SNP molecular marker itpr3 related to goat reproductive traits and application thereof

Abstract

This invention discloses an SNP molecular marker, ITPR3, associated with reproductive traits in goats and its applications, belonging to the fields of biotechnology and livestock breeding. This invention screened a SNP locus significantly associated with goat reproductive traits. This SNP locus, ITPR3g.40886054A>G, is located at 40886054 bp on chromosome 23 of the goat genome, with a polymorphism of either A or G. The genotype of this SNP locus is significantly correlated with the number of lambs in the second and third litters of goats; ewes with the GG genotype have a significantly higher number of lambs in their second litter than ewes with the AG genotype; and ewes with the GG genotype have a significantly higher number of lambs in their third litter than ewes with the AA genotype. Using the molecular marker of this invention for goat screening is a simple, rapid, accurate, and inexpensive method that can improve goat breeding efficiency and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and livestock breeding, and relates to a SNP molecular marker related to goat reproductive traits and its application. Background Technology

[0002] With the rapid development of modern biotechnology, research on improving the economic traits of livestock using modern molecular breeding techniques such as molecular marker-assisted selection has become increasingly widespread, playing a vital role in promoting the high-quality development of animal husbandry. Utilizing modern molecular biology methods to identify effective SNP loci in goat populations and selectively choosing goats with better economic traits such as litter size can effectively improve breeding efficiency, reduce the blind spots in the breeding process, and provide strong technical support for the breeding of high-fertility traits in goats, thus having a profound impact on promoting the sustainable development of the goat industry.

[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. SNPs are widely distributed, numerous, and have high marker density, exhibiting high genetic stability, good reproducibility and accuracy in genetic analysis, and ease of rapid, high-throughput genotyping (Wang Zhonghua, 2008). The allele frequencies of SNP genetic markers differ across populations; this characteristic can be utilized for population genetic diversity analysis, candidate gene analysis and discovery for variety-specific traits, and variety identification (Zhou Xiaomin & Dai Xilin, 2020).

[0004] Inositol 1,4,5-triphosphate (IP3) receptors (IP3Rs) are intracellular Ca2+ receptors located on the endoplasmic reticulum (ER) membrane. 2+ The IP3R family of release channels mediates the movement of Ca2+ from the ER to the cytoplasm when its receptor binds to the second messenger IP3 (Berridge MJ et al., 1993). Three distinct subtypes of IP3Rs (IP3R1, IP3R2, and IP3R3) have been identified in mammals. Using gene knockout mouse models, IP3Rs have been shown to play important roles in regulating a variety of physiological processes, including brain function, taste perception, embryonic survival, extraembryonic vascular development, exocrine function, T cell development, B cell function, gastrointestinal motility, vasoconstriction, and hypertension (Feili Yang et al., 2020).

[0005] José E. Mesonero et al. investigated the regulation of phospholipase C (PLC) and the expression of inositol 1,4,5-trisphosphate receptors (IP3Rs) in the myometrium and endometrium of rats during mid-pregnancy (day 12) and full-term (day 21) in terms of mRNA, protein, and binding capacity, and compared them with estrogen-treated tissues (day 0). The mRNAs encoding the three isoforms of IP3R and their corresponding proteins, IP3R1, IP3R2, and IP3R3, were co-expressed in the myometrium and endometrium, and the expression of IP3Rs increased with the progression of pregnancy (José E. Mesonero et al., 2000). KEGG enrichment analysis revealed that ITPR3, or IT3R3, plays a role in the oxytocin signaling pathway, oocyte meiosis, GnRH signaling pathway, estrogen signaling pathway, and Ca2+ signaling pathway. + It is enriched in multiple reproduction-related signaling pathways, suggesting its broad involvement in reproductive regulation. However, no studies have yet reported that ITPR3 is a molecular marker associated with high fertility in goats. Summary of the Invention

[0006] In order to overcome the shortcomings of existing technologies in the breeding of goat reproductive traits, the present invention aims to provide a SNP molecular marker related to goat reproductive traits and its application in different goat populations.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention claims protection for the use of a substance for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome in any of the following:

[0009] (a1) Application in identifying or assisting in the identification of reproductive traits in goats;

[0010] (a2) Application in the preparation of products for the identification or auxiliary identification of reproductive traits in goats;

[0011] (a3) Application in screening or assisted screening of goats with high reproductive traits;

[0012] (a4) Application in the preparation of products for screening or assisting in the screening of goats with reproductive traits of high-altitude goats;

[0013] (a5) Application of reproductive traits of tall goats in goat breeding;

[0014] The SNP site ITPR3 g.40886054A>G is located at 40886054 bp on chromosome 23 of the goat genome, and its polymorphism is either A or G. The physical location of the SNP site ITPR3 g.40886054A>G was determined based on the whole goat genome sequence, whose accession number is NC_030830.1.

