Method for producing flow cell

Abstract

In an example of a method of manufacturing a flow cell, a functional material is deposited over a resin layer, the resin layer including recesses separated by interstitial regions. The resin layer includes an ultraviolet (UV) light blocking additive. The recesses overlie a first portion of the resin layer having a first thickness, and the gap regions overlie a second portion of the resin layer having a second thickness greater than the first thickness. The functional material readily interacts with the resin layer when exposed to UV light. A predetermined dose of UV light is directed through the resin layer, whereby the functional material within the recesses is exposed to the UV light and attached to the resin layer within the recesses. The functional material overlying the interstitial regions is partially blocked by the second resin without exposure to the UV light.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 501,075, filed on May 9, 2023, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is ILI261BPCT_IP-2602-PCT_Sequence_Listing.xml, the file size is 18,617 bytes, and the file creation date is April 30, 2024. Background Art

[0005] Some available platforms for sequencing of nucleic acid and other biomolecules utilize sequencing by synthesis. Utilize this method, synthesize nascent chain, and detect the interpolation of every kind of monomer (for example, nucleotide) in growing chain optically and / or electronically. Because the template strand guides the synthesis of nascent chain, the sequence of template DNA can be inferred according to a series of nucleotide monomers added to growing chain during the building-up process. In some examples of sequencing by synthesis, sequential paired end sequencing can be used, wherein the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced. In other examples, paired end sequencing can be used simultaneously, wherein the forward strand and reverse strand are sequenced simultaneously. Summary of the invention

[0006] The example of the circulation cell disclosed herein includes a resin layer with a recessed portion defined therein. The recessed portions defined in the resin layer are separated from each other by gap regions, and the resin layer has different thicknesses at various parts, for example, at these recessed portions and at these gap regions. The resin layer may also include an ultraviolet (UV) light blocking additive capable of reflecting and / or absorbing UV light radiation. By controlling the resin layer (for example, composition and / or thickness) and the UV light blocking additive included therein, the initiation of the UV-triggered chemical reaction at the resin layer surface can be controlled. Therefore, the method described herein enables the UV-triggered reaction to occur at the target and desired area of ​​the resin layer. The initiation of the reaction of controlling UV triggering can prevent the material from being attached to the undesirable area of ​​the resin layer surface, and therefore can eliminate other process steps during manufacturing, such as polishing off such materials from undesirable areas. Therefore, the various methods described herein simplify the circulation cell manufacturing workflow and are conducive to selectively initiating the UV-triggered reaction at various parts of the resin layer surface. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly not identical parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0008] Figure 1A is a top view of an example of a flow cell;

[0009] Figure 1B is an enlarged partial cross-sectional view of an example of the architecture within a flow channel of a flow cell;

[0010] Figure 1C is an enlarged partial cross-sectional view of another example of an architecture within a flow channel of a flow cell;

[0011] FIG. 2A to FIG. 2D is a schematic diagram that together illustrate an example of the method disclosed herein, wherein Figure 2A depicts the formation of a recessed portion in the resin layer directly adjacent to the gap region, Figure 2B Depicting application of a functional material (which readily interacts with the resin layer when exposed to UV light) over the resin layer defining the recessed portions and gap regions, Figure 2C Describes the Figure 2B The structure is exposed to a predetermined UV light dose and an attached functional material is formed within the recessed portion, and Figure 2D depicts the removal of unattached functional material from the interstitial region;

[0012] FIG. 3A to FIG. 3C are schematic diagrams showing an example of another method disclosed herein, wherein Figure 3A Depicting the introduction of a functional material into a flow cell comprising two patterned substrates, each patterned substrate comprising a resin layer having recessed portions separated by gap regions defined therein, Figure 3B Depicting exposing each of the two patterned substrates to a predetermined UV light dose and forming attached functional material within the recessed portion of each of the two patterned substrates, and Figure 3C depicts the removal of unattached functional material from a gap region of each of two patterned substrates;

[0013] FIG. 4A to FIG. 4E are schematic diagrams showing an example of yet another method disclosed herein, wherein Figure 4A Depicting applying a first functional material over a resin layer defining a recessed portion directly adjacent to a gap region, Figure 4B Describes the Figure 4A The structure is exposed to a predetermined UV light dose and an attached first functional material is formed within the recessed portion, Figure 4C depicting the removal of unattached first functional material from the gap region, Figure 4D Depicting applying a second material over the gap region and over the attached first functional material within the recess, and Figure 4E depicting directly exposing the second material to a second predetermined UV light dosage and forming an attached second material over the gap region;

[0014] Figure 5A is a graphical representation of spectrophotometric test results in terms of absorbance (arbitrary units, Y-axis) versus wavelength (nm, X-axis) demonstrating the absorption effect of inorganic UV light blocking additives included in different example resin layers;

[0015] Figure 5B is a graphical representation of spectrophotometric test results in terms of absorbance (arbitrary units, Y-axis) versus wavelength (nm, X-axis) demonstrating the absorption effect of organic UV light blocking additives included in different example resin layers;

[0016] Fig. 6A is a graphical representation of spectrophotometric test results in terms of absorbance (arbitrary units, Y-axis) versus wavelength (nm, X-axis) demonstrating the effect of varying resin layer thickness on UV light transmission (and absorption) through examples of resin layers described herein that contain examples of organic UV light blocking additives;

[0017] Figure 6B is an additional graphical representation of spectrophotometric test results in terms of absorbance (arbitrary units, Y-axis) versus resin thickness (nm, X-axis) demonstrating the effect of varying resin layer thickness on UV light transmittance (and absorption) through examples of resin layers described herein that contain examples of organic UV light blocking additives;

[0018] Fig. 7A is a schematic diagram of an example of an example primer set that can be used in one of the flow cells disclosed herein; and

[0019] Figure 7B is a schematic diagram of another example of an example primer set that can be used in one of the flow cells disclosed herein. DETAILED DESCRIPTION

[0020] The example of the flow cell disclosed herein can be used for sequencing process, and its example includes sequential paired end nucleic acid sequencing.In the example of sequential paired end sequencing, the primer set is attached in the recessed part in the resin layer limited to the flow cell.The primer in the primer set includes orthogonal cleavage (linearization) chemical composition, which makes it possible to generate a forward strand, sequence the forward strand, and then remove the forward strand, and then make it possible to generate a reverse strand, sequence the reverse strand, and then remove the reverse strand.In these examples, the orthogonal cleavage chemical composition means that the first cleavage site is insensitive to the removal mechanism of the second cleavage site, and vice versa.Therefore, the orthogonal cleavage chemical composition can be realized by the different cleavage sites attached to different primers in the group.

[0021] Other examples of the flow cell disclosed herein can be used for simultaneous paired end nucleic acid sequencing.For simultaneous paired end sequencing, different primer sets are attached to different regions of patterned substrates (for example, a primer set can be attached in a recessed portion and another primer set can be attached above the gap region, and the two groups can be attached to different regions in the recessed portion respectively). In these examples, the primer set can be controlled so that the cutting (linearization) chemical substances are orthogonal in different regions. In these examples, the orthogonal cleavage chemical composition can be realized by the same cleavage site of the different primers attached to different groups or by the different cleavage sites of the different primers attached to different groups. This enables the generation of a cluster of forward strands in one region (for example, in a recessed portion), and the generation of a cluster of reverse strands in another region (for example, in the gap adjacent to the recessed portion). In any one of these examples, the forward strand and the reverse strand are separated in space, which separates the fluorescent signals from the two reads, while allowing the simultaneous base detection of each read.

[0022] Several example methods are described to generate various examples of flow cells.

[0023] definition

[0024] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0025] "Acrylamide monomer" is a monomer with the structure A monomer or a monomer containing an acrylamide group. Examples of monomers containing an acrylamide group include azidoacetamidopentyl acrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used.

[0026] As used herein, an "aldehyde" is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to an oxygen), wherein the carbon atom is also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0027] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0028] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is completely saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have from 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, and the like. As an example, the name "C1-4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of: methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.

[0029] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0030] An "amine" or "amino" functional group refers to a -NR a R b Group, where R a and R b are each independently selected from hydrogen (e.g., ), C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0031] As used herein, "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the ring system is aromatic. Aryl groups may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0032] As used herein, the term "attachment" refers to a state in which two things are directly or indirectly joined, fastened, adhered, connected or combined with each other. For example, functional materials (e.g., polymer hydrogels, oligonucleotide primers, etc.) can be attached to a target surface (e.g., a target surface of a resin layer) by covalent bonds or non-covalent bonds. Covalent bonds are characterized by sharing electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve shared electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions. In some examples described herein, attachment can be promoted by reactions triggered by UV light.

[0033] The term "ethyleneimine" refers to a three-membered heterocyclic unsaturated compound containing a nitrogen atom.

[0034] An "azide" or "azido" functional group refers to -N3.

[0035] As used herein, the term "base carrier" refers to a material onto which another material or layer of material (eg, a resin layer) may be introduced.

[0036] As used herein, "bonding region" refers to an area on a patterned substrate to be bonded to another material, which may be, for example, a cover, a patterned substrate, etc., or a combination thereof (e.g., a patterned substrate and a cover). The bond formed at the bonding region may be a chemical bond (as described above with respect to attachment) or a mechanical bond (e.g., using fasteners, etc.).

[0037] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the main chain of the ring system. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocycles include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl.

[0038] As used herein, the term "carboxylic acid" or "carboxyl" refers to wherein R is an alkyl group, an alkenyl group, an aryl group, or another substituent.

[0039] As used herein, "cycloalkylene" refers to a fully saturated carbocyclic ring or ring system that is attached to the rest of the molecule through two points of attachment.

[0040] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbon ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbon ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.

[0041] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. One example is cyclooctyne. Another example is bicyclononyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.

[0042] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automatic, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping distribution, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0043] As used herein, the term "recess" refers to a discrete concave feature in a patterned substrate having a surface opening. The recess may be at least partially surrounded by a gap region of the patterned substrate. The recess may have any of a variety of shapes at the opening in its surface, including, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross-section of the recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc. As an example, the recess may be a hole or two interconnected holes. The recess may also have more complex structures, such as ridges, step features, etc.

[0044] As used herein, "dibenzoyl" refers to a compound containing two benzoyl groups (eg, two benzene rings or benzene rings, each independently bonded to a separate carbonyl group).

[0045] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0046] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell is also capable of detecting reactions occurring in the flow cell. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc.

[0047] As used herein, a "flow channel" or "channel" can be a region defined between two bonding components that can selectively receive a liquid sample. In some examples, the flow channel can be defined between a patterned substrate and a cover, and can therefore be in fluid communication with one or more surface chemical components on the patterned substrate. In other examples, the flow channel can be defined between two patterned substrates (each of the two patterned substrates having a surface chemical component thereon), and can therefore be in fluid communication with the surface chemical components of both substrates.

[0048] As used herein, "functional material" or "first functional material" refers to a material (e.g., a polymer hydrogel in the form of a layer or particle, or a polymer hydrogel coated on a core particle, or a primer of a primer set) that is sensitive to a specific chemical reaction (e.g., chemical bonding with a resin layer or with another substance) when exposed to UV light. After exposure to UV light, the functional material undergoes a UV-triggered chemical reaction with the underlying resin layer, causing the two to become attached. After this chemical reaction, the functional material is referred to as an "attached functional material".

[0049] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms, i.e., elements other than carbon, such as nitrogen, oxygen and / or sulfur in the ring backbone. When heteroaryl is a ring system, each ring in the ring system is aromatic. A heteroaryl group may have 5-18 ring members.

[0050] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. The heterocycles can be joined together in a fused, bridged or spiro manner. The heterocycle can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms can be present in non-aromatic rings or aromatic rings. The heterocyclic group can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N or S.

[0051] As used herein, the term "hydrazine" or "hydrazine" refers to a -NHNH2 group.

[0052] As used herein, the term "hydrazone" or "hydrazine" refers to Group, where Ra and R b Each is independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocycle, as defined herein.

[0053] As used herein, "hydroxy" refers to an -OH group.

[0054] As used herein, "nitrile oxide" refers to "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on an imidic chloride [RC(Cl)=NOH] or by reaction between hydroxylamine and an aldehyde.

[0055] As used herein, "nitrone" refers to Group, where R 1 , R 2 and R 3 It can be R as defined in this article a Group and R b Any of the groups, except that R 3 Not hydrogen (H).

[0056] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is the monomer unit of a nucleic acid sequence. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position in the ribose. The nitrogenous heterocyclic base (i.e., a nucleobase) may be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 atom of pyrimidine or the N-9 atom of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0057] In some examples, the term "over" may mean that one component or material is directly on another component or material. When one is directly on another, the two are in contact with each other. For example, Figure 1B In the embodiment of the present invention, the resin layer 16 is applied over the base carrier 14 such that the resin layer 16 is directly located on and in contact with the base carrier 14 .

[0058] In other examples, the term "over" may mean that one component or material is indirectly located on another component or material. By indirectly, it is meant that a gap or another component or material is located between the two components or materials. Figure 2B In the embodiment, the functional material 22 is positioned above the base carrier 14 so that the two are in indirect contact. The resin layer 16 is positioned between the two.

[0059] A "patterned substrate" or "patterned structure" refers to a structure that, in some cases, includes a resin layer applied over a base carrier, wherein the resin layer has recesses defined therein in a pattern. In some cases, surface chemistry is introduced into the recesses. In some examples, the structure has been exposed to a patterning technique (e.g., stamping, etching, photolithography, etc.) to generate a pattern / architecture for the recesses. The patterned substrate can be generated by any of the methods disclosed below.

[0060] As used herein, in some examples, a "pre-clustered particle" includes a core, a hydrogel coating attached to the core, a plurality of primers attached to the side chains or arms of the hydrogel coating, a plurality of amplicons attached to at least some of the plurality of primers, and a surface attachment mechanism that attaches the pre-clustered particle to the resin layer. In other cases, the core of the pre-clustered particle is made of a polymer hydrogel and therefore does not include an additional polymer hydrogel coating.

