed that ZmFADS1 protein was mainly enriched in pollen ( Figure 1 b).

[0047] 2. Subcellular localization of ZmFADS1

[0048] A ZmFADS1-GFP fusion expression vector was constructed to perform subcellular localization of the protein. The vector used the 35S promoter to regulate gene expression. After obtaining the ZmFADS1 gene transcript, the stop codon in the transcript was removed, and the following primers were designed with KpnI and BamHI as restriction sites:

[0049] SEQ ID NO.7:

[0050] ZmFADS1-F2 atttggagaggacagggtacc ATGGAGATTGACCAGGCGGTGCGCG;

[0051] SEQ ID NO.8:

[0052] ZmFADS1-R2 agtgtcgactctagaggatccTTTGCAACTGTTAAGTTGGG.

[0053] The above primers were used to connect the ZmFADS1 gene to the multiple cloning site of pCAMBIA2300-35S-GFP. The constructed vector was named pCAMBIA2300-35S-ZmFADS1-GFP, and the vector was transferred into corn protoplasts and tobacco leaves respectively. Subcellular localization results showed that the ZmFADS1 protein was mainly distributed in the cytoplasm ( Figure 2 ).

[0054] 3. Inspection of As III Induced ZmFADS1 gene in maize seedlings

[0055] 0 and 0.10 mg L -1 , 0.50mg L -1 , 1.00mg L -1 , 5.00mg L -1 and 10.00 mg L -1 As III Wild-type maize inbred line B104 was treated, and the gene expression analysis and protein immunoblot analysis of ZmFADS1 were performed on each treated plant (the analysis method, primers and antibodies used were the same as in 1). The results are shown in FIG. Figure 3 As shown, with As III With the increase of concentration, the expression level of ZmFADS1 first increased and then decreased ( Figure 3 a), and its protein enrichment also showed the same trend ( Figure 3 b).

[0056] The above results show that in As IIIIn the presence of , ZmFADS1 gene expression is induced.

[0057] 4. ZmFADS1 gene overexpression in maize

[0058] 4.1 Vector construction

[0059] A promoter that can drive the expression of the ZmFADS1 gene was selected. Taking the rbcS1 pro promoter as an example, multiple cloning sites MfeI and BamHI were added before and after the rbcS1pro promoter sequence, respectively. The treated promoter was cloned into the multiple cloning site of the pTF102 vector using primer A to replace the original Ubi promoter. Then, the full-length ZmFADS1 gene with BamHI and SacI restriction sites was inserted into the rear of the rbcS1pro promoter on the pTF102 vector using primer B to construct a plant binary expression vector containing a 35S-bar-Tnos herbicide selection marker.

[0060] The sequence of primer A is as follows:

[0061] SEQ ID NO.9:

[0062] MfeI rbcsP1-F 5-CCGCAATTGCCTTTAATCTGGCGCTAGATCTGC-3;

[0063] SEQ ID NO.10:

[0064] BamHI rbcsP1-R 5-CGGGATCCGCCTGGCTGCCTAGTATGTATGTAC-3;

[0065] The sequence of primer B is as follows:

[0066] SEQ ID NO.11:

[0067] ZmFADS1-F3 5-CGGGATCCAACAATGGAGATTGACCAGGCGGTGCGCG-3;

[0068] SEQ ID NO.12:

[0069] ZmFADS1-R3 5-CCCGAGCTCTTATTTGCAACTGTTAAGTTGGG-3.

[0070] 4.2 Maize genetic transformation

[0071] Introduce the plant binary expression vector into the Agrobacterium strain EHA101, streak on YEP+km / spect (or only kan) medium, culture at 28°C for 2 days, and store at 4°C until a single clone grows; streak the day before infection and culture at 28°C overnight; on the day of infection, shake the infection medium at room temperature to make OD600 reach 0.35-0.55, shake gently on a shaker at 75rpm for more than 2 hours for later use, and wrap a 50ml centrifuge tube with aluminum foil to protect it from light.

[0072] Take the ears of corn inbred line B104 9-12 days after pollination (the young embryo is about 1.5-2mm long), transport them back to the laboratory with the bracts, and temporarily store them in a 4℃ refrigerator. Take the ears without pests and diseases, open the bracts and spray them with 75% alcohol until the alcohol drops. The whole process should not exceed 1 minute. Use a blade to cut off the upper part of the kernel, use an embryo spoon to dig out the young embryo, suspend it in MS-Inf (+AS), and wait for infection.

[0073] Collect 50-100 embryos in each tube (collect one tube of immature embryos from each cob, and the time that the immature embryo vesicles stay in the liquid culture medium should be less than 30 minutes). Wash the peeled immature embryos twice with MS-Inf (+AS) to remove the endosperm and starch, add Agrobacterium bacterial solution and soak in the dark for 5 minutes, then spread them flat on the co-culture medium, turn the immature embryos over with tweezers, with the back facing up, absorb the bacterial solution, and blow dry for about half an hour. Wrap the culture dish with parafilm and place it in the dark at 20-22 degrees Celsius for co-culture for 3 days.

