Application of neurogranulin inhibitor in preparation of medicine for treating nerve injury related diseases

Abstract

The invention discloses an application of a neurogranulin (Neurogranin, Nrgn) inhibitor in preparation of a medicine for treating diseases related to nerve injury. The research shows that the neuron siRNA interferes with the expression of Nrgn in fetal rat cortical neurons of pregnant 18d SD rats, and regeneration and growth of neurons can be remarkably promoted. The medicine clomastine or the JNK inhibitor BI-78D3 is used, so that Nrgn can be inhibited, and the growth of cortical neurons is remarkably promoted. The behavioral detection shows that the error rate of an irregular level ladder can be reduced by inhibiting the Nrgn by adopting the adeno-associated virus AAV2 / 8-Syn-chr2-mCherry-miR30-shRNA, and the BBB experiment, the catwalk experiment and the TSE fine movement system analysis result also show that the inhibition of the Nrgn can promote the recovery of the fine movement of the posterior limbs of the rat after spinal cord injury. Spinal cord electrophysiological detection shows that the nerve conduction capability is promoted by inhibiting Nrgn. According to the invention, Nrgn is taken as a target spot, so that a new possibility is provided for research and development of drugs for treating nerve injury.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to the application of neurogranin inhibitors in the preparation of medicines for treating diseases related to nerve damage. Background Art

[0002] The repair of nerve damage has increasingly become a clinical problem faced by countries around the world. Frequent natural disasters and traffic accidents can easily cause central and peripheral nerve damage. It is very difficult to repair the central nervous system of adult mammals after damage, and the vast majority of neurons cannot regenerate axons, often leading to persistent neurological dysfunction. Compared with the peripheral nervous system, the regeneration of the central nervous system is more difficult. This is because the central nervous system lacks intrinsic regenerative capacity and has more regeneration inhibitory molecules than peripheral nerve damage.

[0003] Spinal cord injury (SCI) seriously damages the central nervous system and is the most serious complication of spinal cord injury, often leading to severe functional impairment of the limbs below the injured segment. Spinal cord injury not only causes serious physical and psychological harm to the patient himself, but also imposes a huge economic burden on the entire society. However, there are limited treatments to promote spinal cord regeneration. Therefore, exploring the mechanism of healing after SCI and finding new treatments have important social significance for the treatment of SCI.

[0004] Many studies have shown that thyroid hormones promote recovery after brain injury and accelerate the recovery of the sciatic nerve, but at the same time, some articles have also proved that thyroid hormones inhibit heart regeneration and may potentially participate in the development of the central nervous system. We systematically compared the expression profiles of group 0 and group 4 pyramidal neurons (upper motor neurons) that cannot regenerate axons after spinal cord injury and anterior horn motor neurons (lower motor neurons) that can regenerate axons after sciatic nerve injury, and found that neurogranin (Nrgn), a target of the thyroid pathway, is a significantly different gene, which is differentially expressed in the sequencing of cortical upper motor neurons and spinal lower motor neurons. Therefore, it is speculated whether inhibiting the expression of Nrgn can promote neuronal regeneration and enhance the ability of neurons to pass through the injury scar area after spinal cord injury.

[0005] Nrgn, also known as neurogranin, is a brain-specific protein and a direct target of the thyroid hormone pathway. It is mainly distributed in the postsynaptic regions of the cerebral cortex, hippocampus, and olfactory bulb of humans or animals. As a member of the Calpac itin protein family, Nrgn is a natural substrate of protein kinase C and a reservoir of calmodulin (CaM). Nrgn may play an important role in physiological changes such as learning, memory, and nervous system development (plasticity). At the same time, it may also be involved in changes in nervous system function caused by pathophysiological changes such as hypothyroidism, sleep deprivation, aging, and brain hypoxia preadaptation. At present, most of the research on Nrgn is in the field of mental illnesses such as schizophrenia and bipolar disorder. A small number of studies have studied its effects on brain damage and thyroid hormones, and its function in neural regeneration is still unclear. Summary of the invention

[0006] The present invention uses spatial transcriptome sequencing and single-cell sequencing to characterize the changes in cells and genes in the cerebral cortex at different time points after hemisection of the spinal cord, and finds that (Neurogranin, Nrgn) is expressed more in upper motor neurons than in lower motor neurons. Further experiments have shown that inhibiting Nrgn can promote the growth of neurons and promote the recovery of fine motor movements in the hind limbs of rats after spinal cord injury. The present invention provides new possibilities for the development of drugs for treating nerve damage.

[0007] The specific technical solutions of the present invention are as follows:

[0008] Application of neurogranin inhibitors in the preparation of drugs for treating nerve damage.

[0009] The neurogranin inhibitor of the present invention is a substance that inhibits neurogranin or its gene expression, and is selected from one or more of compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, and nucleic acids.

[0010] In a specific example of the present invention, the substance that inhibits neurogranin gene expression is Clemastine fumarate (Selleck, catalog number s1847), CAS: 14976-57-9, or JNK inhibitor BI-78D3 (Selleck, catalog number s8201), CAS: 883065-90-5.

[0011] In a specific example of the present invention, the substance that inhibits neurogranin gene expression is Nrgn siRNA and / or vector-based shRNA.