[0061] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers referred to herein as amplification primers are used as the starting point for template amplification and cluster generation. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The 5' end of the primer may be modified to allow coupling reaction with the functional group of the polymer. The primer length may be any number of base lengths and may include a variety of non-natural nucleotides. In one example, the sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0062] As used herein, "surface chemistry" refers to i) primers that are or will be attached to the flow cell surface and are capable of amplifying library template strands, or ii) primers and the polymer hydrogel that attaches these primers to a substrate.

[0063] The term "sydnone" refers to a mesoionic heterocyclic chemical compound having a 1,2,3-oxadiazole core with a keto group at the 5 position.

[0064] A "thiol" functional group refers to -SH.

[0065] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0066] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazole may be optionally substituted.

[0067] The term "UV blocking" can be used to describe a material that is capable of at least partially absorbing and / or reflecting a specific wavelength or range of wavelengths. Transmittance is the ratio of light energy falling on an object to the light energy transmitted through the object, and can be used to quantify the UV blocking properties of a material. In the examples disclosed herein, the transmittance of a material capable of blocking UV light can range from 0 (0%) to less than 0.25 (25%). In the case where the transmittance of a material capable of blocking UV light is greater than about 0.1 (10%), it may be desirable to include a UV-transmitting portion (e.g., a thinner portion) and a UV-blocking portion (e.g., a thicker portion) that produces a higher UV blocking contrast, i.e., a higher difference in UV blocking capability. As an example, when the transmittance of the UV-blocking portion ranges from 0.1 to 0.25, the transmittance of the UV-transmitting portion can be selected to have a transmittance of 0.85 (85%) or more.

[0068] The terms "UV-transmitting" or "UV-transmissive" may be used to describe a material that is capable of allowing a particular wavelength or range of wavelengths of ultraviolet light to pass therethrough. The transmittance of the base carrier or resin layer will depend on the thickness of the base carrier or layer, the presence, type, and amount of any UV light blocking additives, the wavelength of the light, and the dose of light to which the base carrier or resin layer is exposed. In the examples disclosed herein, the transmittance of the thinner portions of the base carrier or resin layer may range from 0.25 (25%) to 1 (100%).

[0069] As used herein, "triazine" refers to a six-membered heterocyclic group comprising three nitrogen atoms and three carbon atoms. The triazine may be optionally substituted.

[0070] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0071] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0072] The terms top, bottom, lower, upper, on, above, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation. As an example, Figure 3AThe flow cell in comprises two patterned structures, and its recessed portion faces the flow channel defined therebetween. In the lower patterned structure, the thinner part of the resin layer is located below each recessed portion in the recessed portion, and in the upper patterned structure, the thinner part of the resin layer is located above each recessed portion in the recessed portion. However, the flow cell can be inverted so that the opposite situation is established. Therefore, a component is located above or below another component and can depend on the orientation of the described components.

[0073] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0074] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe a value, the term is intended to cover minor variations (up to + / - 10%) from the value.

[0075] Flow cell

[0076] Examples of flow cells for sequential paired-end sequencing generally include a patterned structure including a resin layer having recesses defined therein and functional materials attached within the recesses.

[0077] An example of a flow cell 10 is shown in Figure 1A Although not shown in the figure, the flow cell 10 may include two patterned structures bonded together (such as the reference FIG. 3A to FIG. 3C ) or a patterned structure bonded to a cover (cover not shown).

[0078] The flow channel 11 is located between two patterned structures or between a patterned structure and a cover. The two patterned structures or a patterned structure and a cover can be bonded together by a spacer layer (see FIG. 3A to FIG. 3C 36 in the figure). Thus, each flow channel 11 is defined by the patterned structure, the spacer layer and the cover or the second patterned structure.

[0079] Figure 1AThe example shown includes eight flow channels 11. Although eight flow channels 11 are shown in the figure, it should be understood that any number of flow channels 11 (e.g., a single flow channel 11, four flow channels 11, etc.) can be included in the circulation pool 10. Each flow channel 11 can be separated from another flow channel 11 so that the fluid introduced into the flow channel 11 does not flow into the adjacent flow channel 11. Some examples of fluids introduced into the flow channel 11 can introduce reaction components (e.g., DNA samples, polymerases, sequencing primers, nucleotides, etc.), washing solutions, deblocking agents, etc.

[0080] Each flow channel 11 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 11 may be positioned at opposite ends of the flow cell 10. The inlet and outlet of the respective flow channel 11 may alternatively be positioned at any position along the length and width of the flow channel 11 that enables the desired fluid flow.

[0081] The inlet allows fluid to be introduced into the flow channel 11, and the outlet allows fluid to be drawn out of the flow channel 11. Each of the inlet and outlet is fluidly connected to a fluid control system (including, for example, a reservoir, a pump, a valve, a waste container, etc.) that controls fluid introduction and discharge.

[0082] The flow channel 11 may have any desired shape. In one example, the flow channel 11 has a substantially rectangular configuration with curved ends (eg, Figure 1A ). The length of the flow channel 11 depends in part on the size of the substrate (e.g., resin layer and base carrier) used to form the patterned structure. The width of the flow channel 11 depends in part on the size of the substrate used to form the patterned structure, the desired number of flow channels 11, the desired spacing between adjacent channels 11, and the desired spacing at the periphery of the patterned structure. The space between and at the periphery of the channels 11 can be sufficient to attach to a cover (or another patterned structure).

[0083] When microcontact, aerosol or inkjet printing is used to deposit a separate material that defines the wall of the flow channel 11, the depth of the flow channel 11 can be as small as a single layer thick. The separation material is an example of a spacer layer 36. For other examples, the depth of the flow channel 11 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm or more. In one example, the depth may be in the range of about 10 μm to about 100 μm. In another example, the depth may be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of the flow channel 11 may be greater than, less than, or between the values ​​specified above.

[0084] A spacer layer for attaching the patterned structure and the cover (or for attaching the first patterned structure and the second patterned structure) (see again FIG. 3A to FIG. 3C The spacer layer 36 (reference numeral 36 in the figure) can be any material that will seal the patterned structure and the portion of the cover (or will seal the first patterned structure and the second patterned structure). As an example, the spacer layer 36 can be an adhesive, a radiation absorbing material that facilitates bonding, etc. In some examples, the spacer layer 36 is a radiation absorbing material, such as black( black).

[0085] When used, the cover can be any material that is transparent to the excitation light directed toward the flow cell 10 during the sequencing operation. In an optical detection system, the cover can also be transparent to the emissions generated by the reactions occurring in the flow cell 10. As an example, the cover can include glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable polymeric materials, namely cycloolefin polymers, are available from Zeon Chemicals LP. In some cases, the cover is shaped to form the top of the flow cell 10 , and in other cases, the cover is shaped to form both the top of the flow cell 10 and the sidewalls of the flow channel 11 .

[0086] The patterned structure comprises a bonding area where it can be sealed to the cover or a second patterned structure. The bonding area can be located at the periphery of each flow channel 11 and / or at the periphery of the patterned structure (and therefore at the periphery of the flow cell 10).

[0087] like Figure 1B and Figure 1C As shown, the flow channel 11 is at least partially defined by at least one patterned structure of the resin layer 16. The patterned structure includes the resin layer 16 having recessed portions 18 defined therein, wherein the recessed portions 18 are separated by gap regions 20. Figure 1B and Figure 1C As further shown, a resin layer 16 is applied directly over the base carrier 14 .

[0088] Suitable example materials for the base carrier 14 are capable of transmitting a predetermined UV light dose for initiating a chemical reaction within the recess 18 defined in the resin layer 16 (as described in more detail herein). The selected base carrier 14 is also transparent to the excitation light directed toward the circulation pool 10 during the sequencing operation. As some examples, the base carrier 14 may include silicones, glass, modified or functionalized glass, polymer materials (including acrylic resins, polystyrene and copolymers of styrene and other materials, polyethylene terephthalate (PET), polycarbonate, cyclic olefin copolymers (COC), some polyamides, silicon dioxide or silicon oxide (e.g., SiO2), fused silica, silicon dioxide-based materials, silicon nitride (Si3N4), resins, etc. The material of the base carrier 14 can be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting base carrier 14 is capable of having a desired transmittance.

[0089] The base carrier 14 can be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm, for example, about 200 mm to about 300 mm, or can be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). For example, the width of the die can range from about 0.1 mm to about 10 mm. Although example dimensions have been provided, it should be understood that a base carrier 14 having any suitable dimensions can be used to support the resin layer 16.

[0090] As described, the patterned substrate includes a resin layer 16. The resin layer 16 has recesses 18 defined therein, and has gap regions 20 separating the recesses 18. The material of the resin layer 16 can exhibit variable transmittance depending in part on the thickness of the resin layer 16. In the examples described herein, the material of the resin layer 16 is selected to be capable of transmitting a predetermined dose of UV light through a portion located below the recesses 18 (as described in more detail herein). Examples of materials for the resin layer 16 that can transmit UV light include polymer resins such as poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxy resins), acrylic resins, acrylate resins, methacrylate resins, thiol-based resins, tetrazole-based resins, amorphous fluoropolymer resins (e.g., from Bellex), and polyether resins (e.g., polyether resins). ) and combinations thereof. Other example resins include sterone-containing polymers, aziridine-containing polymers, resins capable of oxime attachment (e.g., those comprising electrophilic carbonyl groups (e.g., aldehydes / ketones) that can react with nucleophilic aminooxy groups), or any other resin containing UV clickable functional groups.

[0091] Any of the example resin materials described herein also include a resin material that can be combined with the functional material 22' (or in some cases, Figure 1CThe functional material 22' is shown as a surface functional group that reacts (upon exposure to UV light) with a functional group of the second material 32') that is attached to the resin layer 16 during the example method. As an example, a thiol-ene resin (made of acrylate and thiol monomers) includes surface thiol groups that can react with an alkene or alkyne of the functional material 22' (or an alkene / alkyne of the second material 32').

[0092] Although at least some of the resin layer 16 is capable of transmitting UV light (depending in part on the thickness), it should be understood that the resin layer 16 may also include ultraviolet (UV) light blocking additives 30 (e.g., Figure 1B and Figure 1C ). Suitable examples of the UV light blocking material 30 for the resin layer 16 include inorganic particles, such as carbon black, metal oxides (e.g., titanium dioxide, zinc oxide, zirconium dioxide, etc.), or combinations thereof. A specific example of the resin layer 16 having inorganic particles as the UV light blocking additive 30 is an acrylate resin doped with titanium dioxide (TiO2). Other suitable examples of the UV light blocking additive 30 for the resin layer 16 include organic materials, such as triazole-based compounds, triazine-based compounds, dibenzoyl-based compounds, or combinations thereof. A specific example of the resin layer 16 having an organic material for the UV light blocking additive 30 is an acrylate resin doped with avobenzone.

[0093] In one example, the resin layer 16 includes about 1 wt % to about 50 wt % of the UV light blocking additive 30, based on the total weight of the resin layer 16. In another example, the resin layer 16 includes about 2 wt % to about 25 wt % of the UV light blocking additive 30, based on the total weight of the resin layer 16. In yet another example, the resin layer 16 includes about 3 wt % to about 22.5 wt % of the UV light blocking additive 30, based on the total weight of the resin layer 16. In still another example, the resin layer 16 includes about 15 wt % to about 20 wt % of the UV light blocking additive 30, based on the total weight of the resin layer 16.

[0094] The resin layer 16 may be any resin material having UV absorbance and / or transmittance, which may be varied by adjusting its thickness and may be manufactured to include UV light blocking additives 30. Figure 1B and Figure 1CAs shown, the resin layer 16 can have a first (thinner) thickness T1 at the recessed portion 18 and a second (thicker) thickness T2 at the gap region 20. Any of the previously listed resins can be used for the resin layer 16, it being understood that the thicker portion of the resin layer 16, such as at T2, is manufactured to block UV light from reaching the gap region 20 (when the UV light is directed through the resin layer 16), while the thinner portion of the resin layer 16, such as T1, is manufactured to transmit sufficient UV light through the resin layer 16 to induce the desired chemical reaction within the recessed portion 18.

[0095] In some examples, the resin layer 16 has a thicker portion T2 (under the gap region 20) ranging from about 300 nm to about 600 nm and a thinner portion T1 (under the recessed portion 18) ranging from about 20 nm to about 200 nm. In these examples, the resin layer 16 will block the transmission of UV light through the gap region 20 and thus prevent the initiation of a UV light-triggered reaction at the gap region 20. In contrast, the resin layer 16 will allow sufficient UV light to be transmitted through the recessed portion 18, which will initiate a UV light-triggered reaction within the recessed portion 18. In one example, the thicknesses T1, T2 are 150 nm and 500 nm, respectively, and range from about 30 mJ / cm 2 to about 60mJ / cm 2 A predetermined UV light dosage may be used to achieve a selective UV light-triggered reaction within the recess 18 .

[0096] Although some example ranges of the thicknesses T1, T2 of the resin layer have been given, it should be understood that the material of the resin layer 16, the thicknesses T1, T2 of the resin layer 16, the predetermined UV light dosage, and the amount / type of the UV light blocking additive 30 in the resin layer 16 can each be independently adjusted to achieve the desired UV blocking at the thicker portion T2 of the resin layer 16 (e.g., the portion located below the gap region 20) and to achieve the desired UV transmittance at the thinner portion T1 of the resin layer 16 (e.g., the portion located below the recess 18).

[0097] The correlation between the predetermined UV light dose, the UV absorption constant and the thickness of the resin layer 16 can be expressed as:

[0098] D0=D×exp(-kd)

[0099] Where D0 is the predetermined UV dose required to initiate a chemical reaction between the UV reactive groups of the resin layer 16 and the functional material 22 within the recessed portion 18, D is the actual UV dose applied to the patterned substrate, k is the absorption constant of the resin, and d is the thickness T1 of the resin layer 16 (e.g., at a thinner portion). Therefore, the actual UV dose (D) can be expressed as:

[0100] D=D0 / exp(-kd)

[0101] It should be appreciated that each of D, D0, and k may depend in part on the amount and type of UV light blocking additive 30 included in the resin layer 16. As described, during fabrication of the patterned substrate, the resin layer 16 is deposited on the base carrier 14.

[0102] Suitable deposition techniques for layer 16 include dip coating, immersion coating, spin coating, spray coating, whipping dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, micro-contact printing, etc. As described, the resin layer 16 is patterned to include recessed portions 18 separated by gap regions 20. Suitable patterning techniques for layer 16 include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, micro-etching techniques, etc. The deposition and patterning techniques used may depend in part on the material used for the base carrier 14 and the material used for the resin layer 16.

