Genes Associated with the Boll Setting Number of Cotton and Their Applications
By resequencing and SV-GWAS analysis of YM8 varieties, the gene evm.model.D06.3155 associated with cotton boll count was identified, which solved the problem that it is difficult to explore the genetic variations related to cotton boll count in the prior art, and achieved effective genetic improvement of cotton boll count.
Patent Information
- Application Number
- CN202411859319.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2044-12-17
AI Technical Summary
The prior art is difficult to effectively explore and utilize excellent genetic variations related to the number of cotton bolls, which limits the increase in cotton yield.
Through resequencing of YM8 varieties populations and SV-based genome-wide association analysis, a gene evm.model.D06.3155, which closely correlated with cotton boll count, was identified, which contains a nucleotide binding domain (NB-ARC).
It successfully revealed the genetic basis of cotton boll count, provided a marker for quickly identifying cotton varieties with multiple boll counts, and promoted the cotton breeding process.
Smart Images

Figure CN119433089B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnological applications, and relates to genes associated with the number of cotton bolls and their applications. Background Art
[0002] Cotton is one of the most important economic crops in the world and an important raw material for the textile industry, playing an irreplaceable role in agriculture, industry and economic development. The number of bolls is one of the main components of cotton yield, and increasing the number of bolls is an effective way to improve cotton yield. Therefore, it is of great significance to breed excellent cotton varieties by exploring and utilizing excellent genetic variations related to the number of cotton bolls.
[0003] Structural variation (SV), including insertions, deletions, inversions, and translocations, is one of the major sources of genomic variation and has been shown to play an increasingly important role in plant evolution, domestication, and breeding (Zhang et al., 2024). Genome-Wide Association Studies (GWAS) can link phenotypes to their underlying genetics across the population genome (Yasir et al., 2022) and is a powerful tool for revealing the associations between genetic variations and phenotypic traits. It has currently been widely used to identify complex traits and potential natural variations in crops (Gupta et al., 2014) and is often used to mine genes related to important agronomic traits such as yield, disease resistance, and stress tolerance. With the in-depth research of gene mining, molecular breeding, and the development of sequencing technologies, researchers have gradually realized that relying solely on SNP markers has many limitations, and enhancing the application of SVs will help to more comprehensively clarify the genetic basis of target phenotypes. Currently, SV-based GWAS analysis has been widely applied to species such as cucumber, peach, tomato, maize, and cotton. In 2015, Zhang et al. pioneered the use of SVs with MAF > 0.05 in 115 cucumber accessions for GWAS analysis of nodulated fruit and pistil traits, detecting a large segmental duplication controlling reproductive morphological traits, providing important resources for exploring genes underlying key cucumber traits and promoting breeding (Zhang et al., 2015). Guo et al. (2020) sequenced 336 peach individuals deeply, constructed a map containing more than 200,000 structural variations, and identified candidate genes associated with 26 agronomic traits using SV-GWAS. Among them, a 9-bp insertion in the Prupe.4G186800 gene encoding an NAC transcription factor was associated with early fruit ripening, and a 487-bp deletion in the promoter of PpMYB10.1 was associated with the flesh color around the fruit stone. In addition, a 1.67-Mb inversion was highly associated with fruit shape, and the PpOFP1 gene near the inversion breakpoint regulated the formation of flat shape. Li et al. (2023) genotyped SVs in a 321-tomato population by integrating the linear reference genome sequence of S. galapagense and SV information from 112 tomato genomes, and performed SV-based GWAS analysis on 32 flavor-related compounds and 362 fruit metabolites, detecting significant association signals in 17 flavor volatiles and 249 fruit metabolites. Yang et al. (2019) identified 80,614 polymorphic pSVs in 521 different lines, of which approximately 22% of the variations could not be detected by traditional SNP detection methods.Subsequently, SNP-GWAS and SV-GWAS were respectively used to analyze the traits of oil content and fatty acid content. The results showed that through SV-GWAS, a new significantly associated region located on chromosome 4 was discovered, and a gene Zm00015a017119 was found within this candidate region. This gene encodes enoyl-acyl carrier protein reductase (ENR), which catalyzes the last enzymatic step in the fatty acid elongation cycle. Jin et al. (2023) used the assembled genomes of 11 polyploid cottons to identify a total of 182,593 non-redundant structural variations (SVs) and constructed an SV-based pan-genome. Through SV-GWAS, some SVs related to yield and fiber quality improvement were identified, and these SVs were not recognized in SNP-based GWAS. At the same time, a 9-base insertion or deletion was found to be related to the elimination of the interspecific reproductive isolation between Gossypium hirsutum and Gossypium barbadense. The above research indicates that compared with traditional SNP-GWAS, SV-GWAS can uncover important genetic variation sites that were not previously discovered, which is an important supplement to it, can provide richer and more valuable gene resources for crop genetic improvement, and accelerate the breeding process. Summary of the Invention
[0004] The object of the present invention is to provide a gene associated with the boll number of cotton and its application in view of the deficiencies of the prior art. It is identified through the resequencing of the YM8 variety population and SV-based genome-wide association analysis. This gene contains a nucleotide-binding domain (NB-ARC). The results of SV-based genome-wide association analysis show that this gene is closely associated with the boll number of cotton.