[0012] In a preferred embodiment, the siRNA sequence is as follows:

[0013] si-Nrgn-1:

[0014] Sense strand: 5′-GACAAGACTTCCCTACTGT-3′, SEQ ID No: 1.

[0015] Antisense strand: 5'-CTGTTCTGAAGGGATGACA-3', SEQ ID No: 2.

[0016] si-Nrgn-2:

[0017] Sense strand: 5′-CCTAACCTCAACCTCCTAA-3′, SEQ ID No: 3.

[0018] Antisense strand: 5'-GGATTGGAGTTGGAGGATT-3', SEQ ID No:4.

[0019] si-Nrgn-3:

[0020] Sense strand: 5′-ACATGGCGAGGAAGAAGAT-3′, SEQ ID No:5.

[0021] Antisense strand: 5'-TGTACCGCTCCTTCTTCTA-3', SEQ ID No:6.

[0022] The shRNA comprises a sense strand segment and an antisense strand segment and a stem-loop structure connecting the sense strand segment and the antisense strand segment. Preferably, the stem-loop structure sequence is: 5'-TACATCTGTGGCTTCACTA-3'.

[0023] shRNA-1 contains a stem-loop structure sequence:

[0024] 5'-AGTGACAAGACTTCCCTACTGTTACATCTGTGGCTTCACTAACAGTAGGGAAGTCTTG TCACG-3', SEQ ID No: 7.

[0025] shRNA-2 contains a stem-loop structure sequence:

[0026] 5'-ACATGGCGAGGAAGAAGATAAATACATCTGTGGCTTCACTATTTATCTTCTTCCTCGCC ATGG-3', SEQ ID No: 8.

[0027] shRNA-3 contains a stem-loop structure sequence:

[0028] 5'-CTCCAAGCCAGACGACGATATTTACATCTGTGGCTTCACTAAATATCGTCGTCTGGCTT GGAT-3', SEQ ID No: 9.

[0029] shRNA-4 contains a stem-loop structure sequence:

[0030] 5'-CTCCCGCTCTCCTTTGTTTATGTACATCTGTGGCTTCACTACATAAACAAAGGAGAGC GGGAT-3', SEQ ID No: 10.

[0031] In a specific example of the present invention, the drug is an injectable preparation.

[0032] In the application of the present invention, the nerve injury is central nervous system injury, further spinal cord injury. In a specific example of the present invention, the injury is right hemisection of the thoracic spinal cord segment T10.

[0033] Advantages of the present invention:

[0034] The present invention uses Nrgn as a molecular intervention target, and inhibits Nrgn by using and targeting drugs Clemastinefuma rate (s1847) and BI-78D3 (s8201) that inhibit Nrgn, thereby promoting the growth of neurons. In vitro experiments use small interfering RNA (siRNA) to inhibit the expression of Nrgn, which promotes the growth and regeneration of cortical neurons in E18d. Adeno-associated virus-infected cells are used to inhibit the expression of Nrgn, thereby reducing the error rate of irregular horizontal ladders in the hind limbs of rats after spinal cord injury. Behavioral tests have found that inhibiting Nrgn can reduce the error rate of irregular horizontal ladders, and BBB experiments, catwalk experiments and TSE fine motor system analysis also show that inhibiting Nrgn promotes the recovery of fine motor in the hind limbs of rats after spinal cord injury. Spinal cord electrophysiological testing found that inhibiting Nrgn promoted nerve conduction ability. The present invention uses Nrgn as a target to provide new possibilities for the development of drugs for treating nerve damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1The results of using siRNA to inhibit Nrgn in vitro to promote the growth of cortical neurons. (A shows the length of axons of cells after dispersed culture transfection with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3. Inhibition of nrgn promoted the growth of cortical neurons; bar = 5 μm. B is a comparison of the total length of axons of 100 cells in each group. *** vs. si-Nc, p = 0.0002; **** vs. si-Nc, p < 0.0001. C is a comparison of the longest axon length of 100 cells in each group. *** vs. si-Nc, p = 0.0006; **** vs. si-Nc, p < 0.0001).

[0036] Figure 2 This is the in vitro use of siRNA to inhibit Nrgn to promote the regeneration of cortical neurons. (A is a comparison of the total length of axons of 100 cells in each group. *vs.si-Nc, p=0.0249. B is a comparison of the longest axon length of 100 cells in each group. **vs.si-Nc, p=0.0069; ****vs.si-Nc, p<0.0001. C is a display of the axon length of cells resuspended and cultured for 1 day after transfection with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3, and inhibition of Nrgn promotes the regeneration of cortical neurons after resuspension; bar=10μm).

[0037] Figure 3 This is the in vitro use of microfluidics to inhibit the use of siRNA to promote the regeneration of cortical neurons. (A is a display of the microfluidic model. B is a display of the axon length of cells transplanted with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3 implanted in microfluidic culture after 1 day of detachment, inhibiting Nrgn to promote the regeneration of cortical neurons; bar = 100μm. C is a comparison of the total length of the axon length of 150 cells in each group. **** vs. si-Nc, p < 0.0001).