[0103] Many different layouts of recesses 18 can be envisioned, including regular, repeated, and irregular patterns. In one example, recesses 18 are arranged in a hexagonal grid to achieve close packing and improved density. Other layouts may include, for example, a straight (rectangular) layout, a triangular layout, etc. In some examples, the layout or pattern may be an xy format in rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recesses 18 and gap regions 20. In still other examples, the layout or pattern may be a random arrangement of recesses 18 and gap regions 20.

[0104] The layout or pattern can be characterized with respect to the density (number) of recesses 18 in a defined area. For example, the recesses 18 can be approximately 2 million / mm. 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 pieces / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2or greater or lesser density. It should also be understood that the density can be between one of the lower and upper limits selected from the above ranges, or other densities (outside the given ranges) can be used. As an example, a high density array can be characterized as having recesses 18 separated by less than about 100 nm, a medium density array can be characterized as having recesses 18 separated by about 400 nm to about 1 μm, and a low density array can be characterized as having recesses 18 separated by more than about 1 μm.

[0105] The layout or pattern of the recessed portion 18 may also be characterized according to or alternatively according to the average pitch, or the spacing from the center of one recessed portion 18 to the center of an adjacent recessed portion 18 or the spacing from the right edge of one recessed portion 18 to the left edge of an adjacent recessed portion 18 (edge-to-edge spacing). The pattern may be regular, so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or greater or less. The average pitch of a particular pattern of recessed portions 18 may be between a value selected from the lower limit value of the above range and a value in the upper limit value. In one example, the recessed portion 18 has a pitch of about 1.5 μm (center-to-center spacing). Although exemplary average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0106] The size of each recess 18 can be characterized by its volume, opening area, depth and / or diameter or length and width. For example, the volume can be about 1×10 -3 μm 3 to about 100 μm 3 In the range of, for example, about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , or larger, or smaller. For another example, the opening area can be about 1×10 -3 μm 2 to about 100 μm 2 In the range of, for example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2, or greater, or less. For another example, the depth can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater, or less. For another example, the depth can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater, or less. For another example, each of the diameter or length and width can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater or less.

[0107] It should be understood that in the final flow cell 10 , the recess 18 is in fluid communication with the flow channel 11 .

[0108] like Figure 1B and Figure 1C As shown, the recessed portion 18 includes an attached functional material 22'. The attached functional material 22' is composed of a functional material 22 (e.g., see FIG. 1 ) that is susceptible to interacting (e.g., covalently attaching) with the resin layer 16 (e.g., which forms the bottom and sidewalls of the recessed portion 18) when exposed to a predetermined UV light dose. Figure 2B )form.

[0109] In some examples, the functional material 22 may be a polymer hydrogel. The polymer hydrogel used as the functional material 22 is susceptible to interacting with the resin layer 16 when the polymer hydrogel is in direct contact with the resin layer 16 and the interface of the materials is exposed to a predetermined UV light dose. The UV light exposure triggers a chemical reaction that attaches the polymer hydrogel to the resin layer 16 within the recessed portion. Therefore, the polymer hydrogel and the resin layer 16 have corresponding functional groups that react with each other when exposed to the predetermined exposure.

[0110] In addition to including UV responsive functional groups, the polymer hydrogel can also swell upon absorbing liquid and can shrink upon removing the liquid, such as by drying. In a specific example, the polymer hydrogel comprises an acrylamide copolymer, such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM). Some other forms of PAZAM and acrylamide copolymers are represented by the following structure (I):

[0111]

[0112] in:

[0113] R A selected from the group consisting of: azido, optionally substituted amino (e.g., aminooxy), optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;

[0114] R B is H or optionally substituted alkyl;

[0115] R C , R D and R E are each independently selected from the group consisting of H and optionally substituted alkyl;

[0116] -(CH2) p - each of which may be optionally substituted;

[0117] p is an integer ranging from 1 to 50;

[0118] n is an integer in the range of 1 to 50,000; and

[0119] m is an integer in the range of 1 to 100,000.

[0120] One of ordinary skill in the art will recognize that the arrangement of recurring "n" and "m" features in structure (I) is representative and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0121] The molecular weight of PAZAM and other forms of acrylamide copolymers may range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0122] In some examples, PAZAM and other forms of acrylamide copolymers are linear polymers. In some other examples, PAZAM and other forms of acrylamide copolymers are lightly cross-linked polymers.

[0123] In other examples, the polymer hydrogel can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Replace, where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group (rather than H, as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0124] As another example of a polymer hydrogel, the recurring "n" feature in structure (I) can be replaced with a monomer including a heterocyclic azido group having structure (II):

[0125]

[0126] Where R 1 is H or C1-C6 alkyl; R2 is H or C1-C6 alkyl; L is a linker including a straight chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; selected from E is a straight chain including 1 to 4 atoms selected from carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0127] As yet another example, the polymer hydrogel may comprise recurring units of each of structures (III) and (IV):

[0128]

[0129] Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b Each of L is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-C14 aralkyl; and each L 1 and L 2 are independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0130] The polymer hydrogel can be prepared by polymerizing the monomers to be formed into the hydrogel. The polymerization method and process conditions will depend on the monomer. In one example, reversible addition-fragmentation chain transfer (RAFT) polymerization can be used to synthesize the hydrogel. Although RAFT polymerization can be used, it should be understood that other polymerization methods can also be used. Other suitable polymerization methods include atom transfer radical polymerization (ATRP), nitroxide free radical mediated free radical (NMP) polymerization combined with RAFT or ATRP, NMP with additional crosslinking steps, cobalt-mediated polymerization, group transfer polymerization (GTP), ring-opening polymerization (ROP), ionic polymerization, or any other polymerization method that directly or indirectly produces a desired linear or branched architecture. In some cases, the polymerization of the polymer hydrogel can be triggered by exposing the polymer hydrogel to a predetermined UV light dose (e.g., after the monomer components of the polymer hydrogel have been deposited in the recess 18).

[0131] The following is a method for applying and selectively attaching a polymer hydrogel in a recess 18 and thereby forming an example of an attached functional material 22' with reference to Figures 2, 3 and 4. This example of an attached functional material 22' is capable of grafting a primer set 24 (including primers 26, 28) thereon. As will be described in more detail in the description of the method, the primers 26, 28 may be pre-grafted onto the polymer hydrogel, or may be grafted after the polymer hydrogel is attached to the recess 18 and after the unattached polymer hydrogel is removed from the gap region 20.

[0132] Although Figure 1B or Figure 1C Not shown, but in other examples, the functional material 22 can be a functionalized particle. The functionalized particle includes any of the previously listed polymer hydrogels coated on a core particle, or can include a polymer hydrogel as the particle itself (i.e., without a different core material). The surface of either example of the functionalized particle is a polymer hydrogel that is susceptible to interacting with the resin layer 16 when in direct contact with the resin layer and when exposed to a predetermined UV light dose.

[0133] The core particles can be inert to various chemical components used throughout the sequencing workflow. For example, the core particles can be inert to the chemical components used to attach the primers 26, 28 (e.g., of the primer set 24) to the polymer hydrogel coating, or to a predetermined UV light dose used to attach the polymer hydrogel coating to the resin layer 16 within the recess 18, etc.

[0134] Examples of suitable materials for the core particles include inert and / or magnetic particles (e.g., magnetic FeO x , silica-coated FeO x), polymers (e.g., polytetrafluoroethylene (PTFE), some polyacrylics, polypropylene, polyethylene, polybutylene, polyurethane, polystyrene and other styrene copolymers, nylon (i.e., polyamide), and polycaprolactone (PCL)), nitrocellulose, silica (SiO2), silica-based materials (e.g., functionalized SiO2), carbon, or metals.

[0135] In order to form functionalized particles, a polymer hydrogel can be formed and then coated on the core particles. The polymer hydrogel can be prepared using any polymerization method disclosed herein. The polymer hydrogel can then be coated on the core using any suitable deposition technique. Examples of suitable deposition techniques include dip coating, dip coating, spin coating, spray coating, whipping distribution, ultrasonic spraying, etc. In one example, the core can be suspended in the polymer hydrogel and exposed to conditions (e.g., heat) that will initiate the attachment of the polymer hydrogel to the core. The type of attachment formed will depend on the chemical composition of the hydrogel and the core. It should be understood that at least some functional groups of the polymer hydrogel coating will be available for primer grafting and UV-induced attachment to the resin layer 16.

[0136] In other examples, the polymer hydrogel can be formed into particles.

[0137] When the polymer hydrogel is used as a coating on the core particle, the thickness of the polymer hydrogel coating on the core particle ranges from about 10 nm to about 200 nm. The hydrogel can be in a dry state or can be in a swollen state, wherein it absorbs liquid. A 10 nm thickness represents a hydrogel in a completely dry state, and a 200 nm thickness represents a hydrogel in a fully swollen state.

[0138] The particle size of the functionalized particles (including thickness when the polymer hydrogel is used as a coating) can be selected so that a single particle can be attached within each recess 18 defined in the resin layer 16. Thus, the functionalized particles can be slightly smaller than the size of the recess 18.

[0139] Another example of a method for applying and selectively attaching functionalized particles in the recess 18 and thereby forming an attached functional material 22' is described below with reference to the series of Figures 2, 3 and 4. This example of attached functional material 22' (i.e., functionalized particles) enables the grafting of primer set 24 (including primers 26, 28) onto the polymer hydrogel particles or polymer hydrogel coating. Primers 26, 28 can be pre-grafted onto the polymer hydrogel particles or the polymer hydrogel coating of the functionalized particles, or can be grafted after the functionalized particles are attached to the recess 18 and the unattached functionalized particles are removed from the gap region 20.

[0140] In the example where the functional material 22 (functional material 22' for forming attachment) is a functionalized particle having primers 26, 28 pre-grafted thereon, the functionalized particle can be a "pre-clustered" functionalized particle. The "pre-clustered" functionalized particle includes a polymer hydrogel particle or core particle and a hydrogel coating thereon, and also includes primers 26, 28 attached to the side chains or arms of the hydrogel, a plurality of amplicons attached to at least some of the primers 26, 28, and a surface attachment mechanism that attaches to the UV-reactive functional groups of the resin layer 16 (within the recess 18) when exposed to a predetermined dose of UV light. The surface attachment mechanism can be any UV-reactive functional group disclosed herein and can be part of the polymer hydrogel. The pre-clustered functionalized particles can be used to generate template nucleic acid chains (i.e., amplicons) to be sequenced. An example method for forming pre-clustered functionalized particles will now be described.

[0141] At the beginning of template strand formation, library templates can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample). DNA nucleic acid samples can be fragmented into single-stranded, similar-sized (e.g., <1000bp) DNA fragments. RNA nucleic acid samples can be used to synthesize complementary DNA (cDNA), and cDNA can be fragmented into single-stranded, similar-sized (e.g., <1000bp) cDNA fragments. During preparation, a joint can be added to the end of any fragment. By reducing cyclic amplification, different motifs can be introduced in the adapter, such as sequencing primer binding sites, indexes, and regions complementary to primers 26, 28 on functionalized particles. In some examples, fragments from a single nucleic acid sample have the same joint added thereto. The final library template includes a DNA or cDNA fragment and joints at both ends. The DNA or cDNA fragment represents the portion to be sequenced of the final library template.

[0142] A plurality of library templates can be introduced into a suspension comprising a liquid carrier and the functionalized particles disclosed herein. The plurality of library templates are hybridized, for example, with one of two types of primers 26, 28, which are immobilized on the polymer hydrogel particles or the polymer hydrogel coating on the core particles.

[0143] The template nucleic acid strand on the functionalized particle can be amplified to form a functionalized particle with a cluster of template strands. In one example, amplification involves cluster generation. In one example of cluster generation, a high-fidelity DNA polymerase is used to copy the library template from hybridization primers 26, 28 by 3' extension. The original library template is denatured so that the copy is fixed around the functionalized particle. Isothermal bridge amplification or some other forms of amplification (e.g., exclusion amplification) can be used to amplify fixed copies. For example, the copied template loops back to hybridize with adjacent complementary primers, and the polymerase replicates the copied template to form a double-stranded bridge, and these double-stranded bridges are denatured to form two single strands. These two chains loop back and hybridize with adjacent complementary primers, and extend again to form two new double-stranded loops. The process is repeated for each template copy by isothermal denaturation and amplification cycles, thereby generating dense clonal clusters on the functionalized particle. Each cluster of double-stranded bridges is denatured. In one example, the antisense strand is removed by specific base cleavage, leaving the forward template strand. Clustering leads to the formation of several template strands fixed on the functionalized particle. This example of clustering is called bridge amplification, and is one example of an amplification that may be performed. It should be understood that other amplification techniques may be used.

[0144] When used to form an attached functional material 22', the functionalized particles (whether pre-clustered or not) are capable of anchoring to the resin layer 16 forming the bottom of the recess 18. The anchoring is possible through a surface attachment mechanism of the functionalized particles. The surface attachment mechanism can be any UV reactive functional group that is part of the polymer hydrogel particles or the polymer hydrogel coating of the functionalized particles. The UV reactive functional groups of the (pre-clustered) functionalized particles react with the UV reactive functional groups of the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose.

[0145] As described above, each of the examples of the attached functional material 22' described so far includes a primer set 24 attached thereto. Figure 1B and Figure 1C In the example shown, the primer set 24 is attached to a polymer hydrogel as an example of an attached functional material 22'. Figure 1B or Figure 1C Not shown, but the primer set 24 may be attached to the polymer hydrogel particle or the polymer hydrogel coating of the functionalized particle, which is another example of an attached functional material 22'.

[0146] In either example, the primer set 24 is attached to the polymer hydrogel (e.g., coated on the core particle, on the particle itself, or applied within the recess 18). The primer set 24 includes two different primers 26, 28 that can be used for sequential paired end sequencing. As an example, the primer set 24 may include P5 and P7 primers, P15 and P7 primers, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. As another example, the second primer set 24 may include any two PA, PB, PC, and PD primers, or any combination of a PA primer and a PB, PC, or primer PD, or any combination of a PB primer and a PC or PD primer, or any combination of a PC primer and a PD primer. Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example, in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOMEANALYER TM The P5 and P7 primers have universal sequences for seeding and / or amplification purposes.