[0015] Furthermore, the reproductive trait is the number of lambs born. The genotype of the SNP locus ITPR3 g.40886054A>G is significantly correlated with the number of lambs born in the second and third litters of goats. The number of lambs born in the second litter of ewes with the GG genotype is significantly higher than that of ewes with the AG genotype. The number of lambs born in the third litter of ewes with the GG genotype is significantly higher than that of ewes with the AA genotype.

[0016] Furthermore, the substance is (b1) or (b2) or (b3) as follows:

[0017] (b1) PCR primers for amplifying the goat genomic DNA fragment containing the SNP site ITPR3 g.40886054A>G;

[0018] (b2) PCR reagents containing the PCR primers described in (b1);

[0019] (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

[0020] Furthermore, the PCR primers comprise an upstream primer F1 and a downstream primer R1;

[0021] Upstream primer F1: 5'-AACTTGCACGTACTCTGCGC-3' (SEQ ID NO.2);

[0022] Downstream primer R1: 5'-TGTCTCGCACACCAGGTTGT-3' (SEQ ID NO.3).

[0023] Secondly, the present invention claims protection for the use of the above-mentioned PCR primers in the preparation of products for detecting the aforementioned SNP site ITPR3g.40886054A>G polymorphism or genotype.

[0024] Thirdly, this invention claims protection for a product used to detect the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome, the product containing the aforementioned PCR primers or the aforementioned substances. The product can be a PCR reagent or kit.

[0025] Fourthly, this invention claims a method for identifying or assisting in the identification of reproductive traits in goats, which involves detecting the polymorphism or genotype of the SNP locus ITPR3 g.40886054A>G in the goat genome; the number of lambs born in a second litter of GG genotype ewes is significantly higher than that of AG genotype ewes; the number of lambs born in a third litter of GG genotype ewes is significantly higher than that of AA genotype ewes. Selecting GG genotype individuals as parents in goat breeding can improve goat reproductive performance.

[0026] Fifthly, the present invention claims a breeding method for a goat with a high reproductive trait, which involves detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome; retaining individuals with the GG homozygous genotype, eliminating individuals with the AA homozygous genotype and individuals with the AG heterozygous genotype, and increasing the number of lambs produced by goats generation by generation.

[0027] Further, in the above method, the method for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome is as follows: using the genomic DNA of the goat blood to be tested as a template, PCR amplification is performed using the above-mentioned PCR primers or the above-mentioned products, and the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome is determined by direct sequencing of the PCR amplification products.

[0028] In a specific embodiment of the present invention, the genotype is determined by direct sequencing of the PCR product; the genotype of ITPR3 g.40886054A>G is determined based on the sequencing peak diagram: when the peak diagram shows a single peak of A, the genotype is AA; when the peak diagram shows a single peak of G, the genotype is GG; when the peak diagram shows a double peak of A and G, the genotype is AG.

[0029] In a specific embodiment of the present invention, the PCR amplification reaction system is 20 μL, comprising: 10 μL of 2×Taq PlusMaster Mix II; 0.6 μL each of upstream and downstream primers; 1 μL of template DNA; and 7.8 μL of deionized water. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; and storage at 4℃ after PCR.

[0030] In a sixth aspect, the present invention claims protection for a molecular marker containing the above-mentioned SNP site ITPR3 g.40886054A>G, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the SNP site ITPR3 g.40886054A>G is located at the 138th bp of the nucleotide sequence shown in SEQ ID NO.1.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] This invention is the first to discover an effective SNP molecular marker affecting lambing numbers in goats within the ITPR3 gene. Using the kit provided by this invention, the genotype of the molecular marker is detected by PCR amplification and direct sequencing of the product. This method is simple, rapid, accurate, and inexpensive. Using the molecular markers of this invention to screen goats, retaining homozygous individuals with the GG genotype and culling homozygous individuals with the AA genotype and heterozygous individuals with the AG genotype, can improve the reproductive performance of goats, accelerate goat breeding progress, and has high application value. Attached Figure Description

[0033] Figure 1 The results of 2% agarose gel electrophoresis of the mixed-pool PCR amplification product of ITPR3 g.40886054A>G site (primer P1) are shown, where M represents DL100 Plus DNA Marker and 1 represents ITPR3 g.40886054A>G.

[0034] Figure 2 This is a sequencing image of the PCR amplification product of the ITPR3 g.40886054A>G site (primer P1); the arrows indicate the mutation sites.