[0038] Figure 4To observe the regenerating axons by viral anterograde labeling after Nrgn inhibition in vivo. (A is brain immunohistochemical staining showing that Nrgn is localized in the fifth layer of the rat cerebral cortex. bar=20μm. B is a hand-drawn schematic diagram of brain stereotaxic. C is a section of brain tissue with mcherry fluorescence 21 days after virus injection. bar=2000μm. (Control group: AAV 2 / 9-syn-chr2-mCherry virus, experimental group: AAV2 / 8-Syn-chr2-mCherry-miR30-shRNA virus). D is the result of immunohistochemical staining after frozen section of brain tissue. It shows that Nrgn (green) is inhibited by infection in the virus (red) injection area, and dark blue DAPI is the cell nucleus; bar=100μm. Immunohistochemical image of the spinal cord after ESCI 21 days. The number of axons of cells (red) infected by the virus passing through the spinal cord injury scar area increased significantly. Dark blue DAPI is the cell nucleus. The spinal cord injury area display bar=100μm, the local enlarged image bar=50μm).

[0039] Figure 5 The inhibition of Nrgn in vivo promotes the recovery of hind limb motor function in rats after SCI. (A is the BBB score. At 7d and 14d, the recovery of the experimental group was significantly better than that of the control group, with significant differences. *vs. Negative Control, p<0.05, **vs. Negative Control, p<0.01. B is the result of the horizontal ladder test. The error rate of the hemisection rats with Nrgn inhibition was lower than that of the control group at the same test level, and the trend became more obvious over time, but there is no medically significant difference at present. C is the display of catwalk footstep pressure recovery at 21d; inhibition of Nrgn promotes the recovery of steps after SCI. *vs. Negative Control, p<0.05. D is the result of the TSE experiment. The angle change of the rats in the Nrgn inhibition group was better than that of the control group 21d after spinal cord injury. ***vs. Negative Control, p<0.001. E is the stick trajectory diagram of the right posterior side of the TSE experimental group and the control group at the right pelvis, right hip, right hind knee, right hind ankle and right hind foot instep. F is the catwalk footstep pressure and coordination display diagram at 21 days. G is the catwalk coordination statistical result. The figure shows that over time, the coordination recovery of the experimental group is better than that of the control group, and it is significant at 14 days. *vs. Negative Control, p<0.005).

[0040] Figure 6The results show that inhibition of Nrgn in vivo promotes the recovery of spinal nerve conduction ability in rats after SCI. (A is the electrophysiological diagram of the Negative Control group, Blank Control group and Nrgn shRNA group. Compared with the Negative Control group, the nerve conduction ability of the Nrgn shR NA group is enhanced. B is the C MAP amplitude of the Negative Control group, Blank Control group and Nrgn shRNA group. Compared with the rats injected with the control virus, the CMAP amplitude of the rats injected with the Nrgn shRNA virus increased, indicating that inhibition of NRGN expression promotes nerve conduction ability. *vs. Negative Control, p<0.05, **vs. Negative Control, p<0.01).

[0041] Figure 7 This is a virtual screening of FDA-approved drug libraries and 25w highly bioactive compound libraries using AI. (A is a flowchart of high-throughput drug screening using AI. B is a schematic diagram of molecular docking of two drugs with Nrgn).

[0042] Figure 8 The toxicity of drugs that target and inhibit Nrgn on cortical neurons in vitro. (A is the cell viability of cortical neurons treated with Clemastinefumarate (CF) for 72 hours. B is the cell viability of cortical neurons treated with BI-78D3 for 72 hours).

[0043] Fig. 9 The optimal concentration of Clemastine fumarate (CF) and BI-78D3 promotes the regeneration of cortical neuron axons in vitro. (A is the immunohistochemical staining of cortical neurons treated with Clemastine fumarate (CF) and BI-78D3 for 72 hours and then resuspended and cultured for 15 hours, bar is 75μm. B is the statistics of the total length and the longest length of axons of cortical neurons after resuspension at the optimal drug concentration of Clemastine fumarate (CF) and BI-78D3. Data represent mean ± SEM, *P < 0.05, **P < 0.001, ***P < 0.005, ****P < 0.0001 vs control). DETAILED DESCRIPTION

[0044] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments, but the embodiments cannot be understood as any limitation to the present invention. The protection scope of the present invention is subject to the claims. Unless otherwise specified, the following embodiments are all completed using conventional existing technologies.

[0045] The siRNA design and synthesis was completed by Guangzhou Ruibo Biotechnology Co., Ltd.: the full-length sequence of rat Nrgn mRNA (NM_00126181.2) was obtained from the National Center for Biotechnology Information (NCBI) database of the United States. According to the RNAi principle and combined with the design software, three candidate siRNAs targeting rat Nrgn mRNA gene transcripts were designed. After BLAST comparison, they were checked to ensure that there was no homology with other genes, and then chemically synthesized.

[0046] The information of the three candidate siRNAs is as follows:

[0047] si-Nrgn-1:

[0048] Sense strand: 5′-GACAAGACTTCCCTACTGT-3′.

[0049] Antisense strand: 5′-CTGTTCTGAAGGGATGACA-3′.

[0050] si-Nrgn-2:

[0051] Sense strand: 5′-CCTAACCTCAACCTCCTAA-3′.

[0052] Antisense strand: 5'-GGATTGGAGTTGGAGGATT-3'.

[0053] si-Nrgn-3:

[0054] Sense strand: 5′-ACATGGCGAGGAAGAAGAT-3′.