[0147] The P5 primer (which may be a cleavable primer due to the cleavable nucleobase uracil or "n") is:

[0148] P5#1: 5' → 3'

[0149] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1)

[0150] P5#2: 5' → 3'

[0151] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.2)

[0152] wherein "n" is inosine in SEQ.ID.NO.2; or

[0153] P5#3: 5' → 3'

[0154] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.3)

[0155] wherein "n" is olefin-thymidine (ie, olefin-dT) in SEQ.ID.NO.3.

[0156] The P7 primer (which may be a cleavable primer) may be any of the following:

[0157] P7#1: 5' → 3'

[0158] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.4)

[0159] P7#2: 5' → 3'

[0160] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.5)

[0161] P7#3: 5' → 3'

[0162] CAAGCAGAAGACGGCATACnAnAT(SEQ.ID.NO.6)

[0163] where "n" is the number of 8-oxoguanines in each sequence.

[0164] Other examples of P7 primers (which may be cleavable primers) may be any of the following: P7#4: 5'→3'

[0165] CAAGCAGAAGACGGCATACGAUAT (SEQ.ID.NO.7); or P7#5: 5'→3'

[0166] CAAGCAGAAGACGGCATACUAGAT(SEQ.ID.NO.8).

[0167] The P15 primers are:

[0168] P15:5'→3'

[0169] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.9)

[0170] wherein "n" is allyl-T (ie, a thymine nucleotide analog having an allyl functional group).

[0171] The above other primers (PA-PD) include:

[0172] PA 5'→3'

[0173] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.10)

[0174] PB 5'→3'

[0175] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.11)

[0176] PC 5'→3'

[0177] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.12)

[0178] PD 5'→3'

[0179] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.13)

[0180] Although not shown in the exemplary sequence of PA-PD, it is understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc., at any point in the chain.

[0181] It should be understood that the cleavage sites of primers 26, 28 in primer set 24 are orthogonal to each other (i.e., one cleavage site is insensitive to the cleavage agent used for the other cleavage site), so that after amplification, either the forward strand or the reverse strand can be cleaved, leaving the other of the reverse strand or the forward strand for sequencing.

[0182] In these examples, the 5' end of each primer 26, 28 includes a functional group that can be attached to a surface group of a polymer hydrogel. The functional group at the 5' end of the primers 26, 28 enables the primers 26, 28 to be fixed by single-point covalent attachment. The attachment will depend in part on the functional group of the polymer hydrogel of the attached functional material 22'. Examples of blocked primers that can be used include succinimidyl (NHS) ester blocked primers, alkyne blocked primers (e.g., including a 5' hexynyl group), tetrazine blocked primers, azido blocked primers, amino blocked primers, epoxy or glycidyl blocked primers, phosphorothioate blocked primers, thiol blocked primers, aldehyde blocked primers, hydrazine blocked primers, phosphoramidite blocked primers, and triazolinedione blocked primers. In some specific examples, a succinimide (NHS) ester-terminated primer can react with an amine of a hydrogel, an aldehyde-terminated primer can react with a hydrazine of a hydrogel, an alkyne-terminated primer can react with an azide of a hydrogel, an azide-terminated primer can react with an alkyne or DBCO (dibenzocyclooctyne) of a hydrogel, an amino-terminated primer can react with an activated carboxylate group or NHS ester of a hydrogel, a thiol-terminated primer can react with an alkylating reactant (e.g., iodoacetamide or maleimide) of a hydrogel or a tetrazole of a hydrogel, or a phosphoramidite-terminated primer can react with a thioether of a hydrogel.

[0183] While several examples have been provided, it should be understood that any functional group that can be attached to the 5' end of the primer 26, 28 and that can be attached to a functional group of the hydrogel can be used.

[0184] Primers 26, 28 may also include a linker between the primer sequence and the 5' terminal group. Example linkers include polyT sequences. In some examples, the polyT region includes 2 T bases to 20 T bases. As a specific example, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases. Other suitable linkers are non-nucleic acid linkers, such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. The following are some examples of nucleotides, including non-nucleic acid linkers with terminal alkynyl groups (where B is a nucleobase and "oligonucleotide" is a primer sequence):

[0185]

[0186] Although in Figure 1B and Figure 1CIn the examples, the primer set 24 is shown as being attached to the polymer hydrogel (attached functional material 22'), but it should be understood that in other examples, the primer set 24 itself acts as the attached functional material 22'. In these examples, when placed in contact with the resin layer 16 and exposed to a predetermined UV light dose, the 5' end of each primer 26, 28 of the primer set 24 is susceptible to interacting with the resin layer (e.g., within the recess 18). Therefore, in these examples, the 5' end functional group of each primer 26, 28 is able to chemically react with the surface functional group of the resin layer 16 within the recess 18 when exposed to UV light.

[0187] In some specific examples, the thiol-terminated primer can react with an olefin or alkyne of the resin layer 16 (via a cycloaddition), the olefin or alkyne-terminated primer can react with a sterone functional group of the resin layer 16 (via a cycloaddition), or the olefin-terminated primer can react with an aziridine functional group of the resin layer 16 (via a cycloaddition). In another example, the terminated primer and the surface group of the resin layer 16 are capable of a hetero-Diels-Alder reaction.

[0188] Now specific reference Figure 1C Some examples of flow cell architectures include a second material 32' (eg, formed of the second material 32) attached over the gap region 20. The attached second material 32' may be a passivating second material or a functionalizing second material.

[0189] When the attached second material 32' is a passivating material, the second material 32' may be a material capable of preventing a portion (e.g., primers, labeled nucleotides introduced during sequencing, etc.) from being attached at the gap region 20. The passivating attached second material 32' may prevent a dye or protein from being attached to the gap region 20. A resin or polymer hydrogel including a UV reactive functional group for attachment to the resin layer 16 but not capable of attaching primers 26, 28, labeled nucleotides introduced during sequencing, or other portions reacting within the recess 18 may be used as a passivating material.

[0190] When the attached second material 32' is a functionalized second material, in some examples, the attached second material 32' can be any material capable of improving the signal-to-noise ratio (SNR) during sequencing operations to improve the performance of the flow cell 10. As one example in these examples, the functionalized attached second material 32' can be a dark quencher (e.g., carbon black) that reduces signals otherwise emitted at the gap region 20 (e.g., due to autofluorescence or non-specifically bound labeled nucleotides). As another example in these examples, the attached functionalized second material 32' can be an antioxidant that reduces damage to DNA that may occur during sequencing, thereby improving the sequencing signal.

[0191] The dark quencher or antioxidant can be held in the interstitial region 20 by a polymer layer such as poly (N-isopropylacrylamide) (PNIPAAm). This type of polymer layer transitions between a hydrophilic state and a hydrophobic state, and can therefore be controlled by its critical solution temperature. For this lower critical solution temperature (LCST) polymer, an increase in temperature above the LCST destroys the copolymer and inhibits the passivating portion (i.e., the dark quencher or antioxidant). Conversely, a decrease in temperature below the LCST makes the copolymer more hydrophilic, which causes the copolymer to swell, exposing the passivating portion. The polymer layer is reversible between the two states, but the passivating portion can be released during the expansion of the polymer layer, either in its initial expansion or after multiple cycles of expansion and contraction.

[0192] In some other examples where the attached second material 32' is a functionalized second material, the second material 32 can be a material to which a primer set (e.g., second primer set 24') can be grafted and can be attached to the resin layer 16 at the gap region 20 when exposed to a predetermined UV light dose. For example, the attached second functional material 32' can be a polymer hydrogel. This is further referred to Figure 4D and Figure 4E . As will be further described, in these examples, two different primer sets 24A, 24B or 24A', 24B' can be used to facilitate simultaneous paired end sequencing. One of the primer sets 24A or 24A' can be attached to a polymer hydrogel (e.g., an attached functional material 22') that is attached within the recess 18 of the patterned substrate, and the other of the primer sets 24B or 24B' can be attached to a polymer hydrogel (e.g., an attached second functionalized material 32') that is attached above the gap region 20.

[0193] In some of the examples disclosed herein, the attached functional material 22' and the attached second material 32' are chemically identical, and some of the techniques disclosed herein can be used to affix the corresponding primer set 24A, 24B, or 24A', 24B' to the desired material 22' or 32'. In other examples disclosed herein, the attached materials 22' and 32' are chemically different (e.g., different functional groups are included for the corresponding primer set, such as 24A or 24B, or 24A' or 24B' attachment), and some of the techniques disclosed herein can be used to affix the corresponding primer set, such as 24A or 24B, or 24A' or 24B' to the desired attached material 22' or 32'. In other examples disclosed herein, the material applied and exposed to UV light to form the attached material 22', 32' can have a corresponding primer set 24A or 24B, or 24A' or 24B' pre-grafted thereon, and thus the fixed chemical composition of the attached material 22', 32' can be the same or different.

[0194] Specific examples of primer sets are given in Fig. 7A 24A and 24B, and in Figure 7B Shown as 24A' and 24B'.

[0195] The primer sets 24A, 24B or 24A', 24B' are related because one set 24A, 24A' includes a cleavable first primer 34, 34' and a non-cleavable second primer 36, 36', and the other set 24B, 24B' includes a non-cleavable first primer 42, 42' and a cleavable second primer 40, 40'. These primer sets 24A, 24B or 24A', 24B' allow a single template strand to be amplified and clustered across two primer sets 24A, 24B or 24A', 24B', and also enable the generation of forward and reverse strands on the attached material 22' or 32' due to the presence of cleavable groups 44 and 44 or 44' on the opposing primers of the set 24A, 24B or 24A', 24B'. It should be understood that the primer(') designations of primers 34', 36', 40', 42' do not refer to the complementary sequences of primers 34, 36, 40, 42, but are additional examples of primer types.

[0196] Each of the first primer sets 24A, 24A' includes a cleavable first primer 34 or 34' and a non-cleavable second primer 36 or 36'; each of the second primer sets 24B, 24B' includes a non-cleavable first primer 42 or 42' and a cleavable second primer 40 or 40'.

[0197] The non-cleavable second primer 36 or 36' and the cleavable first primer 34 or 34' are an oligonucleotide pair, for example, wherein the non-cleavable second primer 36 or 36' is a forward amplification primer and the cleavable first primer 34 or 34' is a reverse amplification primer, or wherein the non-cleavable second primer 36 or 36' is a forward amplification primer and the cleavable first primer 34 or 34' is a reverse amplification primer. In each example of primer set 24A, 24A', the cleavable first primer 34 or 34' includes a cleavage site 44, while the non-cleavable second primer 36 or 36' does not include a cleavage site 44.

[0198] The cleavable second primer 40 or 40' and the non-cleavable first primer 42 or 42' are also oligonucleotide pairs, for example, wherein the cleavable second primer 40 or 40' is a forward amplification primer and the non-cleavable first primer 42 or 42' is a reverse amplification primer, or wherein the non-cleavable first primer 42 or 42' is a forward amplification primer and the cleavable second primer 40 or 40' is a reverse amplification primer. In each example of the second primer set 24B, 24B', the cleavable second primer 40 or 40' includes a cleavable site 44 or 44', while the non-cleavable first primer 42 or 42' does not include a cleavable site 44 or 44'.

[0199] It should be understood that the non-cleavable second primer 36 or 36' of the first primer set 24A, 24A' and the cleavable second primer 40 or 40' of the second primer set 24B, 24B' have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable second primer 40 or 40' includes a cleavage site 44 or 44' integrated into the nucleotide sequence or integrated into a linker 46 or 46' attached to the nucleotide sequence. Similarly, the cleavable first primer 34 or 34' of the first primer set 24A, 24A' and the non-cleavable first primer 42 or 42' of the second primer set 24B, 24B' have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable first primer 34 or 34' includes a cleavage site 44 integrated into the nucleotide sequence or integrated into a linker 46 attached to the nucleotide sequence.

[0200] The non-cleavable primers 36, 42 or 36', 42' may be any primers having a universal sequence for capture and / or amplification purposes, such as those described herein with reference to FIG. 2A to FIG. 2D Any of the described P5 and P7 primers or any combination of P5, P7, P15, PA, PB, PC, PD primers (e.g., P15 and P7, PA and PB or PA and PD, etc.).

[0201] These non-cleavable primers 36, 42 or 36', 42' are "non-cleavable" because they do not include cleavage sites 44, 44'. Thus, the P5 sequence does not include uracil, inosine or olefin-thymidine, and the P7 sequence does not include 8-oxoguanine or uracil. It should be understood that any suitable universal sequence can be used as the non-cleavable primer 36, 42 or 36', 42'.

[0202] Examples of cleavable primers 34, 40 or 34', 40' include P5 and P7 primers or other universal sequence primers (e.g., P15, PA, PB, PC, PD primers), wherein the corresponding cleavage sites 44, 44' are incorporated into the corresponding nucleic acid sequence ( Fig. 7A ), or incorporated into a linker 46, 46' that attaches the cleavable primer 34, 40 or 34', 40' to the attached material 22' or 32' ( Figure 7B ). Examples of suitable cleavage sites 44, 44' include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases or other cleavable molecules (e.g., between nucleobases). Some specific examples of cleavage sites 44, 44' include uracil, 8-oxoguanine, or allyl-T (a thymine nucleotide analog with an allyl functional group). Cleavage sites 44, 44' may be incorporated at any point in the chain or in the linker 46, 46'.

[0203] In any of the examples disclosed herein, primer set 24A, 24B, 24A' or 24B' may also include a PX primer for capturing the library template seeding molecule. The density of the PX motif should be relatively low in order to minimize polyclonality on the flow cell surface. The PX capture primer may be: PX 5'→3'

[0204] AGGAGGAGGAGGAGGAGGAGGAGG(SEQ.ID.NO.14)

[0205] exist Fig. 7A In the example shown, the primers 34, 36 and 40, 42 of the primer sets 24A and 24B are directly attached to the attached material 22', 32', for example without the need for a linker 46, 46'. The attached material 22' or 32' has a surface functional group that can fix the terminal group at the 5' end of the corresponding primer 34, 36 and 40, 42.