[0035] Figure 3 The correlation chart is for ITPR3 g.40886054A>G and the number of lambs born in the second litter of Haimen goats.

[0036] Figure 4 The correlation chart is for ITPR3 g.40886054A>G and the number of lambs born in the third litter of Haimen goats. Detailed Implementation

[0037] The technical solution of the present invention will be further described in detail below with reference to the embodiments and related drawings. However, it is worth noting that the embodiments of the present invention are not limited thereto, and those skilled in the art can implement them in other different forms without departing from the spirit and purpose of the present invention.

[0038] Example 1: Genotyping and Identification of SNP Molecular Markers in the Goat ITPR3 Gene

[0039] 1. Collection of experimental animals and samples

[0040] This experiment collected lambing information from the first three litters of 1100 purebred Haimen goats from the Yangtze River Delta White Goat Conservation and Breeding Research Institute and Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. in Haimen District, Nantong City; lambing information from 220 crossbred Haimen goats (Haimen goat × Boer goat) from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd.; and lambing information from 324 purebred Hainan black goats from Xueguli Happy Ecological Ranch in Sanya, Hainan. Additionally, 10 mL of jugular vein blood samples were collected, placed in anticoagulant tubes containing EDTA, and stored at -20℃.

[0041] 2. Main Instruments

[0042] Pipettes (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortex mixer (Dalong), digital display constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis apparatus (Beijing Liuyi, DYY-6C), fully automated digital gel imaging system (Tanon, Tanon-4100).

[0043] 3. Main reagents

[0044] TIANGEN Blood Genomic DNA Extraction Kit (Centrifuge Column), 50×TAE (Solarbio), Agarose (BIOWEST), 2×Taq Plus Master MixⅡ (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed Nucleic Acid Gel Dye (TSINGKE, TSJ003), DL2000 Plus DNA Marker (Vazyme, MD102-02).

[0045] 4. Methods

[0046] 4.1 Extraction of genomic DNA from goat blood

[0047] Five hours in advance, remove the goat blood from the -20°C freezer and place it in a 4°C freezer to thaw. Once the blood is completely thawed, extract DNA from the whole blood according to the instructions of the TIANGEN Blood Genomic DNA Extraction Kit.

[0048] DNA concentration and quality were detected using a micro-spectrophotometer, including OD. 260 / 280 It should be between 1.80 and 2.00, OD 260 / 230The value should be between 1.80 and 2.20. DNA samples that pass the test should be stored at -20°C.

[0049] 4.2 Primer Design for Candidate SNP Sites

[0050] Information on SNP sites related to the ITPR3 gene was found using the Ensembl database (https: / / asia.ensembl.org / index.html), and genotyping primers were designed using PrimerPremier5 software. SNP site information and primer information are shown in Tables 1 and 2.

[0051] Table 1. SNP locus information of ITPR3 gene

[0052]

[0053] Table 2. Primer sequences for ITPR3SNP genotyping

[0054]

[0055] 4.3 Validation of candidate SNP sites primers

[0056] 4.3.1 Mixing Pool Preparation

[0057] Fifty DNA samples were randomly selected from 1100 samples from Haimen goats, and 1 μL of each sample was added to the same 1.5 mL centrifuge tube to prepare DNA pools for subsequent verification of candidate SNP site polymorphisms and primers. The above operation was repeated in 220 samples from Bohe goats and 324 samples from Hainan black goats, for a total of 3 DNA pools.

[0058] 4.3.2 Mixed-pool PCR amplification

[0059] (1) PCR amplification system (20 μL): 2×TaqPlusMasterMixⅡ 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0060] (2) PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0061] 4.3.3 Agarose gel electrophoresis of mixed-cell PCR products

[0062] (1) Preparation of 2% agarose gel: Measure 1g of agarose and 50mL of 1×TAE and pour them into an Erlenmeyer flask. Heat in a microwave oven on high for 3 minutes until the solution is clear and transparent; otherwise, extend the heating time appropriately. After the solution has cooled to a comfortable temperature, add 5μL of nucleic acid dye, mix thoroughly, pour the mixture onto a plate, and allow it to solidify.

[0063] (2) After the agarose gel solidifies, the sample loading operation is performed. The PCR product loading volume is 6 μL and the DNA marker loading volume is 4 μL. Gently place the agarose gel into the electrophoresis tank containing 1×TAE (the 1×TAE liquid level should cover the gel surface), and perform electrophoresis at 140V 300mA for 35 min.

[0064] (3) After electrophoresis, the gel was transferred to a fully automated digital gel imaging system for observation.