[0055] Antisense strand: 5′-TGTACCGCTCCTTCTTCTA-3′.

[0056] Example 1 In vitro use of siRNA to inhibit Nrgn and promote the growth of cortical neurons

[0057] 1. Statistical analysis of axon length in dispersed culture:

[0058] 1) Anesthesia: 18-day pregnant SD rats were anesthetized with reanaesthesia, and the abdomen of the pregnant rats was thoroughly disinfected with 75% alcohol.

[0059] 2) Sampling: Under a stereomicroscope, the cerebral cortex of a fetus from an 18-day gestational age SD rat was collected and placed in a medium dish containing dissecting fluid.

[0060] 3) Digestion: After washing the cortex with PBS several times, add 2 ml of trypsin to a medium dish and digest for 15 minutes, pipetting thoroughly every 5 minutes.

[0061] 4) Termination of digestion: Terminate the digestion with 6 ml DMEM (DMEM basal medium + 10% FBS + 1% PS) and pipette thoroughly.

[0062] 5) Filtration: Filter with a 0.22 μm cell strainer.

[0063] 6) Centrifugation: centrifuge at 1200 rpm for 5 minutes at room temperature. After centrifugation, discard the supernatant, resuspend the precipitate, count with a cell counting plate, and then seed.

[0064] 7) Transfection: After centrifugation, discard the supernatant, resuspend the precipitate, count the cells using a cell counting plate, and then seed the cells into a 24-well plate containing transfection reagents with different siRNAs (refer to the instructions for transfection reagents from Guangzhou Ruibo Biotechnology Co., Ltd. for transfection).

[0065] 8) Change medium: 12 to 16 hours after transfection, change to NB + Culture medium (NB basal medium + 2% B27 + 1% Glu + 1% PS).

[0066] 9) Statistics: After 48 h of culture, the dispersed cultured cells were subjected to immunohistochemical staining to count the axon length; the knockdown efficiency was tested after RNA was collected from the cells.

[0067] 2. Experimental Results

[0068] The results of the dispersed culture experiment are as follows Figure 1 As shown, A is a display of the axon length of cells after dispersed culture transfection with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3. Inhibition of Nrgn promotes the axon growth of cortical neurons; bar = 5 μm. B is a comparison of the total length after the axon length of 100 cells in each group is counted. ***vs.si-Nc, p = 0.0002; ****vs.si-Nc, p < 0.0001. C is the longest comparison after the axon length of 100 cells in each group is counted. ***vs.si-Nc, p = 0.0006; ****vs.si-Nc, p < 0.0001. The results show that the use of small interfering RNA to inhibit Nrgn can promote the axon growth of cortical neurons.

[0069] Example 2 In vitro use of siRNA to inhibit Nrgn and promote the regeneration of cortical neurons

[0070] 1. Counting axon length after cell resuspension

[0071] The operations of steps 1) to 8) are the same as those of steps 1) to 8) of Example 1.

[0072] 9) Resuspension: After culturing for 48 hours, the resuspended cells were digested with 0.25% trypsin and then resuspended and seeded into a new 24-well plate.

[0073] 10) Statistics: After 24 days of culture, the cultured cells were resuspended for immunohistochemical staining and the axon length was counted.

[0074] 2. Experimental Results

[0075] The results of the resuspended cell culture experiment are as follows Figure 2 As shown, A is a comparison of the total length of the axon length of 100 cells in each group. *vs.si-Nc, p=0.0249. B is a comparison of the longest axon length of 100 cells in each group. **vs.si-Nc, p=0.0069; ****vs.si-Nc, p<0.0001. C is a display of the axon length of cells resuspended and cultured for 1 day after transfection with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3, and the regeneration of cortical neurons was promoted after inhibition of Nrgn; bar=10μm. The results show that the inhibition of Nrgn using small interfering RNA can promote the regeneration of axons of cortical neurons.

[0076] Example 3 In vitro microfluidics using siRNA to inhibit Nrgn and promote the regeneration of cortical neurons

[0077] 1. Microfluidics to Count Cell Axon Length

[0078] The operations of steps 1) to 6) are the same as those of steps 1) to 6) of Example 1.

[0079] 7) Cultivation: After centrifugation, discard the supernatant, resuspend the precipitate, count it with a cell counting plate, and then plant it in the microfluidics. Cultivate for 3-4 days and observe the length of the axon passing through the ladder.

[0080] 8) Transfection: When the axons grow beyond the ladder, use NB - The culture medium (NB base medium + 2% B27 + 1% Glu) was added with transfection reagent to transfect siRNA.

[0081] 9) Change medium: Change to NB after 12-16 hours + Culture medium.

[0082] 10) Statistics: After 24 days of culture, the cultured cells were resuspended for immunohistochemical staining and the axon length was counted.

[0083] 11) Disconnection: After 48 hours of culture, the axons were disconnected using a pressure pump.

[0084] 12) Statistics: After 24 days of culture, the cells in the microfluidics were subjected to immunohistochemical staining and the axon length was counted.