[0206] Also in Fig. 7AIn the example shown, the cleavage site 44, 44' of each cleavable primer in the cleavable primers 34, 40 is incorporated into the sequence of the primers 34, 40. It should be understood that the same type of cleavage site 44 or different types of cleavage sites 44, 44' can be used in the cleavable primers 34, 40 of the corresponding primer sets 24A, 24B. As an example, the cleavage site 44 is a uracil base, and the cleavable primers 34, 40 are P5U (SEQ.ID.NO.1) and P7U (SEQ.ID.NO.7 or SEQ.ID.NO.8), respectively. It should be understood that any other cleavable nucleotide that can be incorporated by the polymerase can be used as the cleavage site 44. Uracil bases or other cleavage sites can also be incorporated into any of the PA, PB, PC and PD primers to generate cleavable primers 34, 40. In this example, the non-cleavable primer 36 of the oligonucleotide pair 34, 36 can be P7 (any of the P7 sequences described herein without a cleavage site), and the non-cleavable primer of the oligonucleotide pair 40, 42 can be P5 (any of the P5 sequences described herein without a cleavage site). Thus, in this example, the first primer set 24A includes P7, P5U, and the second primer set 24B includes P5, P7U. The primer sets 24A, 24B have opposite linear chemistries that, after amplification, cluster generation, and linearization, allow the formation of a forward template strand on the attached material 22' or 32' and a reverse strand on the other attached material 32' or 22'.

[0207] exist Figure 7B In the example shown, primers 34', 36' and 40', 42' of primer set 24A', 24B' are attached to corresponding attached materials 22' or 32' via linkers 46 or 46, 46'. Attached materials 22' or 32' have surface functional groups that can fix the terminal group of linker 46 at the 5' end of primer 34', 36'. Attached materials 32' or 22' have surface functional groups that can fix the terminal group of linker 46 or 46' at the 5' end of primer 40', 42'.

[0208] Examples of suitable linkers 46, 46' may include nucleic acid linkers (e.g., 10 nucleotides or less), or non-nucleic acid linkers, such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. Any of the linkers described herein may be used for linkers 46, 46'.

[0209] exist Figure 7BIn the example shown, primers 34', 42' have the same sequence (e.g., P5 without a cleavage site) and the same adapter 46 or different adapters 46, 46'. Primer 42' is non-cleavable (i.e., without a cleavage site), while primer 34' includes a cleavage site 44 (opposite to the primer sequence) incorporated into the adapter 46. Also in this example, primers 36', 40' have the same sequence (e.g., P7 without a cleavage site) and the same adapter 46 or different adapters 46, 46'. Primer 36' is non-cleavable, and primer 40' includes a cleavage site 44 or 44' (opposite to the primer sequence) incorporated into the adapter 46 or 46'. The same type of cleavage site 44 or different types of cleavage sites 44, 44' can be used in the adapters 46 or 46, 46' of cleavable primers 34', 40'. Primer sets 24A', 24B' have opposite linear chemistries which, after amplification, cluster generation and linearization, allow the formation of a forward template strand on one of the attached materials 22' or 32' and a reverse strand on the other of the attached materials 32' or 22'.

[0210] Although cleavage site 44 or 44, 44' Figure 7B 46 or 46, 46', but it will be appreciated that the cleavage site 44 or 44, 44' of the primer 34', 40' may be incorporated into the primer sequence rather than the adapter 46 or 46, 46'.

[0211] exist Fig. 7A and Figure 7B In the examples shown, attachment of primers 34, 36 and 40, 42 or 34', 36' and 40', 42' to the attached functional material 22' or the attached second material 32' leaves the template-specific portions of primers 34, 36 and 40, 42 or 34', 36' and 40', 42' free to anneal to their cognate templates and the 3' hydroxyl groups free for primer extension.

[0212] Several methods of patterning a flow cell that utilizes a predetermined UV light dosage to trigger chemical attachment of the functional material 22 (eg, to the resin layer 16 within the recess 18 of the flow cell 10) will now be described.

[0213] Method of forming a flow cell comprising a single patterned substrate

[0214] FIG. 2A to FIG. 2DThe method depicted in the method generally includes depositing a functional material 22 over a resin layer 16 including recessed portions 18 separated by gap regions 20, wherein: the resin layer 16 includes an ultraviolet (UV) light blocking additive 30; the recessed portions 18 are located above a first portion of the resin layer 16 having a first thickness T1, and the gap regions 20 are located above a second portion of the resin layer 16 having a second thickness T2 greater than the first thickness T1; and the functional material 22 is susceptible to interacting with the resin layer 16 when exposed to UV light; and the resin layer 16 is guided through a predetermined UV light dose, whereby the functional material 22 within the recessed portions 18 is exposed to the predetermined UV light dose and attached to the resin layer 16 within the recessed portions 18, and the functional material 22 located above the gap regions 20 is blocked by the second resin portion and is not exposed to the predetermined UV light dose.

[0215] It should be understood that FIG. 2A to FIG. 2D The illustrated example of the method may be performed using a base carrier 14 (eg, to which the resin of the resin layer 16 may be applied and cured).

[0216] Any suitable resin material described herein can be used to form the resin layer 16 (e.g., thiol-based resins, acrylate resins, etc.), and any example of the UV light blocking additive 30 is included in the resin material. In addition, any suitable deposition technique disclosed herein can be used to deposit the resin (which forms the resin layer 16) on the base carrier 14. Still further, the base carrier 14 can be any base carrier 14 material described herein.

[0217] After the resin is applied to the base carrier 14, the resin can be soft baked to remove any excess solvent present in the resin. The soft bake can be performed at a temperature lower than that used to cure the resin (e.g., in the range of about 50°C to about 150°C) and for a time in the range of greater than 0 seconds to about 3 minutes. In one example, the soft bake time ranges from about 30 seconds to about 2.5 minutes.

[0218] After the resin has been applied to the base carrier 14 and, in some cases, soft-baked, the recessed portions 18 and the gap regions 20 are defined (forming the resin layer 16). FIG. 2A to FIG. 2D A single recess 18 is shown in the method depicted in FIG. 1 , but it should be understood that the flow cell 10 may include a plurality of recesses 18, wherein each individual recess 18 is separated from each other recess 18 by a gap region 20 (similar to Figure 1B and Figure 1C shown).

[0219] The recess 18 can be formed in the resin using any suitable technique described herein, such as nanoimprint lithography (NIL) or photolithography. As an example of forming the recess 18, the working stamp 34 can be pressed into the resin when the resin is soft, which produces an impression of the working stamp 34 in the resin. The resin can then be cured with the working stamp 34 in place. Curing can be achieved by exposure to actinic radiation or heat. In one example, the curing of the resin can be achieved by exposing the applied resin to incident light with an energy dose ranging from about 0.5J to about 20J for 30 seconds or less. The incident light can be actinic radiation, such as ultraviolet (UV) radiation. In one example, most of the UV radiation emitted can have a wavelength of about 365nm. The curing process can include a single UV exposure stage. The curing process forms a resin layer 16 that is patterned to have a recess 18 and a gap region 20.

[0220] In some cases, it may be desirable to perform a post-cure bake process. If performed, the post-cure bake may be performed at a temperature ranging from about 150° C. to about 250° C. for a time ranging from about 1 minute to about 2 minutes.

[0221] After curing, and in some cases after a post-cure bake, the working stamp 34 is released to expose the resin layer 16. More specifically and as Figure 2A As shown, release of the working stamp 34 from the resin layer 16 exposes the recessed portions 18 in the layer 16 .

[0222] like Figure 2A As further shown, the portion of the resin layer 16 located below the recessed portion 18 has a first thickness T1, and the portion of the resin layer 16 defined / located below the gap region 20 has a second thickness T2 greater than the first thickness T1. In order to produce a patterned resin layer 16 having a desired thickness T1, T2 in a desired area, the resin layer 16 is first deposited with a desired thickness corresponding to the thickness T2. Then, when forming the recessed portion 18, the size of the working stamp 34 is selected so that the recessed portion 18 extends the desired depth into the total thickness of the resin layer 16 (i.e., T2), and thus leaves a portion having the first thickness T1 at the bottom of the recessed portion 18.

[0223] like Figure 2B As shown, with the recessed portion 18 formed in the resin layer 16, the example method continues by applying a functional material 22 over the resin layer 16 (e.g., over the recessed portion 18 and over the gap region 20). As described, the functional material 22 includes functional groups that are applied to the resin layer 16 and are susceptible to interacting with the resin layer when exposed to a predetermined UV light dose.

[0224] exist Figure 2BIn the example shown, the functional material 22 is a polymer hydrogel that is attached to the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose. The polymer hydrogel can be any of the polymer hydrogel materials disclosed herein and can be deposited using any suitable deposition technique. In some cases, the polymer hydrogel can first be diluted (e.g., up to 10% dilution) using water or another suitable solvent before being deposited in the recess 18. Examples of suitable solvents include dimethyl sulfoxide (DMSO), isopropyl alcohol (IPA), or a mixture of any of these solvents with water.

[0225] Although Figure 2B The illustrated functional material 22 is depicted as a polymer hydrogel layer, but it should be understood that any of the examples of functional material 22 described herein may be used in place of a polymer hydrogel layer.

[0226] In one example, the functional material 22 is a functionalized particle (i.e., a polymer hydrogel particle or a polymer hydrogel coated on a core particle, either of which attaches to the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose). The functionalized particles can be pre-clustered or non-pre-clustered. In this example, the polymer hydrogel can be any of the polymer hydrogel materials disclosed herein, and when included, the core particles can include any of the core particle materials disclosed herein. In addition, in this example, the functionalized particles (pre-clustered or non-pre-clustered) can be suspended in a liquid carrier before they are introduced into the circulation pool 10.

[0227] In this example, the functionalized particles (pre-clustered or not) can be suspended in a liquid carrier. Any liquid carrier that does not dissolve the particles themselves can be used. Examples of liquid carriers include buffers (e.g., Tris-HCl buffer or 0.5x sodium citrate saline (SSC) buffer), acetic acid, acetone, acetonitrile, benzene, butanol, diethylene glycol, ether, dimethylformamide, ethanol, glycerol, methane, pyridine, triethylamine, etc. Surfactants / dispersants such as sodium dodecyl sulfate (SDS) and (CTAB) can also be included. The suspension can be introduced into a flow cell and retained in the flow cell during UV exposure.

[0228] In another example, the functional material 22 includes a primer set 24 (which itself includes primers 26, 28) attached to the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose. In this example, the flow cell 10 may not contain any polymer hydrogel, and the primer set 24 may become directly attached to the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose. The primer set 24 (including primers 26, 28) may include any of the oligonucleotide primers disclosed herein, provided that the primers 26, 28 have orthogonal cleavage groups to generate forward and reverse strands, respectively. In some examples, the primer set 24 is suspended in a liquid carrier at a concentration ranging from 1 μM to 4 μM before being introduced into the flow cell 10.

[0229] like Figure 2C As shown, after applying the functional material 22, the example method continues by directing a predetermined dose of UV light through the resin layer 16 (bottom), which is Figure 2C . During this process, the functional material 22 within the recess 18 is exposed to a predetermined UV light dose, which triggers a chemical reaction (e.g., between the functional material 22 and the resin layer 16) and forms an attached functional material 22' within the recess 18. The (thinner) thickness T1 of the portion of the resin layer 16 located below the recess 18 can facilitate this exposure. At this thickness T1, the resin layer 16 is capable of transmitting at least 25% of the predetermined UV light dose through to the functional material 22 in the recess 18. It should be understood that the amount of UV light blocking additive 30 at the portion of the resin layer 16 having the thickness T1 is low enough so that the additive 30 (in this portion) allows sufficient UV light transmission to trigger the desired UV triggered reaction within the recess 18.

[0230] However, it should be understood that during this process, the functional material 22 above the gap region 20 will not be exposed to enough UV light to trigger a chemical reaction at the gap region 20. The portion of the resin layer 16 having a thickness T2 blocks 75% or more of the UV light directed toward the resin layer 16, and thus the interface between the resin layer 16 and the functional material 22 above the gap region 20 is not exposed to a predetermined UV light dose. In addition, the amount of UV light blocking additive 30 at the portion of the resin layer 16 having a thickness T2 is high enough that the additive 30 does help block UV light. Therefore, a chemical reaction between the UV reactive groups (of the components 22, 16) is not initiated, and the functional material 22 will not be attached to the portion of the resin layer 16 that forms / underlies the gap region 20.

[0231] When the functional material 22 is a polymer hydrogel, exposing the functional material 22 within the recess 18 to a predetermined UV light dose initiates a chemical reaction between the corresponding UV reactive groups of the polymer hydrogel and the resin layer 16. The reaction attaches the polymer hydrogel to the resin layer 16 and forms an example of attached functional material 22' at the bottom of the recess 18. In some cases, exposure to the predetermined UV light may also initiate polymerization of the polymer hydrogel.

[0232] When the functional material 22 is a functionalized particle (e.g., pre-clustered or non-pre-clustered), exposing the functional material 22 within the recess 18 to a predetermined UV light dose initiates a chemical reaction between the UV reactive groups of the resin layer 16 and i) the UV reactive groups of the polymer hydrogel particles or ii) the UV reactive groups of the polymer hydrogel coating. The reaction attaches the polymer hydrogel particles or the polymer hydrogel coating to the resin layer 16 and forms another example of attached functional material 22' at the bottom of the recess 18. As mentioned above, the core of the functionalized particle (when included) can be inert, e.g., inert to UV light and / or light and / or reagents used for sequencing, and thus does not interfere with the attachment of the functionalized particle to the recess 18 or downstream sequencing.

[0233] When the functional material 22 is a primer set 24 (including primers 26, 28), exposing the functional material 22 to a predetermined UV light dose initiates a chemical reaction between the corresponding UV reactive groups of the primers 26, 28 and the resin layer 16. The reaction attaches the primers 26, 28 to the resin layer 16 at the bottom of the recess 18.

[0234] It should be understood that exposing any example of the functional material 22 to a predetermined UV light dose can initiate various desired UV light-triggered chemical reactions with the resin material 16 within the recess 18. As an example, exposing the functional material 22 within the recess 18 to a predetermined UV light dose can be used to initiate: thiol-ene or thiol-alkyne cycloaddition reactions, heterogeneous Diels-Alder reactions, sterone-olefin or alkyne cycloaddition reactions, aziridine-olefin cycloaddition reactions, oxime ligation, etc.

