High-affinity pseudo-antibody targeting neurodegenerative disease related Tau protein as well as preparation method and application of high-affinity pseudo-antibody
Through the skeleton of Irisin96 constructed based on irisin, a high-affinity skeleton targeting Tau proteins related to neurodegenerative diseases was screened out, solving the large size and penetration of existing antibodies in the treatment of neurodegenerative diseases. Poor performance and other problems have achieved efficient and low-cost Tau protein binding and detection.
Patent Information
- Application Number
- CN202411715220.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-27
- Publication Date
- 2025-02-18
AI Technical Summary
When treating neurodegenerative diseases, existing antibodies have problems such as large size, poor penetration, unstable binding sites, limited structural diversity and high production costs, and it is difficult to effectively target Tau protein.
Using the quasi-antibody skeleton Irisin96 constructed based on irisin, a high-affinity quasi-antibody targeting neurodegenerative disease-related Tau protein was screened through the phage surface display quasi-antibody library.
It has achieved high affinity binding to Tau protein, has better tissue permeability and binding ability, and has low production cost. It is suitable for the detection, diagnosis and treatment of neurodegenerative diseases.
Smart Images
Figure CN119462919A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical engineering technology, and specifically relates to a high-affinity pseudo-antibody targeting Tau protein associated with neurodegenerative diseases, and a preparation method and application thereof. Background Art
[0002] Antibodies are immunoglobulins (Immunoglobulin, Ig) produced by plasma cells that proliferate and differentiate into B lymphocytes or memory B cells under antigen stimulation, and can specifically bind to corresponding antigens. Whether in the field of biotechnology or in the diagnosis and treatment of diseases, antibodies play a wide and important role, and related research fields have become research hotspots. The advantages of antibodies are mainly reflected in high specificity, diversity and targeting specificity. However, with the deepening of research, their natural limitations have also become prominent: ① Antibodies are large in size and have poor penetration into tissues and solid tumors; ② The small Fv region of the antigen binding site will lead to unstable binding of light chains and heavy chains, and the recombinant expression step is too difficult, which restricts its scope of application; ③ The Fv region is composed of 6 antibody variable regions of heavy and light chains, and the structural diversity is limited when preparing a fully synthetic antibody library; ④ Glycosylated antibody drugs must be expressed in eukaryotic cell lines, which has a long cycle and high cost.
[0003] Based on the various deficiencies of antibodies, the search for antibody-like scaffold drugs or non-antibody scaffold drugs has gradually become a new hot spot in basic research and technological innovation. Ideal non-antibody scaffold proteins generally have a small size, a dense and thermally stable structure, and a variable surface area. Compared with traditional antibody drugs, antibody-like scaffold drugs have important characteristics such as intracellular stability, weak immune effects, oral absorption and low cost, and have become one of the hot areas of drug research and development.
[0004] Protein mimetics are polypeptides, modified peptides or other molecules that simulate the biological functions or activities of other proteins, and are usually used in drug design and discovery. Protein mimetics are divided into antibody mimetic or Antibody mimics, Peptidomimetic and Phosphomimetics. Antibodies can bind specifically to antigens, but are not related to antibodies in molecular structure. They are usually artificial proteins (peptides) with a molecular weight of 2 to 20 kDa (about 150 kDa for full-length antibodies). Nucleic acids and small molecules are sometimes also considered antibody mimics, but they are not artificial antibodies or antibody fragments and their fusion proteins. Pseudo-antibodies also have high affinity and specificity for targets and are easy to screen. Compared with traditional antibodies, they have three main advantages: ① The protein skeleton is smaller than that of traditional antibodies, with strong tissue permeability and low immunogenicity, which is more conducive to finding binding sites that are difficult for antibodies to reach, and has advantages in treating solid tumors or producing inhaled drugs; ② They have higher tolerance to thermal and enzymatic degradation, can be expressed or synthesized in large quantities and in highly soluble forms in bacteria and yeast, are easy to modify, and have relatively low production costs. Pseudo-antibodies can make up for the limitations of traditional antibody therapy to a certain extent, and with the advancement of development and application, they have unique advantages and application prospects.
[0005] The protein scaffold of the pseudo-antibody is obtained by screening the scaffold protein library constructed by genetic modification for specific target molecules. In recent years, relevant research has made great progress. The Academy of Military Medical Sciences has made exploratory research in the research and development of scaffold proteins. Du Jianfang et al. used thioredoxin Trx as the scaffold and inserted random peptide library fragments into the protruding loop region to construct a scaffold protein polypeptide library. Zhao An et al. displayed the insect defensin A after molecular modification on the surface of bacteriophage. In 2009, the US FDA approved Kalbitor (ecallantide) manufactured by Dyax for preventing the onset of hereditary angioedema. In May 2017, AstraZeneca launched the anticalin asthma drug PRS-060 (pseudo-antibody) from Boston-based Pieris Phamaceuticals into clinical trials. In March 2019, progress was made in the application of orally available anti-influenza pseudo-antibodies in mouse studies. The pseudo-antibodies target conserved epitopes on influenza HA (Hemagglutinin), possess antibody functional characteristics in vitro and in vivo, and exhibit high affinity and broad-spectrum binding activity comparable to that of the influenza neutralizing antibody CR6261.