[0085] 2. Experimental results:

[0086] Microfluidic culture experiment results Figure 3 As shown, A is a display diagram of the microfluidic model. B is a display of the axon length of cells implanted in microfluidic culture transfected with si-nc, si-Nrgn-1, si-Nrgn-2, and si-Nrgn-3 after 1 day of detachment. Inhibition of Nrgn promotes the regeneration of cortical neurons; bar = 100 μm. C is a comparison diagram of the total length after the axon length of 150 cells in each group was counted. **** vs. si-Nc, p < 0.0001. The results show that the use of small interfering RNA to inhibit Nrgn can promote the regeneration of axons of cortical neurons.

[0087] Example 4 Observation of regenerated axons by viral anterograde labeling after Nrgn inhibition in vivo

[0088] 1. Stereotaxic injection of adenovirus into the brain of 5- to 6-week-old SD rats (hand-drawn diagram of stereotaxic injection of adenovirus into the brain is shown in the figure) Figure 4 B)

[0089] 1) Anesthesia: Rats were anesthetized by intraperitoneal injection of resedative anesthesia at a dose of 0.35 ml / 100 g to ensure that they were completely sedated and painless throughout the procedure.

[0090] 2) Positioning: Place the rat in a stereotaxic apparatus and use ear bars and dental bars to fix the head to prevent movement. The skull should be kept level between the anterior and posterior bregma for accurate positioning.

[0091] 3) Incision and exposure: Under a surgical microscope, make an incision along the midline of the scalp to expose the skull. Identify the bregma or another anatomical landmark as a reference point for calculating the injection coordinates. Drill the skull in the stereotaxic area with a cranial drill to expose the left cerebral cortex area of ​​the rat, being careful to avoid damaging the underlying brain tissue.

[0092] 4) Needle insertion: Attach the glass electrode to the stereotaxic arm and lower the needle to the desired depth according to the stereotaxic atlas coordinates. Wait several minutes to minimize tissue damage and allow pressure to equilibrate.

[0093] 5) Injection of virus: Determine the injection site, absorb the virus with a capillary glass electrode, and slowly inject the substance within a few minutes to ensure diffusion into the brain tissue. The injection volume and injection speed are adjusted according to the experimental requirements and the size of the target area. The control group was injected with AAV 2 / 9-syn-chr2-mCherry virus control, and the experimental group was injected with AAV2 / 8-Syn-chr2-mCherry-miR30-shRNA virus. The viruses used were packaged by Yunzhou Biotechnology Co., Ltd. (Guangzhou). The shRNA sequences selected for packaging AAV viruses are as follows:

[0094] Stem-loop structure sequence: 5'-TACATCTGTGGCTTCACTA-3'.

[0095] shRNA-1 contains a stem-loop structure sequence

[0096] 5'-AGTGACAAGACTTCCCTACTGTTACATCTGTGGCTTCACTAACAGTAGGGAAGTCTTG TCACG-3'

[0097] shRNA-2 contains a stem-loop structure sequence

[0098] 5'-ACATGGCGAGGAAGAAGATAAATACATCTGTGGCTTCACTATTTATCTTCTTCCTCGCC ATGG-3'

[0099] shRNA-3 contains a stem-loop structure sequence

[0100] 5'-CTCCAAGCCAGACGACGATATTTACATCTGTGGCTTCACTAAATATCGTCGTCTGGCTT GGAT-3'

[0101] shRNA-4 contains a stem-loop structure sequence

[0102] 5'-CTCCCGCTCTCCTTTGTTTTATGTACATCTGTGGCTTCACTACATAAACAAAGGAGAGC GGGAT-3'.

[0103] 6) Needle withdrawal: After injection, leave the needle in place for 5 minutes to allow the substance to diffuse and prevent backflow along the injection tract. Then, slowly withdraw the needle to minimize disturbance of brain tissue.

[0104] 7) Hemostasis and closure: After gently cleaning the area around the surgical site with a cotton swab, add hemostatic drugs and carefully suture the muscle and skin layers of the injured area.

[0105] 8) Postoperative Care: Monitor the rats for any signs of discomfort, infection, or complications. Provide analgesics for pain management according to the approved protocol. Ensure that the rats have access to water and food. All animal experiments were performed in accordance with the animal care guidelines and were ethically approved by the Jiangsu Provincial Laboratory Animal Management Committee. The animal experiment license is 220227903.

[0106] 2. Twenty-one days after virus injection, the right hemisection model of the spinal cord T10 of 8- to 9-week-old SD rats injected with adenovirus was established

[0107] 1) Anesthesia: Rats were anesthetized by intraperitoneal injection of resedative anesthesia at a dose of 0.35 ml / 100 g to ensure that they were completely sedated and painless throughout the procedure.

[0108] 2) Surgical preparation: The surgical area around the T10 vertebra was shaved and disinfected. The rat was placed prone on a sterile surgical platform.

[0109] 3) Incision and exposure: Under an operating microscope, a midline skin incision was made above the thoracic spine to expose the anterior edge of the T10 vertebra.

[0110] 4) Hemisection: Carefully perform a right hemisection of the spinal cord using a fine scalpel. Cut the blade vertically into the dorsal side of the spinal cord at T10. The cut should be as precise as possible to ensure that only the right half of the spinal cord is completely damaged, while the left half is preserved.

[0111] 5) Hemostasis and closure: Control bleeding by applying gentle pressure to the surgical site using a cotton swab. Carefully suture the muscle and skin layers of the injured area.

