New use of s100a11 inhibitors and medicaments for treating hair regrowth disorders and / or promoting hair regrowth

By constructing an S100a11 inhibitor vector to specifically inhibit S100a11 gene expression, and using lentiviral injection to promote the transition of hair follicles from the resting phase to the growth phase, the safety and effectiveness issues of hair regeneration disorder treatment are resolved, providing a new therapeutic target.

CN119454958BActive Publication Date: 2025-10-10SHENYANG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411359963.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-27
Publication Date
2025-10-10
Estimated Expiration
2044-09-27

AI Technical Summary

Technical Problem

Existing treatments for hair regeneration disorders have problems such as large side effects, insignificant effects, or the need for long-term use, and lack safe and effective therapeutic targets.

Method used

By constructing a vector for the S100a11 inhibitor, the expression of the S100a11 gene is specifically inhibited, and lentiviral injection is used to promote the transition of hair follicles from the resting phase to the growth phase, thereby promoting hair regeneration.

Benefits of technology

It significantly and effectively promotes hair regeneration, provides a new potential target for treating hair regeneration disorders, overcomes the shortcomings of traditional surgery and drug treatments, and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119454958B_ABST
    Figure CN119454958B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of medicine, and particularly relates to a new use of S100a11 inhibitor and a medicine for treating hair regeneration disorder and / or promoting hair regeneration. The present application firstly finds that the S100a11 gene is closely related to the growth and development regulation of hair follicles; and confirms that the expression of the S100a11 gene can be promoted by inhibiting the expression of the S100a11 gene. The present application constructs a vector for inhibiting the expression of S100a11, and further obtains a lentivirus for inhibiting the expression of S100a11 through cell transfection. In the process of hair cycle regeneration of mice, the expression of S100a11 can be significantly and effectively promoted by specifically inhibiting the expression of S100a11, and the hair follicles are induced to be converted from the resting phase to the growth phase in advance. The present application provides a new potential treatment target for human or animal alopecia or hair follicle hair regeneration disorder and other related diseases, has important significance for the research of hair cycle regeneration, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and particularly relates to a new use of S100a11 inhibitors and application thereof in a medicament for treating hair regrowth disorders and / or promoting hair regrowth. BACKGROUND

[0002] With the rapid development of society, hair regrowth disorders have become an increasingly common problem. Hair regrowth disorders are a class of diseases affecting hair growth and regeneration, mainly manifested as sparse hair, hair loss, and difficulty in regrowing hair, including alopecia areata, androgenetic alopecia, and cicatricial alopecia. Hair has the functions of physical protection, body temperature regulation, tactile perception, and aesthetics. If hair regrowth disorders are severe, they will affect appearance and mental health.

[0003] Hair follicles are small organs attached to the skin and are responsible for hair growth and periodic cyclic regeneration. Under normal circumstances, hair follicles will undergo continuous periodic remodeling, including an involution phase driven by apoptosis, a resting phase in a relatively static state, and a growth phase that restores growth activity and produces hair shafts. However, hair follicles are affected by complex factors, including endocrine, nutritional, or disease factors that cause hair regrowth disorders, pathological abnormalities in hair follicles, and failure to enter the growth phase normally, ultimately leading to hair regrowth disorders such as atrophic hair follicles and hair loss.

[0004] Existing treatment methods include drug therapy, surgical treatment, and physical therapy. Common hair loss treatment drugs such as finasteride and minoxidil can effectively slow down the progression of hair loss and promote hair growth to some extent, but still have some side effects, such as finasteride may cause sexual dysfunction and other adverse reactions. In addition, drug therapy must be used long-term. Hair transplantation surgery can quickly and effectively improve hair appearance, but requires patients to have certain hair follicle resources. The surgical process also has certain risks, such as infection, bleeding, etc. Postoperative recovery period is also required, and patients need to follow strict care requirements. Physical therapy is mainly laser therapy, which can stimulate the activity of hair follicle cells and promote hair growth, but the effect of laser therapy is relatively slow, and long-term use is required to see obvious results. The treatment effect is relatively limited, and the effect may not be ideal for patients with severe hair loss. Therefore, developing a safe and effective new target for treating hair regrowth disorders and promoting hair regrowth has important clinical needs and application prospects.