[0065] The mixed-pool DNA was subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the ITPR3 SNP site shows a clear band at the 238bp position, consistent with the expected fragment size, and there are no nonspecific bands, indicating good primer specificity and allowing for subsequent operations.

[0066] 4.4 Genotyping

[0067] 4.4.1 Sample PCR amplification

[0068] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0069] (2) PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0070] 4.4.2 Sequencing of Sample PCR Products and Determination of Results

[0071] The PCR product and primer P1 were sent to Universal Biotech for sequencing. The sequencing results showed that the PCR product sequence was as shown in SEQ ID NO.1, and the SNP site ITPR3 g.40886054A>G was located at the 138th bp of the nucleotide sequence shown in SEQ ID NO.1.

[0072] TGTCTCGCACACCAGGTTGTAGTTTTGTCTTATTGTTCTGGCAGCGCAGGAAGTTCTGC

[0073] AGAGGATGGGGAGGGATGCGCATGGCGCCGCTGCAGCACGGAGGGAGGGCCTGCCCAGGGAGGGAGGGCCTGCCCAGGG[A / G]CCACAATCACATGGGCAGCAGGGATGGG GCCTCGCCGGCCTCGGAGCCACACATGCCATGGTGCCCAGGCCTGATGCCGGGCGC AGAGTACGTGCAAGTT(SEQ ID NO.1).

[0074] The sequencing results were compared and analyzed using SnapGene software. The genotype of ITPR3 g.40886054A>G was determined according to the sequencing peak map: when the peak map showed a single peak of A, the genotype was AA; when the peak map showed a single peak of G, the genotype was GG; when the peak map showed a double peak of A and G, the genotype was AG( Figure 2 ).

[0075] The above results indicated that by using primer P1 to perform PCR amplification on goat genomic DNA and determining the genotype by direct sequencing, the SNP locus of the goat ITPR3 gene could be rapidly and accurately genotyped. Example 2 Statistical analysis of the polymorphism of the SNP locus of the ITPR3 gene and its relationship with the high fecundity traits of goats

[0076] 1. Statistical analysis of the genetic parameters of different goat populations at the ITPR3 g.40886054A>G locus

[0077] Genotyping was performed on 1100 Haimen goats, 220 Boer crossbred goats, and 324 Hainan black goats according to the primers and methods designed in Example 1, and the population genetic parameters of this locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective number of alleles, polymorphism information content, and Hardy-Weinberg equilibrium P value.

[0078] The results are shown in Table 3. There were three genotypes of AA, AG, and GG at the ITPR3 g.40886054A>G locus in goats. Among them, the AG genotype was the dominant genotype, and A was the dominant allele, showing moderate polymorphism (0.25 < PIC < 0.5). It was in Hardy-Weinberg equilibrium (P > 0.05) in Boer crossbred goats and Hainan black goats, and not in Hardy-Weinberg equilibrium (P < 0.05) in Haimen goats

[0079] Table 3 Genetic parameters of different goat populations of the ITPR3 gene

[0080]

[0081] 2. Association between the ITPR3g.40886054A>G locus and high fertility in goats.

[0082] Using SAS (9.4) software and the GLM program, least squares statistical analysis was performed to analyze the association between different genotypes of ITPR3g.40886054A>G and the number of lambs born in different goat populations.

[0083] Using genotype and season as fixed effects, the model is: Y ijk =μ+G i +S j +e ijk In the formula, Y ijk G represents the phenotypic value of the number of lambs born to an individual; μ represents the population mean; G represents the population mean. i Genotype effect; S j This is due to seasonal effects; e ijk This is random error.

[0084] 2.1 Association analysis between the ITPR3g.40886054A>G locus and the number of lambs born in Haimen goats

[0085] Fixed effects other than genotype effects that were not significantly associated with individual phenotypic values ​​were removed. Association analysis was performed between the ITPR3 gene SNP locus and the number of lambs born in Haimen goats. The results are expressed as "least square mean ± standard error".

[0086] The results are shown in Table 4. Figure 3 and Figure 4 As shown, the ITPR3g.40886054A>G site was significantly associated with the number of lambs born in the second and third litters of Haimen goats. The number of lambs born in the second litter of GG genotype ewes was significantly higher than that of AG genotype ewes; the number of lambs born in the third litter of GG genotype ewes was significantly higher than that of AA genotype ewes.

[0087] Table 4. Association between ITPR3 gene SNP sites and lambing number in Haimen goats.