[0235] like Figure 2DAs shown in , after the selected portion of the functional material 22 is exposed to a predetermined UV light dose and the attached functional material 22' is formed within the recessed portion 18, the method continues to remove the (unattached) functional material 22 from the gap region 20. Relatively simple removal techniques, such as ultrasonic treatment, washing, rinsing, wiping, etc., can be used because in this example method, the functional material 22 is not attached to the resin layer 16 at the gap region 20 (e.g., covalently). Therefore, the removal of the (unattached) functional material 22 from the gap region 20 can be performed without polishing. The removal of the unattached functional material 22 exposes the surface of the resin layer 16 that forms the gap region 20.

[0236] Although FIG. 2A to FIG. 2D Not shown, but in some examples of the method where the attached functional material 22' is a polymer hydrogel, the method may further include grafting a primer set 24 (including primers 26, 28) to the attached polymer hydrogel (e.g., after UV light exposure and removal of unattached functional material 22). In other examples, the functional material 22 is a polymer hydrogel, and the polymer hydrogel is pre-grafted with the primer set 24.

[0237] In addition, although FIG. 2A to FIG. 2D Not shown, but in some examples of the method where the attached functional material 22' is a polymer hydrogel coated on a core particle and attached to the resin layer 16 within the recess 18 when exposed to a predetermined UV light dose (i.e., is a functionalized particle), the method can also include grafting the primer set 24 (including primers 26, 28) to the polymer hydrogel coated on the core particle (e.g., after UV light exposure and removal of unattached functional material 22). In other examples, the attached functional material 22' is a polymer hydrogel particle, and the method can also include grafting the primer set 24 (including primers 26, 28) to the polymer hydrogel particle (e.g., after UV light exposure and removal of unattached functional material 22). In still other examples, the functional material 22 is a functionalized particle, and the polymer hydrogel coating is pre-grafted with the primer set 24. In some of these examples, where the functional material 22 is a functionalized particle pre-grafted with the primer set 24, the functionalized particle can be pre-clustered, as described herein.

[0238] Whether the polymer hydrogel is used alone or as a coating on the core particle, the grafting of the primer set 24 to the polymer hydrogel (of the functional material 22) can involve dip coating, which involves immersing the patterned substrate (with the hydrogel attached in the recess 18) in a primer solution or mixture. The solution or mixture may include primers 26, 28, water, a buffer and a catalyst. Other grafting techniques may involve spraying, whipping distribution or another suitable method of attaching the primers 26, 28 to the hydrogel. Using any grafting method, the primers 26, 28 react with the reactive groups of the polymer hydrogel and form a chemical bond, thereby attaching the primers 26, 28 to the polymer hydrogel.

[0239] use FIG. 2A to FIG. 2D The patterned structure formed by the method can be attached to a cover or another patterned structure to form a flow cell 10. Bonding can be performed before or after primer grafting. When bonding is performed before primer grafting, it should be understood that primer grafting can be performed using a flow-through technique. When using FIG. 2A to FIG. 2D When two patterned structures formed by the method are bonded together before primer grafting, the corresponding surfaces can be grafted simultaneously using the flow-through technique.

[0240] The patterned structure and the cap or second patterned structure may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0241] Method of forming a flow cell comprising two patterned substrates

[0242] FIG. 3A to FIG. 3CThe method generally includes introducing a functional material 22 into a flow cell 10 including two patterned substrates, each of which includes a resin layer 16 having recessed portions 18 separated by gap regions 20, wherein: the resin layer 16 includes an ultraviolet (UV) light blocking additive 30; the recessed portions 18 of each of the two patterned substrates are located on a first portion of the resin layer 16 having a first thickness T1, and the gap regions 20 of each of the two patterned substrates are located on a second portion of the resin layer 16 having a second thickness T2 greater than the first thickness T1; and the functional material 22 is susceptible to interacting with the resin layer 16 of each of the two patterned substrates when exposed to UV light; and simultaneously introducing a predetermined UV The light dose is directed through the resin layer 16 of each of the two patterned substrates, whereby some of the functional materials 22 within the recessed portion 18 of the first of the two patterned substrates are exposed to a predetermined UV light dose and attached to the resin layer 16 within the recessed portion 18 of the first of the two patterned substrates, some other of the functional materials 22 within the recessed portion 18 of the second of the two patterned substrates are exposed to a predetermined UV light dose and attached to the resin layer 16 within the recessed portion 18 of the second of the two patterned substrates, and the functional material 22 in contact with the gap region 20 of each of the two patterned substrates is partially blocked by the second resin and is not exposed to the predetermined UV light dose. In some methods of this example, the unattached functional material 22 can then be removed.

[0243] As mentioned above, FIG. 3A to FIG. 3C The method shown involves a flow cell 10' comprising two patterned structures. Before starting the method, each of the patterned structures is formed and the two are bonded together at bonding areas 38 to form the flow cell 10'. Each of the patterned structures comprises a resin layer 16 patterned with recesses 18.

[0244] like FIG. 3A to FIG. 3C As shown, the resin layer 16 can also be applied directly onto the base carrier 14. The resin included in the resin layer 16 of each of the first and second patterned substrates of the two patterned substrates can be any resin material disclosed herein and also include a UV light blocking additive 30, and the base carrier 14 can be any material of the base carrier 14 material described herein. In order to generate the patterned structure, the resin can be applied, patterned, and cured using any suitable method described herein.

[0245] like Figure 3AAs shown, a plurality of recesses 18 are defined in the resin layer 16 of each of the first and second patterned substrates of the two patterned substrates, each recess 18 being separated from each other recess 18 by a gap region 20. It should be understood that the resin layer 16 of each of the first and second patterned substrates of the two patterned substrates is first deposited with a desired thickness corresponding to the thickness T2. Then, when the recesses 18 are formed by nanoimprint lithography, the size of the working stamp 34 is selected so that the recesses 18 extend the desired depth into the total thickness of the resin (i.e., T2), and thus a portion having a first thickness T1 is left at the bottom of each of the recesses 18.

[0246] exist Figure 3A In the example shown, the patterned structures are then bonded together to create an example of a flow cell 10 '. As depicted, a spacer layer 36 is applied to a bonding area 38 of one or both of the patterned structures, and the patterned structures are then placed in contact at the bonding area 38. The spacer layer 36 is allowed to dry or cure to create an attachment point. As shown, a flow channel 11 is created between the bonded patterned structures.

[0247] As the flow cell 10' is formed, the example method continues by introducing a functional material 22 into the flow cell 10'. The functional material 22 is applied so that it contacts the recessed portion 18 and the gap region 20 of each of the first and second patterned substrates of the two patterned substrates. As described herein, the functional material 22 is susceptible to interacting with (e.g., attaching to) the resin layer 16 of the two patterned substrates when exposed to a predetermined UV light dose.

[0248] exist FIG. 3A to FIG. 3C In the example shown, the functional material 22 is shown as a polymer hydrogel that, when exposed to a predetermined UV light dose, is attached to the resin layer 16 within the recessed portion 18 of each of the first and second patterned substrates of the two patterned substrates. In this example, the polymer hydrogel can be any of the polymer hydrogel materials disclosed herein.

[0249] In another example, the functional material 22 can be a polymer hydrogel particle or a polymer hydrogel coated on a core particle (e.g., a functionalized particle) and attached to the resin layer 16 within the recess 18 of each of the first and second patterned substrates of the two patterned substrates when exposed to a predetermined UV light dose. In some examples, the functionalized particles can be pre-grafted with primers 26, 28 and can be further pre-clustered. The polymer hydrogel particles or polymer hydrogel coating can be any of the polymer hydrogel materials disclosed herein, and the core particles (when used) can be any of the core particle materials disclosed herein.

[0250] In still another example, the functional material 22 includes a primer set 24 (including primers 26, 28) that is directly attached to the resin layer 16 within the recess 18 of each of the first and second patterned substrates of the two patterned substrates when exposed to a predetermined UV light dose. In this example, the flow cell 10' may not contain any polymer hydrogel, and the primer set 24 may be directly attached to the resin layer 16 (within the recess 18) of each of the first and second patterned substrates of the two patterned substrates when exposed to a predetermined UV light dose. The primer set 24 (including primers 26, 28) may include any of the oligonucleotide primers disclosed herein, provided that the primers 26, 28 have orthogonal cleavage groups to generate forward and reverse strands, respectively.

[0251] Regardless of the functional material 22 used, the functional material 22 may be incorporated into a liquid carrier (examples of which are shown in FIG. Figure 2B Description) and introduced into the flow cell 10' through the inlet. Figure 3A As shown, enough liquid carrier is added to fill the flow channel 11 so that some of the functional materials 22 can contact the recessed portion 18 of each of the resin layers 16 .

[0252] like Figure 3B As shown, after the functional material 22 is introduced into the flow cell 10', the example method continues by directing a predetermined UV light dose through both sides of the flow cell 10' (e.g., through the resin layer 16 of each of the first patterned substrate and the second patterned substrate). In this example, two different UV light sources can be used, which respectively direct a predetermined UV light dose through the resin layer 16 toward the flow channel 11. The UV light is directed by Figure 3C The arrow in indicates.

[0253] During this process, the functional material 22 within the recessed portion 18 of each of the two patterned substrates is exposed to a corresponding predetermined UV light dose directed thereto. The thickness T1 of the portion of each of the resin layers 16 that transmits UV light and enables it to reach the functional material 22 in the recessed portion 18 can facilitate this exposure. More specifically, at this thickness T1, each resin layer 16 is capable of transmitting at least 25% of the predetermined UV light dose through to the functional material 22 in the recessed portion 18. This exposure triggers a chemical reaction (e.g., between the functional material 22 and the corresponding resin layer 16) and forms an attached functional material 22' within the recessed portion 18. It should be understood that the amount of UV light blocking additive 30 at the portion of the resin layer 16 having the thickness T1 is sufficiently low that the additive 30 does not interfere with the desired UV light transmission.

[0254] Also during this process, the functional material 22 in the flow channel 11 that is in contact with the gap region 20 will not be exposed to enough UV light to trigger a chemical reaction at the gap region 20. The portion of the resin layer 16 having a thickness T2 blocks 75% or more of the UV light directed toward the respective resin layer 16, and thus the interface between the respective resin layer 16 and the functional material 22 in contact with the gap region 20 is not exposed to a predetermined UV light dose. In addition, the amount of the UV light blocking additive 30 at the portion of the resin layer 16 having a thickness T2 is sufficiently high that the additive 30 does help to block UV light. Therefore, a chemical reaction between the UV reactive groups (of the components 22, 16) is not initiated, and the functional material 22 will not be attached to the portion of the resin layer 16 that forms the gap region 20.

[0255] When the functional material 22 is a polymer hydrogel, exposing the functional material 22 within the recess 18 to a predetermined UV light dose initiates a chemical reaction between the corresponding UV reactive groups of the polymer hydrogel and the resin layer 16. The reaction attaches the polymer hydrogel to the resin layer 16 and forms an example of attached functional material 22' within the recess 18.

[0256] When the functional material 22 is a functionalized particle (pre-clustered or non-pre-clustered), exposing the functional material 22 within the recess 18 to a predetermined UV light dose initiates a chemical reaction between the UV reactive groups of the resin layer 16 and i) the UV reactive groups of the polymer hydrogel coating or ii) the UV reactive groups of the polymer hydrogel particles. The reaction attaches the polymer hydrogel particles or coating to the resin layer 16 and forms another example of an attached functional material 22' within the recess 18. In one example, a single functionalized particle can be attached within a single recess 18.

[0257] When the functional material 22 is a primer set 24 (including primers 26, 28), exposing the functional material 22 to a predetermined UV light dose initiates a chemical reaction between the corresponding UV reactive groups of the primers 26, 28 and the resin layer 16. The reaction attaches the primers 26, 28 to the resin layer 16 within the recess 18.

[0258] It should be understood that exposing any example of the functional material 22 to a predetermined UV light dose can initiate a variety of chemical reactions within the recessed portion 18 of each of the first and second patterned substrates of the two patterned substrates, depending in part on the material used for the functional material 22 and the desired attachment point of the functional material 22. As an example, exposing the functional material 22 to a predetermined UV light dose can be used to initiate: thiol-ene or thiol-alkyne cycloaddition reactions, heterogeneous Diels-Alder reactions, sterone-olefin or alkyne cycloaddition reactions, aziridine-olefin cycloaddition reactions, oxime ligation, etc.

[0259] like Figure 3C As shown, after exposing the functional material 22 to a predetermined UV light dose and forming an attached functional material 22' within the recessed portion 18 of each of the first and second patterned substrates in the two patterned substrates, the method continues to remove the (unattached) functional material 22 from the gap region 20 of each of the two patterned substrates. The unattached functional material 22 can be removed using any suitable method, such as a wash cycle, in which a wash solution (e.g., a buffer) is directed into the flow channel 11, through the flow channel, and then out of the flow channel (which is defined between the two patterned substrates). When the wash solution is present in the flow channel 11, the flow cell 10' can be exposed to ultrasonic treatment to accelerate the removal of the unattached functional material 22.

[0260] Although FIG. 3A to FIG. 3C Not shown, but in examples of methods where the attached functional material 22' is a polymer hydrogel, the method may further include grafting a primer set 24 (including primers 26, 28) to the polymer hydrogel (e.g., after UV light exposure and removal of unattached functional material 22). In other examples, the functional material 22 is a polymer hydrogel, and the polymer hydrogel is pre-grafted with the primer set 24.

[0261] In addition, although FIG. 3A to FIG. 3CNot shown, but in some examples of the method in which the functional material 22 is a polymer hydrogel coated on a core particle and attached to the resin layer 16 within the recessed portion 18 of each of the first and second patterned substrates of the two patterned substrates when exposed to a predetermined UV light dose (i.e., is a functionalized particle), the method may also include grafting the primer set 24 (including primers 26, 28) to the polymer hydrogel coated on the core particle (e.g., after UV light exposure and removal of the unattached functional material 22). In other examples, the attached functional material 22' is a polymer hydrogel particle, and the method may also include grafting the primer set 24 (including primers 26, 28) to the polymer hydrogel particle (e.g., after UV light exposure and removal of the unattached functional material 22). In still other examples, the functional material 22 is a functionalized particle, and the polymer hydrogel coating is pre-grafted with the primer set 24. In some of these examples, for example, where the functional material 22 is a functionalized particle pre-grafted with a primer set 24, the functionalized particle can be pre-clustered.