[0005] S100 proteins are calcium-binding proteins with a molecular weight of 10-12 kDa, primarily synthesized and secreted by fibroblasts, macrophages, lymphocytes, and neutrophils. S100 family proteins are involved in the physiological functions of normal hair follicles and are expressed in a tissue-specific manner, playing a vital role in hair growth, structural maintenance, and regeneration. S100 calcium-binding protein A11 (S100A11), a member of the S100 protein family, influences processes such as cell proliferation, differentiation, and migration. As a multifunctional protein, S100A11 plays an important role in various fields, including skin health and cancer. However, whether S100a11 is involved in the regulation of hair follicle growth and development, or its role in hair regeneration, has not yet been studied or reported. Summary of the Invention

[0006] To address these technical issues, the present invention constructed a vector that inhibits S100a11 expression and, through cell transfection, generated a lentivirus that inhibits S100a11 expression. In mice undergoing hair regeneration, specific inhibition of S100a11 expression significantly promoted hair regeneration on the back of the head, inducing an earlier transition of hair follicles from the resting phase to the anagen phase, revealing a link between the S100a11 gene and hair regeneration.

[0007] The first aspect of the present invention provides use of an S100a11 inhibitor in the preparation of a medicament for treating hair regeneration disorders and / or promoting hair regeneration.

[0008] Furthermore, the S100a11 inhibitor is at least one of the following drugs: a drug that knocks out or silences the S100a11 gene, and a drug that inhibits the function of the S100A11 protein.

[0009] Furthermore, the drugs for knocking out or silencing the S100a11 gene include: siRNA, shRNA or drugs for achieving CRISPR gene editing; the drugs for inhibiting the function of the S100A11 protein include: competitive inhibitors, non-competitive inhibitors or regulatory inhibitors.

[0010] Furthermore, the drug for knocking out or silencing the S100a11 gene includes: an S100a11 gene RNA interference fragment, an RNAi vector containing the S100a11 gene RNA interference fragment, or a lentivirus containing an RNAi vector containing the S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is an S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4, or other S100a11 gene-specific RNA interference fragment; the RNAi vector containing the S100a11 gene RNA interference fragment is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP with a nucleotide sequence as shown in SEQ ID NO:1, or other similar expression vectors that can be used for RNAi.

[0011] Furthermore, the S100a11 gene RNA interference fragment sh_S100a11 has a hairpin structure, and the construction method includes:

[0012] A specific shRNA was designed for the mouse S100a11 gene, resulting in an upstream sequence S100a11-F having a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R having a nucleotide sequence as shown in SEQ ID NO:7;

[0013] The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4.

[0014] Furthermore, the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is constructed by:

[0015] The S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO: 4 was ligated to the expression vector pCDH-Lgr5-CMV-copGFP to obtain the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0016] Furthermore, the lentivirus containing the RNAi vector of the S100a11 gene RNA interference fragment is obtained by transfecting the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP into tool cells.

[0017] Furthermore, the tool cells are HEK 293T cells or other similar tool cells that are easily transfected.

[0018] Further, the lentivirus regulates the RNAi carrier by the Lgr5 promoter to inhibit the expression of the S100a11 gene.

[0019] In a second aspect of the present application, a medicament for treating hair regeneration disorder and / or promoting hair regeneration is provided, which is prepared by adding a S100a11 inhibitor as an active ingredient into pharmaceutically acceptable adjuvants or auxiliary ingredients.

[0020] The present application has the following beneficial effects:

[0021] 1. The present application promotes the regeneration of mouse back hair by inhibiting the expression of S100a11 gene, which provides a new idea for treating alopecia.

