Use of chromatin domain Y-like protein CDYL in preparing drugs for preventing or treating cardiac aging
By constructing a recombinant adeno-associated virus vector that overexpresses CDYL and targeting cardiomyocytes, the problem of insufficient intervention targets for cardiac aging was solved, and the effect of significantly improving cardiac function and delaying cardiac aging was achieved.
Patent Information
- Application Number
- CN202411635647.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-11-15
AI Technical Summary
Currently, epigenetic modification plays a key role in cardiac aging, but the specific intervention targets and methods have not been fully studied, especially the role of chromatin domain Y-like protein CDYL in cardiac aging has not been clarified.
The invention provides a nucleotide sequence encoding a chromatin domain Y-like protein CDYL, and constructs a recombinant adeno-associated virus vector overexpressing CDYL to target cardiomyocytes and overexpress CDYL to intervene in cardiac aging.
Overexpression of CDYL significantly improves cardiac function, reduces myocardial fibrosis and cardiomyocyte hypertrophy, delays heart aging, reduces the expression of genes related to myocardial fibrosis and myocardial hypertrophy, and improves cardiovascular diseases in the elderly.
Smart Images

Figure CN119454918B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of a chromatin domain Y-like protein CDYL in preparing a drug for preventing or treating cardiac aging. Background Art
[0002] Aging is an increasingly serious global problem. At present, the aging of my country's population is accelerating, and various cardiovascular diseases caused by aging have become health problems that cannot be ignored. Cardiac aging refers to a series of structural and functional degeneration of the heart due to the aging of individuals, including myocardial cell aging, hypertrophy, excessive proliferation of myocardial fibroblasts, metabolic abnormalities of extracellular matrix such as elastin, inflammation, cardiac dysfunction, etc. Cardiac aging increases the risk of hypertension, atherosclerosis and heart failure. Current studies have shown that lifestyle interventions can delay cardiac aging to a certain extent, such as aerobic exercise, a balanced diet and a regular work and rest schedule. In addition, further exploring the key molecules and molecular mechanisms of cardiac aging from a new perspective will help develop strategies to effectively delay cardiac aging and improve cardiovascular diseases in the elderly, which has important clinical significance.
[0003] Recent studies have demonstrated that epigenetic modifications play a key role in cardiac aging and could serve as potential targets for intervention. Existing studies have revealed that the Sirtuin family (such as SIRT1 and SIRT2) plays a crucial role in cardiac aging. For example, SIRT2 activates AMPK, primarily in an LKB1-dependent manner, thereby inhibiting vascular and myocardial remodeling. Notably, epigenetic modifications are reversible, meaning that pharmacological interventions can modulate their levels and improve cardiac function. For example, previous studies have reported that the histone acetyltransferase activator SPV106 significantly restored proliferation and differentiation levels in cardiac mesenchymal cells from diabetic patients, reduced histone methylation levels, and significantly inhibited aging. Therefore, the application of epigenetic modifications in cardiac aging holds great promise. Chromodomain Y-like (CDYL) is a protein with chromatin remodeling and transcriptional regulation functions, playing an important role in cellular epigenetic regulation. As a crotonyl-CoA hydratase, CDYL converts crotonyl-CoA to β-hydroxybutyryl-CoA and negatively regulates histone crotonylation. It has been reported that CDYL is closely related to physiological and pathological processes such as acute kidney injury, tumors and reproductive development, but whether it plays a role in cardiac aging has not been reported yet. Summary of the Invention
[0004] The technical problem to be solved by the present invention is: Currently, epigenetic modification plays a key role in cardiac aging and can be used as a potential intervention target. However, which intervention targets or intervention methods can specifically act on cardiac aging remains to be studied.
[0005] The technical solution of the present invention to solve the above technical problems is: to provide a use of a chromatin domain Y-like protein CDYL in the preparation of a drug for preventing or treating cardiac aging.
[0006] Among them, in the above-mentioned use, the encoding nucleotide sequence of the chromatin domain Y-like protein CDYL is shown as SEQ ID NO: 1.
[0007]
[0008] Among them, in the above-mentioned use, the heart aging refers to at least one of heart dysfunction caused by aging, myocardial cell hypertrophy, increased myocardial collagen deposition, myocardial fibrosis or chronic heart failure.