[0088]

[0089] Note: Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0090] 2.2 Association analysis between the ITPR3g.40886054A>G locus and the average number of lambs born in different goat populations

[0091] Fixed effects that were not significantly associated with individual phenotypic values, except for genotype effects, were removed. Association analysis was performed between the ITPR3 gene SNP locus and the average number of lambs born in Haimen goats, Bochum goats, and Hainan black goats. The results are expressed as "least square mean ± standard error".

[0092] The results are shown in Table 5. The association analysis results of the ITPR3g.40886054A>G site with the average number of lambs born in each genotype of Haimen goat, Bocha goat and Hainan black goat population are consistent with the trend.

[0093] Table 5. Association between ITPR3 gene SNP sites and average number of lambs born in different goat populations.

[0094]

[0095] Example 3: Method for improving reproductive traits in goats

[0096] The main methods for improving the reproductive traits of goats include the following steps:

[0097] 1. Collect blood from the goats to be tested and extract genomic DNA from the blood.

[0098] 2. Using primer P1 as described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification products.

[0099] in:

[0100] (1) PCR amplification system (20 μL): 2×TaqPlusMasterMixⅡ 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0101] (2) PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0102] (3) Sequencing: The PCR product and primer P1 were sent to General Biotech for direct sequencing.

[0103] (4) Genotype determination: The sequencing peak diagrams of the ITPR3g.40886054A>G site were compared and analyzed using SnapGene software. When the peak diagram showed a single peak of A, the genotype was AA; when the peak diagram showed a single peak of G, the genotype was GG; and when the peak diagram showed a double peak of A and G, the genotype was AG.

[0104] 3. The GG genotype of ITPR3g.40886054A>G can serve as an effective molecular marker for improving reproductive traits in goats.

[0105] Selecting individuals with the GG genotype as parents in goat breeding can increase the number of lambs born in the second and third litters.

[0106] By using the SNP molecular markers of this invention to screen goats, retaining individuals with the GG homozygous genotype and eliminating individuals with the AA homozygous genotype and the AG heterozygous genotype, the breeding goal of improving the reproductive performance of goats can be achieved.

Claims

1. The application of substances used to detect SNP molecular markers in the goat genome in any of the following: (a1) Application in identifying or assisting in the identification of reproductive traits in goats; (a2) Application in the preparation of products for the identification or auxiliary identification of reproductive traits in goats; (a3) Application in screening or assisted screening of goats with high reproductive traits; (a4) Application in the preparation of products for screening or assisting in the screening of goats with reproductive traits; (a5) Application of reproductive traits in goat breeding; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The SNP molecular marker is located at 138 bp of the nucleotide sequence shown in SEQ ID NO.1, and its polymorphism is A or G, and its genotype is GG, AG or AA. The reproductive trait mentioned is the number of lambs born. The genotype of the SNP molecular marker is significantly correlated with the number of lambs born in the second and third litters of goats. The number of lambs born in the second litter of GG genotype ewes is significantly higher than that of AG genotype ewes. The number of lambs born in the third litter of GG genotype ewes is significantly higher than that of AA genotype ewes.

2. The application according to claim 1, characterized in that, The substance is (b1) or (b2) or (b3) as follows: (b1) PCR primers for amplifying goat genomic DNA fragments containing the SNP molecular markers; (b2) PCR reagents containing the PCR primers described in (b1); (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

3. The application according to claim 2, characterized in that, The PCR primers described herein comprise an upstream primer F1 and a downstream primer R1; Upstream primer F1: 5'-AACTTGCACGTACTCTGCGC-3'; Downstream primer R1: 5'-TGTCTCGCACACCAGGTTGT-3'.

4. A method for identifying or assisting in the identification of reproductive traits in goats, characterized in that, The reproductive trait is the number of lambs born. The SNP molecular markers in the goat genome described in claim 1 were detected. The number of lambs born in the second litter of GG genotype ewes was significantly higher than that of AG genotype ewes. The number of lambs born in the third litter of GG genotype ewes was significantly higher than that of AA genotype ewes.

5. A breeding method for goats with high reproductive traits, characterized in that, The reproductive trait is the number of lambs born. The SNP molecular markers in the goat genome described in claim 1 are detected. Individuals with the GG homozygous genotype are retained, while individuals with the AA homozygous genotype and the AG heterozygous genotype are eliminated, thereby increasing the number of lambs born in each generation.

6. The method according to claim 4 or 5, characterized in that, The method for detecting SNP molecular markers in the goat genome is as follows: using the genomic DNA of the goat blood to be tested as a template, PCR amplification is performed using the PCR primers described in claim 2 or 3, and the genotype of the SNP molecular markers in the goat genome described in claim 1 is determined by direct sequencing of the PCR amplification products.

Images