[0006] Irisin was discovered in 2012. It is a myokine protein that is widely present in multiple species. It can be induced to secrete through exercise stimulation and is expressed in multiple organs such as skeletal muscle, heart, brain, spinal cord, and testicles. Irisin is mainly responsible for regulating the browning of adipose tissue, thereby regulating the body's metabolism and heat production. Through structural comparative analysis, it was found that the three-dimensional structure of irisin has structural similarities with antibody fragments (single-domain antibody VH, nanoantibody CH2 and CH3). Its three loop regions (structurally corresponding to the complementarity determining region of the antibody, CDR) can be designed and developed into a pseudo-antibody skeleton for rapid diagnosis of diseases and development of therapeutic drugs.
[0007] Tau (Tubulin associated unit, Tau) protein is microtubule-associated protein tau (MAPT), which is encoded by the gene MAPT located on chromosome 17. It is mainly expressed in the central nervous system and peripheral nervous system. Some Tau subtypes are also translated and expressed in the spinal cord and skeletal muscle. Tau protein mainly includes four functional domains: N-terminal projection domain, proline-rich domain, microtubule structure binding domain and C-terminal tail domain. Tau protein is in a disordered and naturally unfolded protein structure state. Its repeating sequence forms a "paper clip" structure. The N-terminal domain and microtubule structure binding domain can approach the C-terminal tail domain and interact with each other.
[0008] The main function of Tau protein in the central nervous system is to promote microtubule assembly, participate in neurite polarity, axon elongation and axon transport, regulate neuronal plasticity, and respond to oxidative stress. The incorrect accumulation and hyperphosphorylation of Tau protein can lead to many different neurodegenerative diseases, collectively referred to as Tauopathies. Alzheimer's disease (AD) is the most common neurodegenerative disease, and its clinical manifestations are mainly cognitive dysfunction and slow mobility. AD is a secondary tauopathy, which is related to the hyperphosphorylation of Tau protein causing intracellular neurofibrillary tangles (NFT) and the aggregation of Aβ protein in the form of neuritic plaques outside nerve cells. These two forms promote each other and aggravate the course of AD. Parkinson's disease (PD) is also a widely affected neurodegenerative disease. Neurofibrillary tangles and Aβ plaques caused by Tau hyperphosphorylation have also been found in PD patients, so PD patients are also considered to be at higher risk of developing Taupathies. In addition, there are many diseases caused by abnormal function of Tau protein. Therefore, Tau protein detection is of great significance for the early diagnosis, disease monitoring, differential diagnosis and treatment effect evaluation of neurodegenerative diseases. It also provides important biomarker support for studying disease mechanisms and developing new therapies. Summary of the invention
[0009] The purpose of the present invention is to provide a high-affinity pseudo-antibody targeting Tau protein associated with neurodegenerative diseases and a preparation method and application thereof.
[0010] To achieve the above object, the present invention adopts the following technical solution:
[0011] The present invention first provides a pseudo-antibody framework Irisin96 constructed based on irisin: the amino acid sequence of the pseudo-antibody framework Irisin96 is positions 1-96 of SEQ ID No.4; the pseudo-antibody framework Irisin96 has three antigen-binding loop regions similar to the functions of antibody complementary determinants: loop1, loop2 and loop3; the amino acid sequence of loop1 is positions 25-32 of SEQ ID No.4, the amino acid sequence of loop2 is positions 52-57 of SEQ ID No.4, and the amino acid sequence of loop3 is positions 77-83 of SEQ ID No.4.
[0012] The method for preparing a pseudo-antibody library based on the pseudo-antibody framework Irisin96 comprises the following steps:
[0013] (1) Amplifying and splicing the pseudo-antibody gene fragments with Irisin96 as the backbone through primers, and connecting and inserting them into the shuttle vector to form a pseudo-antibody gene library;
[0014] (2) The pseudo-antibody gene library was electroporated into competent E. coli cells, and the helper phage M13KO7 was used to infect the E. coli carrying the pseudo-antibody gene library to obtain the phage surface displayed pseudo-antibody library, and the library capacity of the phage surface displayed pseudo-antibody library was evaluated.
[0015] Based on the pseudo-antibody library constructed as described above, a pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases was screened, characterized in that its nucleotide sequence is shown in SEQ ID No.5 and its amino acid sequence is shown in SEQ ID No.6.