[0009] Wherein, in the above use, the chromatin domain Y-like protein CDYL acts by overexpression.
[0010] Among them, in the above-mentioned use, the medicine also includes pharmaceutically acceptable excipients.
[0011] The present invention also provides a drug for preventing or treating heart aging, comprising a chromatin domain Y-like protein CDYL.
[0012] The beneficial effects of the present invention are:
[0013] The present invention constructs a recombinant adeno-associated virus vector that overexpresses CDYL. Studies have shown that this recombinant vector can overexpress CDYL. Furthermore, it has been found that overexpression of CDYL can delay cardiac aging, improve aging-related weakening of cardiac function, alleviate myocardial hypertrophy, reduce myocardial fibrosis, and reduce cardiomyocyte hypertrophy and myocardial fibrosis. Therefore, the present invention provides the use of the chromatin domain Y-like protein CDYL in the preparation of a drug for preventing or treating cardiac aging, providing a new drug and approach for intervention in cardiac aging. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This is a map of the adeno-associated virus vector used in the present invention.
[0015] Figure 2 Figure 1 shows the timeline of animal experiments overexpressing CDYL in mice and the infection efficiency of adeno-associated virus (AAV) in myocardial tissue. A shows the timeline of animal experiments; B shows the infection efficiency of AAV in myocardial tissue by immunofluorescence. EGFP is the AAV-carried element, labeled with green fluorescence; α-actinin is a cardiomyocyte-specific marker, labeled with red fluorescence; and DAPI is the cell nucleus, labeled with blue fluorescence.
[0016] Figure 3Overexpression of CDYL in mice significantly improved heart aging. A shows that overexpression of CDYL significantly reduced the increase in ejection fraction (EF) and fraction shortening (FS) caused by aging; B shows the statistical results of the heart weight to body weight (HW / BW) and heart weight to tibia length (HW / TL) ratios of each group. Overexpression of CDYL significantly reduced the increase in heart weight caused by aging; C shows the results of hematoxylin-eosin (H&E) staining and wheat germ agglutinin (WGerm) staining. Representative images of each group using WGA (Agglutinin) staining. Overexpression of CDYL significantly reduces the aging-induced increase in myocardial cross-sectional area. D: Overexpression of CDYL significantly reduces the gene expression of cardiac hypertrophy markers (Nppa, Nppb, and Myh7). E: Overexpression of CDYL significantly alleviates myocardial fibrosis in the elderly group. F: Overexpression of CDYL significantly reduces the gene expression of myocardial fibrosis markers (Col1a1, Fn1, and Ctgf). ***, p < 0.001, n = 8-10. DETAILED DESCRIPTION
[0017] The present invention provides a recombinant adeno-associated viral vector expressing a chromatin domain Y-like protein, CDYL. The vector contains a gene encoding the chromatin domain Y-like protein, CDYL, and can overexpress CDYL in vivo. After constructing a recombinant adeno-associated viral vector overexpressing the chromatin domain Y-like protein, the present invention found that overexpression of CDYL significantly improved cardiac aging in mice. This vector can serve as a target for drug intervention to delay cardiac aging and can be used to prepare drugs to delay cardiac aging.
[0018] The present invention constructs an adeno-associated virus (AAV) carrying a cardiac troponin T (cTnT) promoter (targeting cardiomyocytes) to overexpress CDYL. The overexpression control AAV and overexpression CDYL AAV are AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. Young (3 months old) and old (21 months old) C57 mice were included and injected with the above-mentioned virus. After 3 months, the effect of CDYL on cardiac aging was evaluated by echocardiography, pathological staining, marker detection, etc. The present invention found that compared with the control old group, the cardiac function of the old mice overexpressing CDYL was significantly improved, their myocardial cross-sectional area was significantly reduced, their myocardial fibrosis was significantly reduced, and cardiac aging was significantly delayed. The above studies confirm that CDYL can be used as a target for the preparation of cardiac aging drugs.
[0019] The specific embodiments of the present invention will be further explained below through examples, but it is not intended to limit the scope of protection of the present invention to the scope described in the examples.
[0020] The reagents and equipment used in the examples are all common commercially available products.