[0005] The object of the present invention can be achieved by the following technical solutions:
[0006] The cDNA sequence of the cotton gene evm.model.D06.3155 in tetraploid YM8 is: SEQ ID NO.1, and the genomic sequence is: SEQ ID NO.2. The genomic sequence is transcribed forward. This gene is regulated by a neighboring SV locus. 300 bp of bases are inserted at this SV locus, and after mutation, the boll number of cotton is significantly less than that of the wild type.
[0007] The application of the cotton gene evm.model.D06.3155 of the present invention in identifying upland cotton varieties with more bolls.
[0008] Application of reagent for detecting SV locus in identifying cotton with multiple boll numbers. The population of varieties was divided into two haplotypes by the SV genotype in the population. The SV sequence of the cotton material with multiple boll numbers is A; the SV of the cotton material with few boll numbers is shown in SEQ ID NO.7: ATGTAAGACAACACCTATGGAATGGA AATATGCAATTGAGATGTTGAAACAATCAACATTACCAAAAATGAAAAATGAGGTATTTCCACTTTTGAAATTCAGCTATGATAATTTGCCTAATGCAACAATGAAATGTTGCCTCCTATATTGTTGTCTCATCGAGATGATTATCGTATTCCCAGAGAAAGGAATTAGTGGAGCATTGGTTTTGTGAAGGGTTGTTGAATGAATTTGATAGATTTAGTGAGCTCAA. Therefore, this SV can be used as a marker for quickly identifying cotton varieties with multiple boll numbers, and this SV is located at the 1083bp position of evm.model.D06.3155 (Gossypium hirsutum genome D06:64675001). Detect the base at the 1083bp position of the evm.model.D06.3155 gene in Gossypium hirsutum plants. Among them, the cotton with the base A at the 1083bp position is a cotton plant with multiple bolls. On the contrary, the cotton with the base shown in SEQ ID NO.7: ATGTAAGACAACACCTATGGA ATGGAAATATGCAATTGAGATGTTGAAACAATCAACATTACCAAAAATGAAAAATGAGGTATTTCCACTTTTGAAATTCAGCTATGATAATTTGCCTAATGCAACAATGAAATGTTGCCTCCTATATTGTTGTCTCATCGAGATGATTATCGTATTCCCAGAGAAAGGAATTAGTGGAGCATTGGTTTTGTGAAGGGTTGTTGAATGAATTTGATAGATTTAGTGAGCTCAA at the 1083bp position is a cotton plant with few boll numbers.
[0009] In addition, the reagent for detecting the SV locus includes a primer pair: the upstream primer is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6.
[0010] Application of evm.model.D06.3155 gene in improving the boll number of cotton.
[0011] Application of evm.model.D06.3155 gene in cultivating new varieties with multiple bolls by genetic engineering means.