[0112] 6) Postoperative care

[0113] Monitor the rats for any signs of discomfort, infection, or complications. Provide analgesics for pain management according to the approved protocol. Ensure that the rats have access to water and food. All animal experiments were performed in accordance with the animal care guidelines and were ethically approved by the Jiangsu Provincial Laboratory Animal Management Committee with animal experiment license number 220227903.

[0114] 3. Observation of tissue autofluorescence after virus injection

[0115] SD rats were fixed by perfusion with 4% paraformaldehyde, and the brain and spinal cord tissues were removed. They were dehydrated with 30% sucrose solution, and then embedded in OCT for frozen sections. The sections were protected from light and the thickness was 12 μm. The cut tissues were directly rinsed with 0.01M PBS solution for 3 times, 1 min / time, and sealed with an appropriate amount of anti-fluorescence quenching sealing solution (containing DAPI) (Biyuntian, P0131-25ml), and observed and photographed under a ZEISS upright fluorescence microscope ( Figure 4 C).

[0116] IV. Immunofluorescence staining

[0117] SD rats were fixed by perfusion with 4% paraformaldehyde, and the brain and spinal cord tissues were removed. They were dehydrated with 30% sucrose solution, and then embedded in OCT for frozen sections. The thickness of the sections was 12 μm. The sections were rinsed with 0.01M PBS solution for 3 times, 10 min / time, and PBST (PBS containing 0.5% Triton X-100) was used to break the membrane at room temperature for 15 min. The tissues were circled in a circle with a tissue pen, and about 200 μl of immunostaining blocking solution (Biyuntian, P0102) was added and blocked at room temperature for 1 hour. The primary antibody: mcherry (Chicken, 1:1000, abcam) was incubated at 4°C overnight. The sections were rinsed with 0.01M PBS solution for 3 times, 10 min / time, and the secondary antibody: Alexa Fluor647-donkey anti-chicken (1:500, invitrogen) was incubated at room temperature for 2 hours. The sections were rinsed with 0.01M PBS solution for 3 times, 10 min / time. After adding an appropriate amount of anti-fluorescence quenching sealing solution (including DAPI) (Biyuntian, P0131-25ml), the slides were sealed and observed and photographed under a ZEISS upright fluorescence microscope.

[0118] V. Experimental results:

[0119] Immunohistochemistry ( Figure 4 A, 4D, 4E) The results showed that by injecting AAV2 / 8-Syn-chr2-mCherry-miR30-shRNA adenovirus into the M1 region, it was confirmed that the virus injection in the brain was successful, and the inhibition of Nrgn after injury in the spinal cord promoted axons to pass through the scar area and promoted the recovery of spinal cord hemisection injury.

[0120] Example 5 Inhibition of Nrgn in vivo promotes recovery of hindlimb motor function in rats after SCI

[0121] 1. Stereotaxic injection of adenovirus into the brain of 5- to 6-week-old SD rats

[0122] The method is the same as Example 4.

[0123] 2. The right hemisection model of the spinal cord T10 of 8-9 week old SD rats injected with adenovirus

[0124] The method is the same as Example 4.

[0125] 3. Behavioral Tests and Statistics

[0126] After SCI, rats were subjected to BBB score, catwalk test, and horizontal ladder test at 3, 7, 14, and 21 days. Two personnel who were unaware of the experimental conditions performed behavioral statistics. TSE test was performed on the 21st day.

[0127] IV. Experimental Results

[0128] The results are as follows Figure 5 As shown, A is the BBB score. At 7d and 14d, the recovery of the experimental group was significantly better than that of the control group, with significant differences. *vs.Negative Control, p<0.05, **vs.Negative Control, p<0.01. B is the result of the horizontal ladder test. The error rate of the hemisection rats with Nrgn inhibition was lower than that of the control group at the same test level, and the trend became more obvious over time, but there was no medically significant difference at present. C is the display of catwalk footstep pressure recovery at 21d; Nrgn inhibition promotes the recovery of steps after SCI. *vs.Negative Control, p<0.05. D is the result of the TSE experiment. The angle change of the rats in the Nrgn inhibition group was better than that of the control group 21d after spinal cord injury. ***vs.Negative Control, p<0.001. E is the stick trajectory diagram of the right posterior side of the TSE experimental group and the control group at five points: the right pelvis, right hip, right hind knee, right hind ankle, and right hind foot instep. F is the catwalk footstep pressure and coordination display diagram at 21 days. G is the catwalk coordination statistical results. The figure shows that over time, the coordination recovery of the experimental group is better than that of the control group, and it is significant at 14 days. *vs. Negative Control, p<0.005). Behavioral results show that inhibiting Nr gn can reduce the error rate of irregular horizontal ladders ( Figure 5 B), BBB score ( Figure 5 A) catwalk experiment Figure 5 C, 5F, 5G), TSE fine motor system analysis also showed that inhibition of Nrgn promoted the recovery of fine motor skills in the hind limbs of rats after spinal cord injury ( Figure 5 D, 5E).

[0129] Example 6 Inhibition of Nrgn in vivo promotes recovery of spinal nerve conduction ability in rats after SCI

[0130] 1. Stereotaxic injection of adenovirus into the brain of 5- to 6-week-old SD rats

[0131] The method is the same as Example 4.

[0132] 2. The right hemisection model of the spinal cord T10 of 8-9 week old SD rats injected with adenovirus

[0133] The method is the same as Example 4.