[0021] Example 1 In vivo experiments in mice verify the effect of CDYL on cardiac aging
[0022] An adeno-associated virus carrying the cTnT promoter targeting cardiomyocytes to overexpress CDYL was constructed and commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd. The pHBAAV-TNT-3flag-P2A-EGFP vector map is as follows: Figure 1 The overexpression target sequence is shown in SEQ: NO: 1.
[0023] Twenty young (3-month-old) C57 mice were randomly divided into two groups and injected with AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. Twenty old (21-month-old) C57 mice were randomly divided into two groups and injected with AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. The injected virus titer was 5×10 11 vg. After 3 months, the effects of CDYL on cardiac aging were evaluated using echocardiography, pathological staining, and marker detection. Figure 2 As shown in A.
[0024] (1) Echocardiography to evaluate cardiac function in mice: Before ultrasound examination, the mice were anesthetized by inhalation of isoflurane, and the anesthetized mice were fixed in a supine position on the monitoring table. The hair on the chest of the mice was removed. The heart rate of the mice was maintained at 400-500 beats / min during the ultrasound examination. The 3100 small animal high-frequency ultrasound imaging system was used with an MX400 probe (30 MHz). Echocardiographic images were acquired after continuous observation of several cardiac cycles in the long-axis and short-axis sections. Vevo LAB 5.5.1 software was used to analyze the images and calculate EF and FS to assess cardiac function in mice. Figure 3 As shown in A, the results show that compared with the young group of mice, the EF and FS of the old mice were significantly decreased, while overexpression of CDYL significantly increased the EF and FS values of the old mice. This result shows that CDYL can significantly improve the decline in cardiac function caused by aging.
[0025] (2) The mice were euthanized, weighed, dissected, and their hearts were removed. The remaining blood was gently squeezed out and the heart was washed twice with ice PBS before being weighed and recorded. The tibia of the mice was removed and the length was measured with a vernier caliper and recorded. The heart weight to body weight ratio and the heart weight to tibia length ratio were calculated as follows: Figure 3 As shown in Figure B, the results showed that compared with the young group, the heart weight to body weight ratio and the heart weight to tibia length ratio of the old group were significantly increased, while CDYL knockdown significantly reduced these ratios. This result indicates that CDYL knockdown significantly reduces the increase in heart weight caused by aging.
[0026] (3) Immunofluorescence detection of the infection efficiency of adeno-associated virus in mouse myocardium: The fixed tissue was placed in 4% paraformaldehyde at 4°C for 24 hours, and then transferred to 30% sucrose solution for further fixation for 24 hours. The tissue was embedded in OCT embedding medium and then quickly frozen in liquid nitrogen. The embedded tissue was placed in a freezing microtome and cut into slices of about 6 μm. The slices were dried at room temperature for 15 minutes, then fixed with cold acetone for 5-10 minutes, rinsed with PBS, and blocked with blocking buffer for 1 hour. Blocked with PBS supplemented with 0.2% Triton X-100 and 5% serum at room temperature, and then incubated with primary antibody (α-actinin) overnight at 4°C. The next day, the slices were incubated with fluorescently labeled secondary antibodies at room temperature for 1 hour. Use DAPI to stain the cell nucleus and incubate at room temperature for 10-15 minutes. Finally, the slices were sealed with anti-fluorescence quenching agent and observed and photographed using a confocal microscope. The results are as follows Figure 2 As shown in B, the results show that the fluorescence overlap ratio of EGFP and α-actinin is high, which indicates that AAV9 has a high efficiency in infecting cardiomyocytes.