[0022] 2. In the process of mouse hair cycle regeneration, it is found that the test group injected with lentivirus containing S100a11 gene RNAi carrier pCDH-Lgr5-sh_S100a11-CMV-copGFP enters the hair growth period earlier than the control group. It is proved that specifically inhibiting the expression of S100a11 can significantly effectively promote hair regeneration and induce hair follicles to convert from the resting period to the growth period. The present application provides a new potential treatment target for human or animal alopecia or hair follicle hair regeneration disorder and other related diseases, has important significance for the research of hair cycle regeneration, and has good application prospect.

[0023] 3. The present application promotes the regeneration of mouse back hair by injecting lentivirus, which overcomes the instability of the effect and safety of the current traditional surgical and drug treatment methods, and provides a new treatment target for improving animal alopecia by genetic transformation. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a construction diagram of the recombinant expression vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0025] Figure 2 It is a comparison of the pigmentation and hair regeneration of the mouse back injected with the control group containing the pCDH-Lgr5-CMV-copGFP empty vector lentivirus and the test group injected with the recombinant lentivirus containing the RNAi carrier pCDH-Lgr5-sh_S100a11-CMV-copGFP. The red box is the part of the mouse injection area where the hair changes.

[0026] Figure 3Pigmentation and hair regrowth on the backs of mice injected with the empty pCDH-Lgr5-CMV-copGFP lentivirus as a control group were compared with those injected with the recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP as a test group. t-test, n = 5, *P < 0.05, **P < 0.01.

[0027] Figure 4 H&E staining of hair follicles in mice injected with the empty pCDH-Lgr5-CMV-copGFP lentivirus in the control group and the recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP in the experimental group. Scale bar = 1 mm. DETAILED DESCRIPTION

[0028] The present invention is described in detail below with reference to the embodiments, but the embodiments of the present invention are not limited thereto. The embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative work all fall within the scope of protection of the present invention.

[0029] Specific techniques or conditions not specified in the examples of this application can be carried out according to the techniques described in the literature in this field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0030] The main reagents used in the examples: ether was purchased from Changshu Hongsheng Fine Chemical Co., Ltd.; PBS, hematoxylin staining solution, eosin staining solution, and neutral gum mounting medium were purchased from Sangon Biotech (Shanghai) Co., Ltd.; trypsin substitute was purchased from Thermo Fisher Scientific (China) Co., Ltd. DH5α competent cells and plasmid extraction kit (DP118) were purchased from Tiangen Biotech (Beijing) Co., Ltd. LipoFiter TM Liposome transfection reagent was purchased from Hanbio Biotechnology (Shanghai) Co., Ltd. DMEM / HIGH GLUCOSE was purchased from Hyclone (USA).

[0031] The experimental animals used in the examples were healthy 8-week-old C57BL / 6J mice, which were randomly divided into an experimental group and a control group. Five mice in each group were used to observe dorsal pigmentation and hair regeneration after lentivirus injection; two mice in each group were used to observe hair follicle regeneration tissue.

[0032] Prior art suggests that S100A11 plays a key role in maintaining tissue homeostasis and in the development and progression of diseases by interacting with other proteins and molecules to influence cell proliferation, differentiation, and migration. As a multifunctional protein, S100A11 plays a crucial role in various fields, including skin health and cancer. However, there are currently no studies or reports on whether S100a11 is involved in regulating hair follicle growth and development, or its role in hair regeneration.

[0033] According to a first aspect of the embodiments of the present invention, there is provided use of an S100a11 inhibitor in the preparation of a medicament for treating hair regeneration disorders and / or promoting hair regeneration.

[0034] The present invention has demonstrated that hair regeneration can be promoted by inhibiting the expression of the S100a11 gene.

[0035] In some embodiments, the S100a11 inhibitor is at least one of the following drugs: a drug that knocks out or silences the S100a11 gene, and a drug that inhibits the function of the S100A11 protein.