[0012] The beneficial effects of the present invention are as follows:
[0013] (1) The genome of allopolyploid cotton is relatively complex. Genome-wide association analysis based on SV can more deeply reveal the association between complex genetic traits and genomic variations. Based on the high-quality upland cotton genome sequence, the present invention uses population genome resequencing and genome-wide association analysis technology based on SV to successfully identify genes closely related to the boll number in cotton. This technology has a relatively in-depth and extensive research foundation in crops such as maize.
[0014] (2) This gene is evm.model.D06.3155. The evm.model.D06.3155 gene of the present invention is significantly associated with the boll number in genome-wide association analysis based on SV.
[0015] (3) The cDNA and genomic sequences of the evm.model.D06.3155 gene are obtained by PCR technology. This technology has the advantages of strong specificity, high sensitivity, fast and simple operation, and strong repeatability, and can ensure the accuracy of the sequence.
[0016] (4) Using PCR technology, the present invention verified the SV genotypes of the evm.model.D06.3155 gene in the populations of varieties with relatively high and low boll numbers, which is fast, simple, accurate and reliable.
[0017] (5) According to the different SV genotypes of the evm.model.D06.3155 gene, the variety populations can be divided into two major categories, and there are significant differences in the boll number between these two categories of populations. This result further confirms the close association between the evm.model.D06.3155 gene and the boll number in cotton. Description of the Drawings
[0018] Figure 1 It is the association analysis result of the boll number in cotton and the whole-genome sequencing data and the sequence information of the evm.model.D06.3155 gene in Xinjiang in 2022. Among them, (A) is the GWAS association analysis result of the boll number trait in cotton. The abscissa represents the chromosome, and the ordinate represents the significance of the SV locus association, which is represented by -log 10 (P value). There is an SV locus at the position of chromosome D06 with a relatively high significance of association with the boll number trait in cotton. (B) is the position of the SV locus on the chromosome. The abscissa represents the position (Mb) on the chromosome, and the ordinate represents the significance of the SV locus association, which is represented by -log 10It is represented by (P value). (C) represents the sequence information of the evm.model.D06.3155 gene. There is a 300bp insertion in the exon of this gene, and the base at the SV site changes from A to that shown in SEQ ID NO.7.
[0019] Figure 2 It is the comparative analysis of the number of bolls between different haplotypes of the evm.model.D06.3155 gene. The box plot represents the distribution of the number of bolls in the variety population. Those containing evm.model.D06.3155 SV- and evm.model.D06.3155 SV+ There are 228 and 59 varieties with these two haplotypes respectively. The grey box plot (left) represents the trait distribution of the haplotype evm.model.D06.3155 SV- and the white box plot (right) represents the trait distribution of the haplotype evm.model.D06.3155 SV+ . The horizontal line within the box represents the median of the trait distribution. **** indicates a difference at the 0.0001 level. Specific implementation mode
[0020] Example 1: Mining of the evm.model.D06.3155 gene associated with the number of bolls in cotton and obtaining of the evm.model.D06.3155 gene:
[0021] In 2022, a detailed investigation of the number of bolls trait in cotton was carried out in Xinjiang for 370 modern cotton varieties or lines. At the same time, whole-genome resequencing was performed on these 370 cotton varieties with an average sequencing depth of 20X. These sequences were aligned to the genome sequence of the upland cotton genetic standard line TM-1 (V2.1). The Genome Analysis Toolkit (GATK) software was used to identify genome-wide structural variations (SVs), and the Efficient Mixed-Model Association eXpedited (EMMAX) software was used for genome-wide association analysis with the phenotype. By setting P < 10 -5 to screen for SV association signal sites, a locus (D06:64675001) significantly associated with the number of bolls in cotton was identified ( Figure 1 ). This SV is located in the exon of the candidate gene evm.model.D06.3155 in the LD block region where it is located, causing gene structure variation. Its cDNA sequence and genomic sequence are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.
[0022] The evm.model.D06.3155 was obtained from the genomic sequence. A pair of full-length gene primers (Table 1) were designed based on the two ends of its cDNA sequence, namely the cDNA amplification upstream primer F1 shown in SEQ ID NO.3 and the cDNA amplification downstream primer R1 shown in SEQ ID NO.4, for subsequent PCR amplification. The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 57°C for 15 sec, extension at 72°C for 45 sec, for 34 cycles; finally, extension at 72°C for 5 min. The PCR amplification product was sequenced and compared with the cDNA sequence to determine the sequence accuracy. Through the above steps, the evm.model.D06.3155 gene was obtained.