[0027] (4) Pathological staining: ① The heart tissue was fixed with 4% paraformaldehyde at 4°C for 24 hours, then routinely dehydrated, transparentized, paraffin-embedded, sliced, and stained with H&E. After staining, the sections were sealed and scanned. ② The tissue sections were dewaxed at room temperature, rinsed with distilled water, and antigen repaired with antigen repair solution. FITC-labeled wheat germ agglutinin (FITC-WGA) was added and incubated in a humidified chamber at room temperature for 1 hour. The nuclei were stained with DAPI and sealed. The sections were observed and scanned under a microscope. The myocardial cross-sectional area was then analyzed using Image Pro Plus software. ③ The tissue sections were routinely dewaxed to water, stained with prepared Weigert iron hematoxylin staining solution, differentiated with acidic ethanol differentiation solution, blued with Masson blueing solution, and stained with Ponceau fuchsin staining solution. Water washing was required between each staining. After Ponceau fuchsin staining, the sections were washed with weak acid working solution (the ratio of weak acid working solution was distilled water: weak acid solution = 2:1), and then washed with phosphomolybdic acid solution. After that, the sections were directly placed in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, the sections were quickly dehydrated with 95% ethanol, and then dehydrated with anhydrous ethanol for 3 times. Finally, the sections were transparentized with xylene for 3 times and sealed with neutral gum. After staining, the sections were scanned. After obtaining the scanned images, the myocardial collagen deposition was analyzed using Image J software. The results are shown in the figure. Figure 3 C and Figure 3 As shown in Figure E, the results show that overexpression of CDYL in animals significantly reduced myocardial cross-sectional area and the area of myocardial fibrosis. This result indicates that CDYL can significantly improve myocardial hypertrophy and myocardial fibrosis caused by aging.
[0028] (5) Detection of marker genes: RNA was extracted according to the instructions of the kit (Accurate Biotechnology, AG21024), and reverse transcription reaction and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4μL), Primer Mix (1μL), RT Enzyme Mix (1μL), RNA and RNAase-free Water (14μL). The PCR amplification reaction system consists of the following components: SYBR Green Real time PCR Master Mix (10μL), upstream primer (10μM, 1μL); downstream primer (10μM, 1μL), cDNA and RNAase-free Water (8μL); the PCR reaction procedure is as follows: pre-denaturation (95℃, 2min); amplification reaction (95℃, 10s; 59℃, 10s; 72℃, 15s), 40 cycles; melting curve analysis (65-95℃). The primers for mouse marker genes used are as follows: Nppa upstream primer sequence: TCTTCCTCGTCTTGGCCTTT (SEQ ID NO: 2), Nppa downstream primer sequence: CCAGGTGGTCTAGCAGGTTC (SEQ ID NO: 3); Nppb upstream primer sequence: TGGGAGGTCACTCCTATCCT (SEQ ID NO: 4), Nppb downstream primer sequence: GGCCATTTCCTCCGACTTT (SEQ ID NO: 5); Myh7 upstream primer sequence: CGGACCTTGGAAGACCAGAT (SEQ ID NO: 6); Myh7 downstream primer sequence: GACAGCTCCCATTCTCTGT (SEQ ID NO: 7); Fn upstream primer sequence: TAGGATTGGAGACACGTGGA (SEQ ID NO: 8), Fn downstream primer sequence: TGCGGTTGGTAAATAGCTGT (SEQ ID NO: 9); Ctgf upstream primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 10); NO: 10), Ctgf downstream primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 11); Gapdh upstream primer sequence: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 12) Gapdh downstream primer sequence: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 13). The results are as follows Figure 3As shown in Figures D and 3F, the results show that compared with the young group, the expression of cardiac hypertrophy markers Nppa, Nppb, and Myh7, as well as cardiac fibrosis markers Col1a1, Fn1, and Ctgf, was significantly upregulated in the aged mice. Overexpression of CDYL significantly reduced the aging-induced increase in gene expression of these markers. This result suggests that CDYL overexpression can significantly reduce the aging-induced upregulation of gene expression associated with heart failure.
[0029] From the above results, it can be seen that overexpression of CDYL can significantly improve cardiac aging in mice, and can be used as a drug intervention target for delaying cardiac aging and preparing drugs for delaying cardiac aging.
Claims
1. Use of an agent that overexpresses a chromatin domain Y-like protein (CDYL) in the preparation of a drug for delaying or ameliorating cardiac aging; the nucleotide sequence encoding the chromatin domain Y-like protein (CDYL) is shown in SEQ ID NO: 1; cardiac aging refers to at least one of aging-induced cardiac dysfunction, myocardial hypertrophy, or myocardial fibrosis.
2. The use according to claim 1, characterized in that: The medicine also includes pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Cardiac repair by reprogramming of adult cardiac fibroblasts into cardiomyocytes
US20210180023A1
Use of CILP2 in preparation of drug for ameliorating heart aging and myocardial hypertrophy
WO2022033152A1