[0036] In some embodiments, the drug for knocking out or silencing the S100a11 gene includes: siRNA, shRNA or drugs for achieving CRISPR gene editing; the drug for inhibiting the function of the S100A11 protein includes: competitive inhibitors, non-competitive inhibitors or regulatory inhibitors.

[0037] In some embodiments, the drug for knocking out or silencing the S100a11 gene includes: an S100a11 gene RNA interference fragment, an RNAi vector containing the S100a11 gene RNA interference fragment, or a lentivirus containing an RNAi vector containing the S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is an S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4, or other S100a11 gene-specific RNA interference fragment; the RNAi vector containing the S100a11 gene RNA interference fragment is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP with a nucleotide sequence as shown in SEQ ID NO:1, or other similar expression vectors that can be used for RNAi.

[0038] In some embodiments, the S100a11 gene is inhibited by an S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is constructed by:

[0039] A specific shRNA was designed for the mouse S100a11 gene, resulting in an upstream sequence S100a11-F having a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R having a nucleotide sequence as shown in SEQ ID NO:7;

[0040] The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 with a hairpin structure.

[0041] The nucleotide sequence of the CDS region (Coding Sequence) of the S100a11 gene is shown in SEQ ID NO: 3.

[0042] The nucleotide sequence of the sh_S100a11 is shown in SEQ ID NO:4.

[0043] The present invention can significantly and effectively promote hair regeneration by inhibiting S100a11 gene expression, inducing hair follicles to switch from the resting phase to the growth phase ahead of time, which provides a new idea for treating hair loss.

[0044] In some embodiments, the RNAi vector is the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP whose nucleotide sequence is shown in SEQ ID NO: 1.

[0045] In some embodiments, the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is constructed by:

[0046] The RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP was obtained by ligating the S100a11 gene RNA interference fragment sh_S100a11, whose nucleotide sequence is shown in SEQ ID NO: 4, to the expression vector pCDH-Lgr5-CMV-copGFP containing the Lgr5 gene promoter, wherein the nucleotide sequence of the expression vector pCDH-Lgr5-CMV-copGFP is shown in SEQ ID NO: 2. The nucleotide sequence containing the Lgr5 gene promoter is shown in SEQ ID NO: 5.

[0047] In some embodiments, the lentivirus is obtained by transfecting the RNAi vector into a tool cell. Preferably, the tool cell is a HEK 293T cell or other similar easily transfected tool cell.

[0048] Specifically, the preparation method of the recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP comprises the following steps:

[0049] 1) The RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP was transformed into Escherichia coli competent cells DH5α, and the positive plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP was extracted;

[0050] 2) The positive plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP was transfected into HEK 293T cells to obtain a recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0051] In some embodiments, the lentivirus regulates the RNAi vector through the Lgr5 promoter to inhibit the expression of the S100a11 gene.

[0052] Specifically, hair follicle stem cells have the ability to self-renew and reconstruct hair follicles, especially those expressing the Lgr5 gene (Lgr5 + ) hair follicle stem cells are first activated during the hair follicle cycle regeneration process. + An interference sequence specifically targeting S100a11 was expressed in hair follicle stem cells, and an expression vector pCDH-Lgr5-sh_S100a11-CMV-copGFP that specifically inhibits S100a11 was constructed.

[0053] In a second aspect, the present invention provides a drug for treating hair regeneration disorders and / or promoting hair regeneration, which is prepared by using an S100a11 inhibitor as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.

[0054] In summary, the present invention constructs a vector that inhibits S100a11 expression, and through cell transfection, produces a lentivirus that inhibits S100a11 expression. Subcutaneous injection of the lentivirus, which specifically inhibits S100a11 expression, during the hair regeneration cycle in mice significantly and effectively promotes hair regeneration on the back of the mice, inducing an early transition of hair follicles from the resting phase to the anagen phase. This invention provides a new potential therapeutic target for human or animal diseases such as alopecia and hair follicle regeneration disorders, and is of great significance to the study of hair regeneration and has promising application prospects.