[0134] 3. In vivo motor evoked potential EMG recording

[0135] On the 21st day, the rats were anesthetized by intraperitoneal injection of 0.35 ml / 100 g of complex anesthesia, and the hair of the hind limbs and spine of the rats was shaved. The rats were fixed on the operating table, the T7-T8 vertebral plate was opened, and the stimulating electrode was placed on the spinal cord. The recording electrode was punctured into the gastrocnemius muscle through subcutaneous routing, and the electrode was fixed for EMG recording.

[0136] IV. Experimental Results

[0137] Spinal cord electrophysiological testing revealed that inhibition of Nrgn promoted nerve conduction compared with the control group ( Figure 6 , A is the electrophysiological diagram of the Negative Control group, Blank Control group and Nrgn shRNA group. Compared with the Negative Control group, the nerve conduction ability of the Nrgn shRNA group was enhanced. B is the CMAP amplitude of the Negative Control group, Blank Control group and NrgnshRNA group. Compared with the rats injected with the control virus, the CMAP amplitude of the rats injected with the Nrgn shRNA virus increased, indicating that inhibiting the expression of NRGN promoted the nerve conduction ability. *vs.Negative Con trol, p<0.05, **vs.Negative Control, p<0.01).

[0138] Example 7: Virtual screening using AI from FDA-approved drug library and 25w highly bioactive compound library

[0139] 1. Screening process:

[0140] 1. Target identification and validation: After determining the specific biological target, use genomics, proteomics and bioinformatics tools to identify the target.

[0141] 2. Compound library preparation: Establish a compound library for screening. The compound library can contain both small molecules and biological molecules such as peptides.

[0142] 3. High-throughput screening (HTS): Use automated robotic systems to perform assays to measure the binding affinity or biological activity of compounds to targets and rapidly evaluate the interaction between targets and compounds in the library. Algorithms used in computational models are used to predict compound-protein binding affinity and prioritize candidates.

[0143] 4. Hit identification and validation: Hits are selected based on their activity in HTS analysis. These hits are then validated through secondary analysis and more rigorous testing, involving dose-response studies and cross-validation of different assay types, to identify ‘hits’—compo unds that show desired activity against the target.

[0144] 5. Lead optimization: Modify hit compounds using structure-activity relationship (SAR) studies and AI-driven modeling. Techniques such as molecular docking and simulation can help predict the effects of chemical modifications. Optimize the chemical properties of hits to improve their efficacy, selectivity, and pharmacokinetic properties.

[0145] 6. Computer screening and ADMET prediction: Computer tools that combine artificial intelligence and machine learning are often used to calculate models to predict the absorption, distribution, metabolism, excretion, and toxicity (ADMET) properties of lead compounds and filter out compounds with unfavorable ADM ET spectra.

[0146] 7. In vitro and in vivo tests: Verify the biological activity and safety of lead compounds through cell experiments and animal models.

[0147] 8. Preclinical development: Preparation of lead compounds with clinical application prospects.

[0148] 2. Experimental Results

[0149] Ten drugs that have entered clinical trials and can pass the blood-brain barrier were screened, and molecular docking maps of two of them were drawn ( Figure 7 B).

[0150] Example 8 Verification of the toxicity of the drugs Clemastine fumarate (CF) and BI-78D3, which target and inhibit Nrgn, on cortical neurons in vitro

[0151] 1. Verification of drug administration after sampling cortical neurons

[0152] 1) Anesthesia: 18-day pregnant SD rats were anesthetized with reanaesthesia, and the abdomen of the pregnant rats was thoroughly disinfected with 75% alcohol.

[0153] 2) Sampling: Under a stereomicroscope, the cerebral cortex of a fetus from an 18-day gestational age SD rat was collected and placed in a medium dish containing dissecting fluid.

[0154] 3) Digestion: After washing the cortex with PBS several times, add 2 ml of trypsin to a medium dish and digest for 15 minutes, pipetting thoroughly every 5 minutes.

[0155] 4) Termination of digestion: Terminate the digestion with 6 ml DMEM (DMEM basal medium + 10% FBS + 1% PS) and pipette thoroughly.

[0156] 5) Filtration: Filter with a 0.22 μm cell strainer.

[0157] 6) Centrifugation: centrifuge at 1200 rpm for 5 minutes at room temperature. After centrifugation, discard the supernatant, resuspend the precipitate, count with a cell counting plate, and then seed.

[0158] 7) Drug addition: Different concentrations of Clemastine fumarate (CF) or BI-78D3 were added to a 96-well plate and the cells were cultured for 3 days.

[0159] 8) CCK8: culture medium and CCK8:9:1 were added to 96-well plates and incubated at 37° for 4 h.

[0160] 9) Detect absorbance: Use Bio-Tek automatic microplate reader to detect absorbance at 450 nm.

[0161] 10) Statistics: The cell viability was calculated as the percentage of CCK-8 absorbance using the formula: [(drug-treated sample absorbance - blank) / (control sample absorbance - blank)]×100%.

[0162] 2. Experimental Results

[0163] The results are as follows Figure 8 As shown, A is the cell viability of cortical neurons after 72 hours of treatment with Clemastine fumarate (CF). B is the cell viability of cortical neurons after 72 hours of treatment with BI-78D3. The CCK8 experiment tested the optimal drug concentration of the drug, paving the way for the next experiment.