[0023] Table 1 PCR amplification primer sequences
[0024]
[0025] Example 2: Application of the evm.model.D06.3155 gene in identifying cotton with multiple boll numbers:
[0026] There is a synonymous mutation SV site of the evm.model.D06.3155 sequence in the population, as Figure 1 shown, at the 1083bp position of the genomic sequence, the base changes from A to
[0027]
[0028] Based on the position of this SV site on chromosome D06 (D06:64675001), amplification primers were designed at both ends (Table 2), namely the SV detection upstream primer F2 shown in SEQ ID NO.5 and the SV detection downstream primer R2 shown in SEQ ID NO.6, for PCR amplification and sequencing. The PCR reaction procedure was as follows: pre-denaturation at 98°C for 3 min; denaturation at 95°C for 15 sec, annealing at 57°C for 15 sec, extension at 72°C for 30 sec, for 34 cycles; finally, extension at 72°C for 5 min.
[0029] Table 2 PCR amplification primer sequences
[0030]
[0031] According to the base information of this SV site (D06:64675001) and the sequencing results, the genotypes of each variety population at this SV site were analyzed, and 228 materials with the haplotype evm.model.D06.3155(A) were identified, and the haplotype evm.model.D06.3155
[0032]
[0033] 59 materials( Figure 2 and Table 3). Combining the GWAS association results and the phenotypic survey data, the variety materials with the multi-boll number haplotype were labeled as evm.model.D06.3155 SV- and the variety materials with the few-boll number haplotype were labeled as evm.model.D06.3155 SV+ ( Figure 2 ). SV- represents the multi-boll number and SV+ represents the few-boll number.
[0034] Meanwhile, the t-test detection method was used to calculate the correlation of the boll number between the two groups of haplotypes( Figure 2 ). The results showed that compared with evm.model.D06.3155 SV- (A), the boll number of the haplotype evm.model.D06.3155 SV+
[0035]
[0036] decreased by 7.09%, showing a significant negative correlation with the boll number trait (P<0.0001).
[0037] In summary, the above results all indicate that the evm.model.D06.3155 gene has important research value in the improvement of the boll number of cotton and the cultivation of new cotton varieties. First, molecular markers can be developed based on the two different haplotypes of the evm.model.D06.3155 gene, which can be used to accurately identify the boll number trait of cotton and have extremely high practical value for breeding cotton varieties. Second, in the process of cultivating cotton varieties with a multi-boll number, genetic engineering means can be used to directly introduce the gene containing the multi-boll number evm.model.D06.3155(A) into cotton varieties to increase their boll number. At the same time, the SV sites in the few-boll number haplotype evm.model.D06.3155
[0038]
[0039] can be mutated to transform it into a multi-boll number haplotype, contributing to the breeding of new cotton varieties from two aspects.
[0040] Table 3 Distribution of multi-boll number and few-boll number haplotypes in population variety materials
[0041]
[0042]
[0043] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SV loci in identifying high-boll cotton, characterized in that: The SV site is located at the 1083 bp position of the cotton gene evm.model.D06.3155, and the nucleotide sequence of the cotton gene evm.model.D06.3155 is shown in SEQ ID NO.2; The application is specifically as follows: using a reagent for detecting SV sites to detect the nucleotide sequence at the 1083 bp position, wherein the cotton plant with the base A at the 1083 bp position is a cotton plant with a high number of bolls, and the cotton plant with the sequence at the 1083 bp position as shown in SEQ ID NO.7 is a cotton plant with a low number of bolls.
2. The use according to claim 1, characterized in that: The reagent for detecting the SV site includes a primer pair: the upstream primer is shown as SEQ ID NO.5, and the downstream primer is shown as SEQ ID NO.6.
Citation Information
Patent Citations
Method for selecting multi-target trait-associated haplotype of cotton and use thereof
AU2020100969A4
GbRPS1 gene for resisting plant fusarium wilt and verticillium wilt and application thereof
CN102321162A