[0055] Example 1 Recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP (S100a11 RNAi lentivirus)

[0056] The preparation method is as follows:

[0057] (1) Acquisition of sh_S100a11

[0058] 1. Design and synthesis of shRNA sequences targeting mouse S100a11

[0059] Referring to the nucleotide sequence information of the CDS region of the mouse S100a11 gene (NM_016740.3) in the NCBI database (shown as SEQ ID NO:3), the predicted mouse S100a11 nucleotide guide sequence was selected using the Invitrogen Block-iT RNAi Designer and the sequence-specific alignment tool on the NCBI-BLAST website. S100a11 shRNA oligo design was performed based on the miR-30 vector. Restriction sites were incorporated into the 5' end of the designed interfering sequence based on the restriction site information shown in the plasmid map. The designed S100a11-specific shRNA oligo sequences are S100a11-F and S100a11-R. The DNA sequences of S100a11-F and S100a11-R are as follows. The oligo sequences were finally synthesized by Sangon Biotechnology Co., Ltd.

[0060] S100a11-F

[0061] CTAGGAAGGTATATTGCTGTTGACAGTGAGCGCGCTATAGCGTGCCATGATTCTTA GTGAAGCCACAGATGTAAGAATCATGGCACGCTATAGCTTGCCTACTGCCTCGG

[0062] S100a11-R

[0063] GATCCCGAGGCAGTAGGCAAGCTATAGCGTGCCATGATTCTTACATCTGTGGCTTC ACTAAGAATCATGGCACGCTATAGCGCGCTCACTGTCACAGCAATATACCTTC

[0064] 2. shRNA oligo annealing

[0065]

[0066]

[0067] The annealing conditions were as follows: 95°C, 75°C, 55°C, 35°C, and 15°C in a gradient decrease, and each temperature condition lasted for 10 min.

[0068] After annealing, an RNA interference fragment of the S100a11 gene with a hairpin structure (sh_S100a11) was obtained.

[0069] The nucleotide sequence of the sh_S100a11 is shown in SEQ ID NO:4.

[0070] (II) Construction of RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP

[0071] 1. Double enzyme digestion of pCDH-Lgr5-CMV-copGFP vector

[0072] The constructed pCDH-Lgr5-CMV-copGFP empty vector containing the Lgr5 gene promoter was double-digested, BamHI and XbaI were selected as restriction sites, and the cloning vector was linearized with restriction endonucleases.

[0073]

[0074] The PCR instrument was set to 37°C and the reaction was carried out for 4 hours.

[0075] The samples were run on a gel and recovered using a gel recovery kit (Tiangen). After the digestion products were recovered, the purity and concentration of the DNA were determined using a spectrophotometer.

[0076] 2. Ligate the shRNA targeting S100a11 with the linearized plasmid pCDH-Lgr5-CMV-copGFP

[0077] The shRNA annealing sequence sh_S100a11 targeting S100a11 was ligated with the enzyme-digested vector pCDH-Lgr5-CMV-copGFP and ligated with T4 ligase to obtain a recombinant plasmid, namely the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0078]

[0079] The reaction was continued at 4°C for 12 h.

[0080] 3. Transform the recombinant plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP into Escherichia coli competent cells DH5α

[0081] The ligation products were transformed into competent E. coli DH5α cells, and single colonies were selected and sent to the company for bacterial sequencing. Comparison of the designed and synthesized S100a11 interference sequence (sh_S100a11) with the sequenced sequence revealed sequence consistency, resulting in the Lgr5 promoter-regulated S100a11 gene RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP. Successfully sequenced positive bacterial cultures were used for plasmid extraction.

[0082] (III) Synthesis of recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP

[0083] 1) Add the helper plasmids PSPAX and PMD to the recombinant plasmids pCDH-Lgr5-CMV-copGFP or pCDH-Lgr5-sh_S100a11-CMV-copGFP at a volume ratio of 1:2:3 to HEK 293T cells. Refer to the instructions for lipofectamine transfection (Hanbio Biotech) for specific steps. Harvest the cell culture medium containing lentiviral particles 48 and 72 hours after addition of the transfected plasmids.