[0164] Example 9 Verification of the effect of Clemastine fumarate (CF) and BI-78D3 at the optimal concentration on the regeneration of cortical neurons after axonal axotomy in vitro

[0165] 1. Verification of drug administration after sampling cortical neurons

[0166] 1) Anesthesia: 18-day pregnant SD rats were anesthetized with reanaesthesia, and the abdomen of the pregnant rats was thoroughly disinfected with 75% alcohol.

[0167] 2) Sampling: Under a stereomicroscope, the cerebral cortex of a fetus from an 18-day gestational age SD rat was collected and placed in a medium dish containing dissecting fluid.

[0168] 3) Digestion: After washing the cortex with PBS several times, add 2 ml of trypsin to a medium dish and digest for 15 minutes, pipetting thoroughly every 5 minutes.

[0169] 4) Termination of digestion: Terminate the digestion with 6 ml DMEM (DMEM basal medium + 10% FBS + 1% PS) and pipette thoroughly.

[0170] 5) Filtration: Filter with a 0.22 μm cell strainer.

[0171] 6) Centrifugation: centrifuge at 1200 rpm for 5 minutes at room temperature. After centrifugation, discard the supernatant, resuspend the precipitate, count with a cell counting plate, and then seed.

[0172] 7) Drug addition: Add the optimal concentration of Clemastine fumarate (CF) or BI-78D3 into a 24-well plate and culture for 3 days.

[0173] 8) Resuspension: After culturing for 48 hours, the resuspended cells were digested with 0.25% trypsin and resuspended and then seeded into a new 24-well plate.

[0174] 9) Drug addition: Clemastine fumarate (CF) or BI-78D3 at the optimal concentration was added and cultured for 24 hours.

[0175] 10) Statistics: Resuspend the cultured cells for immunohistochemical staining and count the axon length.

[0176] 2. Experimental Results

[0177] The results of the resuspended cell culture experiment are as follows Fig. 9 As shown, A is the immunohistochemical staining of cortical neurons treated with Clemastine fumarate (CF) and BI-78D3 for 72 hours and then resuspended and cultured for 15 hours, bar is 75μm. B is the statistics of the total length and longest length of axons after resuspending cortical neurons at the optimal drug concentration of Clemastine fumarate (CF) and BI-78D3. Data represent mean±SEM, *P<0.05, **P<0.001, ***P<0.005, ****P<0.0001vs control. The results show that inhibiting Nrgn with Clemastine fumarate (CF) or BI-78D3, a drug targeting Nrgn, can promote axon regeneration of cortical neurons.

Claims

1. Application of neurogranin inhibitors in the preparation of drugs for treating nerve damage.

2. The use according to claim 1, characterized in that The neurogranin inhibitor is a substance that inhibits the expression of neurogranin or its gene, and is selected from one or more of compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, and nucleic acids.

3. The use according to claim 2, characterized in that The substance that inhibits neurogranin gene expression is clemastine or JNK inhibitor BI-78D3.

4. The use according to claim 2, characterized in that The substance that inhibits neurogranin gene expression is neurogranin gene siRNA and / or vector-based shRNA.

5. The use according to claim 4, characterized in that The siRNA sequences are as follows: si-Nrgn-1: Sense strand: 5'-GACAAGACTTCCCTACTGT-3', SEQ ID No: 1; Antisense strand: 5'-CTGTTCTGAAGGGATGACA-3', SEQ ID No: 2; si-Nrgn-2: Sense strand: 5'-CCTAACCTCAACCTCCTAA-3', SEQ ID No: 3; Antisense strand: 5'-GGATTGGAGTTGGAGGATT-3', SEQ ID No: 4; si-Nrgn-3: Sense strand: 5'-ACATGGCGAGGAAGAAGAT-3', SEQ ID No: 5; Antisense strand: 5'-TGTACCGCTCCTTCTTCTA-3', SEQ ID No:

6.

6. The use according to claim 4, characterized in that The shRNA includes a sense strand segment, an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment. The shRNA sequence is as follows: shRNA-1 contains a stem-loop structure sequence: 5'-AGTGACAAGACTTCCCTACTGTTACATCTGTGGCTTCACTAACAGTAGGGAAGTCTT GTCACG-3', SEQ ID No: 7; shRNA-2 contains a stem-loop structure sequence: 5'-ACATGGCGAGGAAGAAGATAAATACATCTGTGGCTTCACTATTTATCTTCTTCCTCGC CATGG-3', SEQ ID No: 8; shRNA-3 contains a stem-loop structure sequence: 5'-CTCCAAGCCAGACGACGATATTTACATCTGTGGCTTCACTAAATATCGTCGTCTGGCT TGGAT-3', SEQ ID No: 9; shRNA-4 contains a stem-loop structure sequence: 5'-CTCCCGCTCTCCTTTGTTTTATGTACATCTGTGGCTTCACTACATAAACAAAGGAGAG CGGGAT-3', SEQ ID No:

10.

7. The use according to claim 4, characterized in that The medicine is an injection preparation.

8. The use according to claim 1, characterized in that The nerve damage is central nervous system damage.

9. The use according to claim 8, characterized in that The central nervous system injury is spinal cord injury.

Images