[0262] When the polymer hydrogel or functionalized particle is not pre-grafted, grafting is performed in the flow cell 10' by introducing a primer solution or mixture as described herein into the flow channel 11 so that it fills the recess 18 containing the attached functional material 22'. The primers 26, 28 are allowed to react with the reactive groups of the polymer hydrogel or polymer hydrogel particle or polymer hydrogel coating, thereby forming a chemical bond and attaching the primers 26, 28 to the attached functional material 22'. The unreacted primer solution or mixture can then be removed, and the flow cell 10' is ready for sequencing.

[0263] Method of forming a flow cell having a passivated and / or functionalized interstitial region

[0264] FIG. 4A to FIG. 4EThe method generally includes depositing a first functional material 22 over a resin layer 16 including recessed portions 18 separated by gap regions 20, wherein: the resin layer 16 includes an ultraviolet (UV) light blocking additive 30; the recessed portions 18 are located above a first portion of the resin layer 16 having a first thickness T1, and the gap regions 20 are located above a second portion of the resin layer 16 having a second thickness T2 greater than the first thickness T1; and the first functional material 22 is susceptible to interacting with the resin layer 16 when exposed to UV light; directing a first predetermined UV light dose D1 through the resin layer 16, thereby exposing the first functional material 22 within the recessed portions 18 to the first predetermined UV light dose D1 and attaching to the resin layer 16 within the recessed portions 18, and the first functional material 22 located above the gap regions 20 is blocked by the second resin portion and is not exposed to A first predetermined UV light dose D1 is applied and remains unattached to the resin layer 16 at the gap area 20; the first functional material 22 is removed from the gap area 20; a second material 32 is deposited over the gap area 20 and over the first functional material 22 in the recess 18 (i.e., the attached first functional material 22'), wherein the second material 32 is prone to interact with the resin layer 16 when exposed to UV light and is not prone to interact with the first functional material 22 (i.e., the attached first functional material 22') when exposed to UV light; and a second predetermined UV light dose D2 is directed directly to the second material 32, whereby the second material 32 is exposed to the second predetermined UV light dose D2 and is attached to the resin layer 16 at the gap area 20 and remains unattached to the first functional material 22 (i.e., the attached first functional material 22').

[0265] like FIG. 4A to FIG. 4E As shown, the patterned substrate includes a base carrier 16 and a resin layer 16 applied directly thereto. The base carrier 14 may include any of the base carrier 14 materials described herein.

[0266] The resin layer 16 can be any resin material among the resin materials disclosed herein, and any suitable method described herein can be used to deposit, pattern, and cure the resin. These processes generate a patterned structure in which the resin layer 16 includes regions having desired thicknesses T1, T2. More specifically, the portion of the resin layer 16 located above the recessed portion 18 has a first thickness T1, and the portion of the resin layer 16 located above the gap region 20 has a second thickness T2 greater than the first thickness T1.

[0267] like Figure 4A As shown, a recessed portion 18 is defined in the resin layer 16, and the recessed portion 18 is directly adjacent to the gap region 20. FIG. 4A to FIG. 4EA single recess 18 is shown in FIG. 1 , but it should be understood that the patterned structure may include a plurality of recesses 18, wherein each individual recess 18 is separated from each other recess 18 by a gap region 20 (similar to FIG. 1 ). Figure 1B and Figure 1C shown).

[0268] With the recess 18 formed in the resin layer 16, the example method continues by applying the first functional material 22 over the recess 18 and over the gap region 20. Figure 4A As described, the first functional material 22 is susceptible to interacting with (eg, attaching to) the resin layer 16 when in contact with the resin layer and exposed to the first predetermined UV light dose D1.

[0269] exist FIG. 4A to FIG. 4E In the example shown, the first functional material 22 is a polymer hydrogel that attaches to the resin layer 16 within the recess 18 when exposed to the first predetermined UV light dose D1. In this example, the polymer hydrogel can be any of the polymer hydrogel materials disclosed herein.

[0270] In another example, the first functional material 22 is a polymer hydrogel particle or polymer hydrogel that is coated on the core particle and attached to the resin layer 16 within the recess 18 when exposed to the first predetermined UV light dose D1. In other words, in this example, the first functional material 22 is an example of a functionalized particle. The functionalized particles can be pre-clustered or non-pre-clustered. In this example, the polymer hydrogel can be any of the polymer hydrogel materials disclosed herein, and the core particle (when used) can be any of the core particle materials disclosed herein.

[0271] In yet another example, the first functional material 22 includes a primer set 24 (including primers 26, 28) attached to the resin layer 16 in the recessed portion 18 when exposed to the first predetermined UV light dose D1. In this example, the flow cell 10, 10' may not contain any polymer hydrogel. The primer set 24 (including primers 26, 28) may include any of the oligonucleotide primers disclosed herein, provided that the primers 26, 28 have orthogonal cleavage groups to generate a forward strand and a reverse strand, respectively.

[0272] like Figure 4B As shown, after applying the first functional material 22 over the resin layer 16 (e.g., over the recessed portion 18 and over the gap region 20), the exemplary method directs a first predetermined UV light dose D1 through the bottom of the resin layer 16 (by Figure 4BThe process continues by forming an attached first functional material 22' within the recessed portion 18 (indicated by the arrow in FIG. 1 ). During this process, the first functional material 22 within the recessed portion 18 is exposed to a predetermined UV light dose D1, which initiates a UV-triggered reaction and attaches the first functional material 22 to the surface of the resin layer 16 within the recessed portion 18. As described herein, such exposure may be facilitated by a first (thinner) thickness T1 of a portion of the resin layer 16 that is capable of transmitting UV light, located below the recessed portion 18, and may not be inhibited by the amount of UV light blocking additive 30 present at that portion. UV exposure forms an attached first functional material 22' within the recessed portion 18.

[0273] However, it should be understood that during this process, the first functional material 22 located above the gap region 20 will not be exposed to sufficient UV light to trigger a chemical reaction at the gap region 20, and therefore the first functional material 22 will not be attached to the portions of the resin layer 16 that form / underlie the gap region 20. In the same manner as described herein, blocking of the first predetermined UV light dose D1 can be facilitated by the second (thicker) thickness T2 of the portions of the resin layer 16 that form / underlie the gap region 20 and the amount of UV light blocking additive 30 present at these portions.

[0274] When the first functional material 22 is a polymer hydrogel, exposing the first functional material 22 within the recess 18 to the first predetermined UV light dose D1 initiates a chemical reaction between the UV reactive functional groups of the first functional material 22 and the resin layer 16. This forms one example of an attached first functional material 22' at the bottom of the recess 18.

[0275] When the first functional material 22 is a functionalized particle (pre-clustered or non-pre-clustered), exposing the first functional material 22 within the recess 18 to the first predetermined UV light dose D1 triggers a chemical reaction between the UV reactive functional groups of the first functional material 22 and the resin layer 16. This forms another example of an attached first functional material 22' at the bottom of the recess 18.

[0276] In some examples, the first functional material 22 is a primer set 24. In these examples, exposing the first functional material 22 to a predetermined UV light dose D1 triggers a chemical reaction that attaches the 5' terminal functional group of each primer 26, 28 (of the primer set 24) to a corresponding UV reactive functional group of the resin layer 16 at the bottom of the recess 18.

[0277] Exposing any example of the first functional material 22 to a predetermined UV light dose D1 can initiate a variety of chemical reactions within the recess 18, depending in part on the material used for the first functional material 22 and / or the desired attachment point of the first functional material 22. As an example, exposing the first functional material 22 to a predetermined UV light dose D1 can be used to initiate: thiol-ene or thiol-alkyne cycloaddition reactions, heterogeneous Diels-Alder reactions, sterone-olefin or alkyne cycloaddition reactions, aziridine-olefin cycloaddition reactions, oxime ligation, etc.

[0278] like Figure 4C As shown, after exposing the first functional material 22 to a predetermined UV light dose D1 and forming an attached first functional material 22' within the recessed portion 18, the method continues by removing the (unattached) first functional material 22 from the gap region 20. Figure 2D Any suitable method described removes the unattached first functional material 22 from the resin layer 16. In one example, a washing solution (eg, a buffer) is used to rinse the patterned structure.

[0279] like Figure 4D As shown, from Figure 4C After removing the unattached first functional material 22 from the gap region 20 of the structure, the example method continues by applying the second material 32 over the gap region 20 and over the attached first functional material 22' within the recessed portion 18. Any suitable deposition technique described herein may be used to deposit the second material 32. However, it should be understood that the deposition technique used will depend in part on the material used for the second material 32.

[0280] In some examples, the second material 32 is a passivating material. As described herein, the passivating material can be a material capable of preventing a portion (e.g., a primer, etc.) from attaching to the gap region 20. For example, during use of the flow cell 10, 10', the passivating material can prevent a dye or protein from attaching to the gap region 20. In some of these examples, the passivating second material 32 is one of the hydrogel or resin materials disclosed herein that include UV-reactive functional groups. In these examples, the passivating second material 32 can attach to a portion of the resin layer 16 that forms the gap region 20 when exposed to a second predetermined UV light dose D2.

[0281] In other examples, the second material 32 is a functionalized material. As described, the functionalized material can be a material that can improve SNR (signal to noise ratio) during sequencing operation, thereby improving the performance of the circulation cell. In one example, the second material 32 is a functionalized material selected from the group consisting of: quencher, antioxidant and their combination. Dark quencher (when used) can absorb energy in the gap region and dissipate energy as heat to improve the signal to noise ratio during sequencing. Antioxidant (when used) can reduce the damage caused to the DNA sequenced during sequencing operation. As mentioned above, these examples of functionalized materials can be attached by a polymer layer such as PNIPPAm. In these examples, quencher and / or antioxidant can be first attached to the polymer layer, and then UV exposure D2 can be used to attach the polymer layer to the gap region 20.

[0282] In examples where the attached functional material 22' is a polymer hydrogel (in the form of a layer, particle, or particle coating), the functionalized second material 32 may be a polymer hydrogel capable of having one of the primer sets 24A or 24B or 24A' or 24B' grafted thereto and capable of attaching to the resin layer 16 at the gap region 20 when exposed to the second predetermined UV light dose D2. The second polymer hydrogel may be any of the hydrogel materials described herein, as long as the hydrogel includes UV-reactive functional groups capable of attaching to the resin layer 16 forming the gap region 20 when exposed to the second predetermined UV light dose D2, and as long as the hydrogel is capable of having one of the primer sets 24A or 24B or 24A' or 24B' grafted thereto. In these examples, the second functionalized material 32 may have the primer set 24A or 24B or 24A' or 24B' pre-grafted thereto. In this particular example, it will be appreciated that the other of the primer sets 24B or 24A or 24B' or 24A' is attached to the attached functional material 22' (either by grafting within the recess 18 after hydrogel attachment or as a pre-grafted primer).

[0283] like Figure 4EAs shown, after applying any example of the second material 32 above the gap region 20 and above the attached first functional material 22' within the recessed portion 18, the example method continues by directly exposing the second material 32 to a second predetermined UV light dose D2. Exposing the second material 32 to the second predetermined UV light dose D2 initiates a chemical reaction that attaches the second material 32 to the resin layer 16 that forms / underlies the gap region 20 (thereby forming an attached second material 32' at the gap region 20). However, it should be understood that the second material 32 is not susceptible to interacting with the attached first functional material 22' when exposed to the second predetermined UV light dose D2. Therefore, the second material 32 within the recessed portion 18 (e.g., positioned above the attached first functional material 22') will remain unattached to the attached first functional material 22' during and after exposure to the second predetermined UV light dose D2. The unattached second material 32 can be removed from the attached first functional material 22' using any suitable method (e.g., ultrasonic treatment, washing, etc.).

[0284] It will be appreciated that small portions of the second material 32 may attach to exposed portions of the resin layer 16 within the recess 18 (eg, along the sidewalls), and that this will depend at least in part on the quality of the first reaction (ie, the formation of the attached first functional material 22').

[0285] When the second material 32 is a quencher and / or an antioxidant, the polymer layer serves to attach these materials to the gap region 20. Thus, the second predetermined UV light dose D2 triggers a chemical reaction between the UV-reactive functional groups of the polymer layer and the resin layer 16.

[0286] When the second material 32 is a polymer hydrogel (which is not pre-grafted with the primer set 24A or 24B or 24A' or 24B'), exposing the second material 32 located above the gap region 20 to the second predetermined UV light dose D2 triggers a chemical reaction between the polymer hydrogel of the second material 32 and the corresponding UV reactive functional groups of the resin layer 16. This forms an example of an attached second material 32' at the gap region 20. The polymer hydrogel of the second material 32 will not react with the polymer hydrogel already present in the recess 18 (i.e., the attached functional layer 22'). In some cases, the polymer hydrogel of the second material 32 is deposited under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.), which helps the second material 32 selectively attach to the gap region 20. In these cases, the high ionic strength conditions prevent the second polymer hydrogel (of the second material 32) from being deposited on or adhering to the attached functional layer 22'. Thus, unreacted polymer hydrogel of the second material 32 can be removed before primer grafting occurs. It should be understood that in this example, the polymer hydrogel of the second material 32 is chemically different from the polymer hydrogel of the first functional material 22 (e.g., to facilitate selective attachment of the primer set 24A or 24B or 24A' or 24B' at the recess 18 or gap region 20). In this example, the primer set 24A or 24B or 24A' or 24B' is then grafted to the polymer hydrogel of the attached second material 32'. Because the primer set 24A or 24B or 24A' or 24B' is selective to the chemical composition of the polymer hydrogel of the attached second material 32', the grafting can be performed using any of the techniques described herein. The primer set 24A or 24B or 24A' or 24B' grafted to the polymer hydrogel of the attached second material 32' will not be attached to the polymer hydrogel of the functional layer 22'. In this example, it will be appreciated that one of the primer sets 24A or 24A' is grafted to the attached functional material 22' and the other of the primer sets 24B or 24B' is grafted to the attached second material 32' to enable simultaneous paired end sequencing.