[0084] 2) Filter the viral stock solution collected in the previous step through a 0.45 μm filter and concentrate the virus by centrifugation at 72,000 × g for 2.5 hours at 4°C. Discard the supernatant and retain the viral pellet. Resuspend the viral pellet in 500 μL of pre-chilled PBS medium. Slowly shake the suspension at 150 rpm on ice for 1 hour. After pipetting and homogenizing, aliquot the suspension and store at -80°C to obtain the pCDH-Lgr5-CMV-copGFP and pCDH-Lgr5-sh_S100a11-CMV-copGFP lentiviruses.

[0085] 3) Lentiviral titer detection

[0086] The viral titer of the successfully packaged and purified lentivirus was detected by the well-by-well dilution method. According to the titer calculation formula, the viral titers of pCDH-Lgr5-sh_S100a11-CMV-copGFP and pCDH-Lgr5-CMV-copGFP were 3.5×10 10 TU / mL, 3.75×10 10 TU / mL, the lentivirus was successfully packaged and the virus titer met the requirements of subsequent experiments.

[0087] Example 2 Application of S100a11 Gene Suppression Expression Vector in Promoting Hair Regeneration (I) Establishment of Mouse Hair Regeneration Model

[0088] 1) inhalation anesthesia: using a large cotton ball dipped in ether, quickly put into a closed evaporation container, let it volatilize, then put the test mouse into the container, after 3-5 min, according to the depth of anesthesia of the animal, when the mouse is deeply anesthetized to the state of whole body flaccid, the back is shaved.

[0089] 2) using gauze dipped in sterile water to wet the fur, using a shaving push to cut the skin fur along the direction of the fur.

[0090] 3) using a brush to dip warm soapy water to soak the shaving area, carefully push and cut the remaining short hair on the back.

[0091] (II) Effect of RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP knockdown expression lentivirus on mouse hair regeneration

[0092] In order to observe the effect of specific inhibition of S100a11 expression on mouse hair regeneration, 10 8-week-old mice were randomly divided into two groups, the back was shaved, and subcutaneous injection was performed every other day in the fixed area of the mouse back skin on the day of shaving, a total of 3 times, 100 uL / injection for each mouse. The test group injected virus was the recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP prepared in Example 1, and the control group injected virus was the empty vector lentivirus containing pCDH-Lgr5-CMV-copGFP. The skin color change, pigmentation and hair regeneration on the back were observed and recorded by taking pictures every day. The results are as follows Figure 2 and Figure 3 .

[0093] From Figure 2 it can be seen that compared with the control group, the test group of mice with S100a11 knockdown had pigmentation on the back skin earlier, and entered the anagen phase of the hair follicle. The test group of mice had obvious pigmentation on the back from the 15th day to the 17th day (D15-D17), while the control group of mice had only slight changes in skin color after the 22nd day (D22). This observation result shows that inhibition of S100a11 expression accelerates the skin pigmentation process, which is an early feature of the hair follicle entering the anagen phase. Moreover, 3 days apart, the test group of mice can observe the regenerative hair protruding from the epidermis from the 18th day to the 20th day (D18-D20), indicating rapid hair growth. In contrast, the control group of mice can only observe the regenerative hair protruding from the epidermis after the 28th day (D28), indicating relatively slow hair growth. This finding suggests that inhibition of S100a11 expression promotes the conversion of the hair follicle from the telogen phase to the anagen phase and accelerates the hair regeneration process. Statistical analysis of the time when the back hair of the test group and the control group of mice enters the anagen phase shows that the hair of the test group of mice enters the anagen phase significantly earlier than that of the control group (*p<0.05,Figure 3 ), therefore, during the hair regeneration cycle in mice, specifically inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration and induce hair follicles to transition from the resting phase to the growth phase ahead of time.