[0074] Use tweezers to pick up the young embryo and place it in SI medium away from light for 2 weeks, with the back facing up. After one week, you can see a small callus growing on the tip of the back of the embryo. The young embryo with callus is transferred from S1 to S2, and cultured on S2 for another 2-3 weeks, and you can see the resistant callus growing. The newly grown resistant callus is white and has a fine hairy appearance. The non-resistant callus turns yellow, softens, and liquefies. The white translucent fresh callus grown on S2 grows to a diameter of about 1 cm (you can choose to subculture once according to the growth state of the callus), and then transferred to R1 medium. After 1 week of light culture, the callus appears green and dense buds, and some will have leaf rudiments. Change the differentiation medium and continue light culture. The green buds differentiate into seedlings within 3 weeks. When the seedlings grow to 2 cm, they are transferred to the rooting medium. Thick roots grow in the rooting medium, and the leaves grow to the bottle mouth, and the seedlings are hardened. Transplant to soil and plant WT materials at the same time for pollination.

[0075] 4.3 Obtaining transgenic positive strains

[0076] Obtain transgenic T 0 There were 38 lines of the first generation, and three homozygous lines were selected through self-pollination. The three homozygous lines were subjected to gene expression analysis and protein immunoblotting analysis (the analysis method, primers and antibodies used were the same as in 1).

[0077] The results showed that compared with the wild type, the mRNA level in the leaves of the ZmFADS1 overexpression line ( Figure 4 a) and protein levels ( Figure 4 b) were higher, while the expression level in roots was lower.

[0078] 4.4 Detection of FAD content in leaves of transgenic lines

[0079] Samples were extracted from the three homozygous strains obtained, and the FAD content of the samples was determined using a commercial kit (the determination method refers to the kit). The results showed that compared with the wild type, the FAD content in the leaves of the ZmFADS1 overexpression strain was significantly higher than that of the wild type ( Figure 4 c).

[0080] 4.5 Detection of arsenic and molybdenum content in seeds of transgenic lines

[0081] Three ZmFADS1 overexpression homozygous strains OX1, OX2, OX3 and the wild type were planted in Sanya Daming (the natural arsenic content in the soil was 12.0 mg kg -1 ), the arsenic and molybdenum contents of the harvested ZmFADS1 overexpression plants and wild-type plants were tested (detection instrument was IP-MS), and a number of agronomic traits were tested. The results showed that the arsenic content in the grains of the three ZmFADS1 overexpression lines was significantly reduced ( Figure 5 a), molybdenum content increased significantly ( Figure 5 b), other agronomic traits are not affected ( Figure 5 ch).

[0082] The homozygous strains OX1 and OX2 overexpressing ZmFADS1 were selected and planted together with the wild type at Sanshigang, Hefei, Anhui (the natural arsenic content in the soil is 11 mg kg -1 ), the arsenic content and molybdenum content of the harvested ZmFADS1 overexpression plants and wild-type plants were tested (the instrument was IP-MS). The results showed that the arsenic content in the grains of the ZmFADS1 overexpression line was significantly lower than that of the wild-type ( Figure 6 a), and the arsenic content in different leaves of the aboveground part of the plant was different. Among them, the arsenic enrichment in the old leaves of the ZmFADS1 overexpression line was significantly higher than that of the wild type, while the arsenic enrichment in the flag leaves and ear leaves of the ZmFADS1 overexpression line was lower than that of the wild type ( Figure 6 b).

[0083] 4.6 Examination of the effect of ZmFADS1 mutation on arsenic content in grains

[0084] Construction of CRISPR / Cas9 gene editing vector targeting the CDS region of ZmFADS1 ( Figure 7a), the obtained vector was named pCAMBIA3300-Cas9-U6-ZmFADS1sgRNA, and the vector used was a CRISPR / Cas9 universal vector;

[0085] The target sequence is: SEQ ID NO. 13: GAGATTGACCAGGCGGTGCG (20 bp).

[0086] Using CRISPR / Cas9 gene editing vector to obtain heterozygous mutants ( Figure 7 a) and homozygous mutants, where the homozygous mutants show aborted florets and are unable to complete fertilization and development of grains, showing a homozygous lethal phenotype ( Figure 7 be), gene expression analysis and protein immunoblotting analysis were performed on the heterozygous mutant (the analysis method, primers and antibodies used were the same as in 1), and the results were shown in Figure 7 f, 7g, and the arsenic content was tested, and the results were as follows Figure 7 As shown in h, after ZmFADS1 mutation, the arsenic content in the grains of the heterozygous mutant increased.

[0087] In order to further verify that the expression difference of ZmFADS1 gene will lead to the change of arsenic content in grain, the present invention constructed ZmFADS1 overexpression material in the background of zmfads1(+ / -) heterozygous mutant. By measuring the arsenic content in grain, it was found that under the genetic background of zmfads1(+ / -) heterozygous mutant, the introduction of ZmFADS1 can reduce the arsenic content in grain. That is, the overexpression of ZmFADS1 can compensate for the low expression of ZmFADS1 in zmfads1(+ / -) heterozygous mutant and reduce the arsenic content in grain of its plant ( Figure 8 ).

[0088] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An application of ZmFADS1 gene in improving corn kernel quality, characterized in that: The nucleotide sequence of the ZmFADS1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; Said ZmFADS1 Overexpression of the gene in the plant reduced the arsenic content in corn kernels and increased the molybdenum content in corn kernels.

Images