[0287] When the second material 32 is a pre-grafted polymer hydrogel (which is pre-grafted with a primer set 24A or 24B or 24A' or 24B'), exposing the second material 32 located above the gap region 20 to a second predetermined UV light dose D2 triggers a chemical reaction between the pre-grafted polymer hydrogel of the second material 32 and the corresponding UV reactive functional groups of the resin layer 16. This process can be performed under the high ionic strength conditions described herein. This forms an example of an attached second material 32' at the gap region 20. As described above, the polymer hydrogel of the second material 32 will not react with the polymer hydrogel already present in the recess 18. Therefore, the unreacted pre-grafted polymer hydrogel of the second material 32 can be removed. It should be understood that in this example, the polymer hydrogel of the second material 32 may or may not be chemically different from the polymer hydrogel of the first functional material 22 because the primer set is pre-grafted to the polymer hydrogel of the second material 32 and no additional primer is performed. In this example, it will be appreciated that one of the primer sets 24A or 24A' is grafted to the attached functional material 22' and the other of the primer sets 24B or 24B' is pre-grafted to the attached second material 32' to enable simultaneous paired end sequencing.

[0288] Exposing any example of the second material 32 to a predetermined UV light dose D2 can initiate a variety of chemical reactions at the gap region 20, depending in part on the material used for the second material 32 and / or the desired attachment point of the second material 32. As an example, exposing the second material to a predetermined UV light dose D2 can be used to initiate: thiol-ene or thiol-alkyne cycloaddition reactions, heterogeneous Diels-Alder reactions, sterone-olefin or alkyne cycloaddition reactions, aziridine-olefin cycloaddition reactions, oxime ligation, etc.

[0289] Although FIG. 4A to FIG. 4E Not shown, but in examples of methods where the attached first functional material 22' is a polymer hydrogel, the method may further include grafting a primer set 24 (including primers 26, 28) to the attached polymer hydrogel (e.g., after the first UV light exposure and removal of the unattached first functional material 22). In other examples, the first functional material 22 is a polymer hydrogel, and the polymer hydrogel is pre-grafted with the primer set 24.

[0290] In addition, although FIG. 4A to FIG. 4ENot shown, but in examples of the method where the first functional material 22 is a polymer hydrogel particle or polymer hydrogel coated on a core particle and attached to the resin layer 16 within the recess 18 when exposed to a first predetermined UV light dose D1 (i.e., is a functionalized particle), the method may also include grafting the primer set 24 (including primers 26, 28) to the attached first functional material 22' (e.g., after the first UV light exposure and removal of the unattached first functional material 22). In other examples where the first functional material 22 is a functionalized particle, the method also includes pre-grafting the primer set 24 (including primers 26, 28) to the material 22.

[0291] Grafting the primer set 24 to the polymer hydrogel, polymer hydrogel coating, or polymer hydrogel coating (of the attached first functional material 22') can be as described herein with reference to Figure 2D Using any grafting method, the primers 26, 28 react with the reactive groups of the polymer hydrogel and form a chemical bond, thereby attaching the primers 26, 28 to the polymer hydrogel.

[0292] use FIG. 4A to FIG. 4E The patterned structure formed by the method can be attached to a cover or another patterned structure to form a flow cell 10, 10'. Bonding can be performed before or after primer grafting. When bonding is performed before primer grafting, it should be understood that primer grafting can be performed using a flow-through technique. When using FIG. 4A to FIG. 4E When two patterned structures formed by the method are bonded together before primer grafting, the corresponding surfaces can be grafted simultaneously using the flow-through technique.

[0293] The patterned structure and the cover or second patterned structure can be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art. In these examples, it should be understood that the bonding areas 38 are free of the second material 32'. These areas 38 can be masked or otherwise not exposed to the second predetermined light dose D2 so that they remain available for bonding.

[0294] In any of the examples disclosed herein where primer set 24 or primer sets 24A, 24B or 24A', 24B' are directly attached to resin layer 16, it should be understood that UV dosage, intensity, exposure time, etc. can be adjusted to minimize or prevent damage to the primers.

[0295] When the primer groups 24A, 24B or 24A', 24B' are used, the corresponding groups 24A, 24B or 24A', 24B' can be sequentially grafted in predetermined areas so that one group 24A, 24A' is attached at one area of ​​the attached functional material 22', and the other group 24B, 24B' is attached at another area of ​​the attached functional material 22'. Selective grafting can be performed by masking a portion of the attached functional material 22' during the grafting of a specific group 24A, 24A' or 24B, 24B' (i.e., not grafting the specific group 24A, 24A' or 24B, 24B'). Alternatively, different pre-grafted functional materials 22 (i.e., functional materials grafted with the desired groups 24A, 24A' or 24B, 24B', respectively) can be used, and selective UV exposure can be used to attach the pre-grafted functional materials 22 in the corresponding parts of the recessed portion 18.

[0296] Non-limiting working examples

[0297] Example 1

[0298] In this example, reference FIG. 2A to FIG. 2D One of the methods described. An acrylate resin doped with titanium dioxide (TiO2) is used as an example of a resin layer including different amounts of inorganic UV light blocking additive particles ranging from 1wt% to 15wt%, and an acrylate resin doped with avobenzone is used as an example of a resin layer including different amounts of organic UV light blocking additive particles ranging from 1wt% to 18wt%. Each resin composition is deposited, cured and patterned (using nanoimprint lithography) to form recessed portions separated by gap regions. A predetermined UV light dose is directed through each resin layer. A UV-VIS spectrophotometer is used to measure the amount of UV light transmitted through each resin layer. Each titanium dioxide doped acrylate resin exhibits a UV absorbance of 1.0447 W / m2. Figure 5A and each avobenzone-doped acrylate resin exhibits a UV absorbance of Figure 5B In Figure 5A and Figure 5B , the absorbance (of UV light, arbitrary units) of each resin (identified by the wt % of the corresponding UV light blocking additive particles) is shown on the Y-axis, and the wavelength of the light in nanometers is shown on the X-axis.

[0299] like Figure 5A As can be seen in , including an increased amount of UV blocking titanium dioxide particles in the titanium dioxide-doped acrylate resin composition results in an increased absorbance of UV light by the resin layer (and thus better UV light blocking). Figure 5BAs can be seen in the examples, including an increased amount of UV blocking avobenzone in the resin composition results in an increased absorbance of UV light by the resin layer (and thus better UV light blocking). Thus, these examples support that the amount of UV blocking additive particles included in the resin layer affects the ability of the resin layer to block (e.g., absorb and / or reflect) or transmit UV light.

[0300] Example 2

[0301] In this example, reference FIG. 2A to FIG. 2D One of the methods described. In this example, the resin composition comprises 20 wt% (of the total resin composition weight) of pentaerythritol triacrylate (PE3A) and 2 wt% (of the total resin composition weight) of phenylbis(2,4,6-trimethylbenzoyl)phosphine oxide (DPBAPO) in a solvent (the balance of the total resin composition weight), which is doped with 18 wt% (of the total composition weight) of avobenzone (an example of a UV light blocking additive), the avobenzone comprising 120 wt% (of the total avobenzone weight) of The resin was spin coated three times to produce a corresponding film having a thickness of 505 nm, a thickness of 342 nm, and a thickness of 305 nm. A predetermined UV light dose was directed through each of the resin layers. The amount of UV light absorbed by the resin composition was measured using a UV-VIS spectrophotometer, and the amount of UV light absorbed by the resin composition was measured using ellipsometry (i.e., using COMPLETEASE ELECTRONICS available from JA Woollam Co., Inc.). TM The thickness of each resin layer was measured using an RC2 ellipsometer. Fig. 6A and Figure 6B The results of the absorption of UV light by each individual resin layer are depicted in FIG.

[0302] It can be seen that the resin composition with the thickest film (e.g., 505 nm) exhibits the greatest degree of UV light absorption (about 0.65). In contrast, the resin composition with the thinnest film (e.g., 305 nm) exhibits the lowest degree of UV light absorption (about 0.3). These results indicate that increasing the thickness of the resin layer described herein can result in an increased absorbance of the resin layer to UV light.

[0303] Additional Notes

[0304] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0305] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0306] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A method, comprising: A functional material is deposited over a resin layer, the resin layer comprising recessed portions separated by gap regions, wherein: The resin layer includes an ultraviolet (UV) light blocking additive; The recessed portion is located above a first portion of the resin layer having a first thickness, and the gap region is located above a second portion of the resin layer having a second thickness greater than the first thickness; and The functional material readily interacts with the resin layer when exposed to UV light; and A predetermined UV light dose is directed through the resin layer, whereby the functional material within the recessed portion is exposed to the predetermined UV light dose and attached to the resin layer within the recessed portion, and the functional material located above the gap area is partially blocked by the second resin and is not exposed to the predetermined UV light dose. 2 . The method of claim 1 , wherein the functional material is a polymer hydrogel that attaches to the resin layer within the recessed portion when exposed to the predetermined UV light dosage.

3. The method of claim 2, wherein the polymer hydrogel is pre-grafted with a primer set.

4. The method of claim 2, further comprising grafting a primer set onto the polymer hydrogel. 5 . The method of claim 1 , wherein the functional material is a polymer hydrogel coated on a core particle and attached to the resin layer within the recessed portion when exposed to the predetermined UV light dosage. 6 . The method of claim 5 , wherein after exposure to the predetermined UV light dose, the method further comprises attaching a primer set to the polymer hydrogel coated on the core particle. 7 . The method of claim 1 , wherein the functional material comprises a primer set that attaches to the resin layer within the recessed portion when exposed to the predetermined UV light dosage. 8 . The method according to claim 1 , wherein the resin layer comprises about 1 wt % to about 50 wt % of the UV light blocking additive based on the total weight of the resin layer.

9. A method comprising: The functional material is introduced into a flow cell comprising two patterned substrates, each of the patterned substrates comprising a resin layer having recessed portions separated by gap regions, wherein: The resin layer includes an ultraviolet (UV) light blocking additive; The concave portion of each of the two patterned substrates is located above a first portion of the resin layer having a first thickness, and the gap region of each of the two patterned substrates is located above a second portion of the resin layer having a second thickness greater than the first thickness; and The functional material readily interacts with the resin layer of each of the two patterned substrates when exposed to UV light; and At the same time, a predetermined UV light dose is guided through the resin layer of each of the two patterned substrates, whereby some of the functional materials within the recessed portion of the first patterned substrate of the two patterned substrates are exposed to the predetermined UV light dose and attached to the resin layer within the recessed portion of the first patterned substrate of the two patterned substrates, some other of the functional materials within the recessed portion of the second patterned substrate of the two patterned substrates are exposed to the predetermined UV light dose and attached to the resin layer within the recessed portion of the second patterned substrate of the two patterned substrates, and the functional materials in contact with the gap area of ​​each of the two patterned substrates are partially blocked by the second resin and are not exposed to the predetermined UV light dose.

10. The method of claim 9, wherein the functional material is a polymer hydrogel that, when exposed to the predetermined UV light dose, attaches to the resin layer within the recessed portion of each of the first and second patterned substrates of the two patterned substrates.

11. The method of claim 10, wherein the polymer hydrogel is pre-grafted with a primer set.

12. The method of claim 10, further comprising grafting a primer set onto the polymer hydrogel.

13. The method of claim 9, wherein the functional material is a polymer hydrogel coated on a core particle and attached to the resin layer within the recessed portion of each of the first and second patterned substrates of the two patterned substrates when exposed to the predetermined UV light dose.

14. The method of claim 13, wherein after exposure to the predetermined UV light dose, the method further comprises attaching a primer set to the polymer hydrogel coated on the core particle.

15. The method of claim 9, wherein the functional material comprises a primer set that, when exposed to the predetermined UV light dose, attaches to the resin layer within the recessed portion of each of the first and second patterned substrates of the two patterned substrates.

16. The method according to any one of claims 9 to 15, wherein the resin layer of each of the first patterned substrate and the second patterned substrate of the two patterned substrates comprises about 1 wt % to about 50 wt % of the UV light blocking additive based on the total weight of each of the resin layers.

17. A method comprising: A first functional material is deposited over a resin layer, the resin layer comprising recessed portions separated by gap regions, wherein: The resin layer includes an ultraviolet (UV) light blocking additive; The recessed portion is located above a first portion of the resin layer having a first thickness, and the gap region is located above a second portion of the resin layer having a second thickness greater than the first thickness; and The first functional material is susceptible to interacting with the resin layer when exposed to UV light; directing a first predetermined UV light dose through the resin layer, thereby exposing the first functional material within the recessed portion to the first predetermined UV light dose and attaching to the resin layer within the recessed portion, and the first functional material located above the gap region is blocked by the second resin portion from being exposed to the first predetermined UV light dose and remains unattached to the resin layer at the gap region; removing the first functional material from the interstitial region; depositing a second material over the first functional material in the gap region and the recessed portion, wherein the second material readily interacts with the resin layer when exposed to UV light and does not readily interact with the first functional material when exposed to UV light; and A second predetermined UV light dose is directed directly at the second material, whereby the second material is exposed to the second predetermined UV light and attached to the resin layer at the gap region and remains unattached to the first functional material. The method of claim 17 , wherein the second material is a passivation material.

19. The method of claim 17, wherein the second material is a functionalized material selected from the group consisting of: a quencher, an antioxidant, and combinations thereof.

20. The method of any one of claims 17 to 19, wherein the first functional material is a polymer hydrogel that attaches to the resin layer within the recessed portion when exposed to the first predetermined UV light dose.

21. The method of claim 20, wherein the polymer hydrogel is pre-grafted with a primer set.

22. The method of claim 20, further comprising grafting a primer set onto the polymer hydrogel.

23. The method of any one of claims 17 to 19, wherein the first functional material is a polymer hydrogel coated on a core particle and attached to the resin layer within the recessed portion when exposed to the first predetermined UV light dose.

24. The method of any one of claims 17 to 19, wherein the first functional material comprises a primer set that attaches to the resin layer within the recessed portion when exposed to the first predetermined UV light dose.

25. The method of any one of claims 17 to 24, wherein the resin layer comprises about 1 wt% to about 50 wt% of the UV light blocking additive based on the total weight of the resin layer.

Images