[0094] (3) Paraffin sections and H&E staining

[0095] 1. Paraffin sections

[0096] 1) Four 8-week-old mice were randomly divided into two groups, with two mice in each group. Lentivirus injection was performed as described above, and dorsal skin tissue was obtained on days 17 and 25 after shaving.

[0097] 2) Spread the obtained skin sample on a plate and wash it 2-3 times with saline to remove impurities on the surface of the skin sample. Operate gently to avoid damaging the sample.

[0098] 3) Place the cleaned skin on the filter paper to allow it to absorb moisture. Flatten the skin, placing the dermis side down against the filter paper. Use ophthalmic scissors to cut the skin sample along with the filter paper. Place the cut skin sample in pre-cooled tissue fixative and fix it overnight at 4°C.

[0099] 4) The next day, discard the tissue fixative. Place the skin sample in a centrifuge tube containing 50% ethanol. Shake the sample in a shaker at 4°C for 1.5 hours to gradually remove moisture from the skin tissue, facilitating subsequent chemical processing and paraffin embedding.

[0100] 5) The skin sample was sequentially placed in centrifuge tubes containing 75%, 85%, and 95% ethanol solutions, each time shaken in a 4°C shaker for 1.5 hours to ensure that the moisture in the skin tissue was completely removed without damaging the tissue due to rapid changes in ethanol concentration.

[0101] 6) Place the skin sample in a centrifuge tube containing anhydrous ethanol and shake it in a shaker at 4°C for 30 minutes. Repeat this step once to further ensure complete dehydration of the skin tissue.

[0102] 7) The skin samples were placed in a solution of ethanol and xylene in a 1:1 ratio and then shaken on a shaker at room temperature for 30 minutes to allow for thorough mixing and penetration, making the tissue transparent and facilitating subsequent paraffin embedding.

[0103] 8) The sample was transferred into pure xylene and shaken in a shaker at room temperature for 15 minutes. This step was repeated once.

[0104] 9) After the clearing treatment, the skin sample is placed in fully liquefied paraffin wax for 6 hours. Afterwards, the wax is replaced with fresh wax and the soaking step is repeated twice to ensure that the skin tissue is fully saturated with the paraffin wax.

[0105] 10) Embed the embedded skin sample in a paraffin block. Once the paraffin has completely solidified, use a sharp knife to trim it to the desired shape and size. Precisely cut the block perpendicular to the skin into slices 15-20 μm thick.

[0106] 11) The cut wax slices are gently placed on the surface of 42°C warm water. After they are naturally flattened, they are attached with anti-slip slides to ensure that the slices are flat and free of bubbles.

[0107] 12) Place the slides containing the paraffin sections on a 42°C drying machine and dry them for 6 hours to ensure that the sections are completely fixed in preparation for subsequent microscopic observation or staining.

[0108] 2. H&E staining

[0109] 1) Paraffin sections are first placed in xylene and shaken to remove the paraffin from the sections. This step is repeated once to ensure complete removal of the paraffin.

[0110] 2) Dewaxed sections should be placed in a gradient of ethanol solutions (absolute ethanol, 95%, 85%, 75%, 50%, and 25%). Shake for 2 minutes at each concentration. This gradually removes any residual organic solvent from the sections while allowing water molecules to gradually penetrate the tissue.

[0111] 3) The sections are shaken in deionized water to further remove ethanol and other chemicals. This step is repeated once to ensure that the sections are completely rehydrated.

[0112] 4) The rehydrated sections are placed in a staining box, and hematoxylin dye is added to stain the cell nuclei. After standing for a period of time, the sections are rinsed with running water.

[0113] 5) Add hydrochloric acid ethanol to the surface of the slice to make the staining clearer and highlight the structure of the cell nucleus.

[0114] 6) Rinse again with running water to remove the hydrochloric acid and ethanol.

[0115] 7) The sections were placed in PBS solution to make the staining effect more uniform.

[0116] 8) Rinse the slices again with running water and remove PBS.

[0117] 9) Wash the sections briefly with 95% ethanol to remove excess water and residue.

[0118] 10) Add eosin dye to the slices to stain the cytoplasm.

[0119] 11) Place the slices in a histochemical cup and wash with 95% ethanol to remove excess eosin. Repeat this step once to ensure the slices are clean.

[0120] 12) The sections were treated with anhydrous ethanol and xylene to remove residual water and prepare for sealing.

[0121] 13) Add an appropriate amount of neutral resin and cover the slide. Avoid creating bubbles during this process to ensure a smooth and clear slice.

[0122] 14) Observe and analyze the structure of skin tissue under a microscope.

[0123] To further verify that inhibiting S100a11 expression can significantly and effectively promote hair regeneration, paraffin sections of the back skin of mice in the experimental and control groups were compared and analyzed at two times during the hair growth process. The results showed that on the 17th day, the hair follicles in the experimental group had an oval shape and the hair shaft had grown out of the epidermis. According to published articles, at this time, the hair follicles were at the beginning of the growth phase VI ( Figure 4 A). In the control group, the hair bulb was round, and the hair shaft did not reach the epidermis but only grew to the bulge. The hair follicle was in the growth phase III-IV ( Figure 4 B) The experimental results on the 25th day of hair growth showed that the bulb of the experimental group of hair follicles had shrunk, but still remained oval, and the hair matrix cells no longer completely wrapped the hair papilla and showed a tendency to separate. This is the end of the VI phase of the growth phase ( Figure 4 C). The morphology of the hair follicles in the control group at this time is similar to that of the hair follicles in the experimental group on the 17th day, having just entered the beginning of the VI phase of the hair growth phase ( Figure 4 D) The above results indicate that hair follicles in the experimental group entered the anagen phase earlier than those in the control group. Specifically inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration and induce hair follicles to transition from the resting phase to the anagen phase earlier.

[0124] It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed. The above is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements and improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application. The above is only a preferred embodiment of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and variations can be made without departing from the technical principles of the present application. These improvements and variations should also be regarded as the scope of protection of the present application.

Claims

1. Use of an S100a11 inhibitor in the preparation of a medicament for treating hair regeneration disorders and / or promoting hair regeneration, the S100a11 inhibitor comprising: S100a11 gene RNA interference fragment, RNAi vector containing S100a11 gene RNA interference fragment, or lentivirus containing RNAi vector containing S100a11 gene RNA interference fragment; wherein, The S100a11 gene RNA interference fragment is the S100a11 gene RNA interference fragment sh_S100a11 whose nucleotide sequence is shown in SEQ ID NO:

4.

2. The use according to claim 1, characterized in that The RNAi vector containing the S100a11 gene RNA interference fragment is the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP whose nucleotide sequence is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that The S100a11 gene RNA interference fragment sh_S100a11 has a hairpin structure, and the construction method includes: A specific shRNA was designed for the mouse S100a11 gene, resulting in an upstream sequence S100a11-F having a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R having a nucleotide sequence as shown in SEQ ID NO:7; The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 whose nucleotide sequence is shown in SEQ ID NO:

4.

4. The use according to claim 1, characterized in that The RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is constructed by connecting the S100a11 gene RNA interference fragment sh_S100a11, whose nucleotide sequence is shown in SEQ ID NO: 4, to the expression vector pCDH-Lgr5-CMV-copGFP to obtain the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

5. The use according to claim 1, characterized in that The lentivirus containing the RNAi vector of the S100a11 gene RNA interference fragment is obtained by transfecting the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP into tool cells.

6. The use according to claim 5, characterized in that The tool cells are HEK 293T cells.

7. The use according to claim 5 or 6, characterized in that The lentivirus regulates the RNAi vector through the Lgr5 promoter to inhibit the expression of the S100a11 gene.