[0016] Furthermore, the method for preparing the pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases comprises the following steps:
[0017] (1) constructing a prokaryotic expression vector containing a Tau protein gene sequence associated with neurodegenerative diseases, expressing the Tau protein, and isolating and purifying the Tau protein;
[0018] (2) Using purified Tau protein as the antigen, a phage surface-displayed pseudo-antibody library with Irisin96 as the backbone was used for screening, and a high-affinity specific binding pseudo-antibody clone was obtained through multiple rounds of panning;
[0019] (3) Expressing and purifying the pseudo-antibody clone to obtain a high-affinity pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases, wherein the pseudo-antibody 4G7@Irisin96 has three antigen-binding regions, loop1, loop2 and loop3, wherein the amino acid sequence of loop1 is positions 25-32 of SEQ ID No.6, the amino acid sequence of loop2 is positions 52-58 of SEQ ID No.8, and the amino acid sequence of loop3 is positions 78-85 of SEQ ID No.8.
[0020] The present invention also provides an antigen-binding fragment or a mimetic antibody derivative, which is the following A1) or A2):
[0021] A1) an antigen-binding fragment or a mimetic antibody derivative whose amino acid sequence is shown in SEQ ID No.6;
[0022] A2) A protein tag is connected to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 6 to obtain an antigen-binding fragment or a pseudo-antibody derivative.
[0023] The present invention also provides a biomaterial, which is any one of the following:
[0024] B1): a nucleic acid molecule encoding the mimetibody 4G7@Irisin96 of claim 3 or the antigen-binding fragment of claim 5;
[0025] B2): an expression cassette containing the nucleic acid molecule described in B1);
[0026] B3): a recombinant vector containing the nucleic acid molecule described in B1);
[0027] B4): a recombinant vector containing the expression cassette described in B2);
[0028] B5): A recombinant microorganism containing the nucleic acid molecule described in B1);
[0029] B6): A recombinant microorganism containing the expression cassette described in B2);
[0030] B7): a recombinant microorganism containing the recombinant vector described in B3);
[0031] B8): A recombinant microorganism containing the recombinant vector described in B4).
[0032] Furthermore, the nucleic acid molecule described in B1) has three antigen-binding loop regions: loop1, loop2 and loop3, the coding gene of loop1 is nucleotides 73-96 of SEQ ID No.5; the coding gene of loop2 is nucleotides 154-174 of SEQ ID No.5; and the coding gene of loop3 is nucleotides 232-255 of SEQ ID No.5.
[0033] Further, the nucleic acid molecule as described in B1) is any one of the following:
[0034] C1): a DNA molecule having a nucleotide sequence as shown in SEQ ID No. 5;
[0035] C2): a DNA molecule that hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the mimetic antibody 4G7@Irisin96;
[0036] C3): A DNA molecule that has more than 80% homology with any of the DNA sequences defined in C1) or C2) and encodes the pseudoantibody 4G7@Irisin96.
[0037] Furthermore, the method for preparing the antigen-binding fragment or the pseudo-antibody derivative comprises the following steps: introducing a nucleic acid molecule encoding the antigen-binding fragment or the pseudo-antibody derivative according to claim 5 into a recipient cell to obtain a transgenic cell expressing the antigen-binding fragment or the pseudo-antibody derivative, and culturing the transgenic cell to obtain the antigen-binding fragment or the pseudo-antibody derivative, wherein the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No. 5 in the sequence listing.
[0038] The present invention also provides an ELISA detection kit targeting Tau protein associated with neurodegenerative diseases, wherein the kit comprises the pseudo-antibody 4G7@Irisin96, or the antigen-binding fragment or pseudo-antibody derivative, or the biomaterial.
[0039] The present invention also provides any one of the following applications:
[0040] D1): Use of the mimetic antibody 4G7@Irisin96, or the antigen-binding fragment, or the biomaterial, or the kit in the preparation of a product for detecting Tau protein associated with neurodegenerative diseases;
[0041] D2): Use of the mimetic antibody 4G7@Irisin96, or the antigen-binding fragment, or the biomaterial, or the kit in the preparation of a product that binds to Tau protein associated with neurodegenerative diseases;
[0042] D3): Use of the pseudo-antibody 4G7@Irisin96 or the antigen-binding fragment in the preparation of a Tau protein detection reagent associated with neurodegenerative diseases;
[0043] D4): Use of the pseudo-antibody 4G7@Irisin96 or the antigen-binding fragment in the preparation of a diagnostic reagent for a neurodegenerative disease (Tauopathy);
[0044] D5): Use of the pseudo-antibody 4G7@Irisin96 or the antigen-binding fragment in the preparation of drugs for preventing and / or treating neurodegenerative diseases (Tauopathy).
[0045] The present invention adopts the above technical scheme, constructs a pseudo-antibody skeleton based on the structural analysis of irisin, and then constructs a pseudo-antibody library based on the pseudo-antibody skeleton. The pseudo-antibody skeleton construction method provided by the present invention is conducive to mining pseudo-antibody skeletons from human proteins, and the high-affinity pseudo-antibody 4G7@Irisin96 targeting the Tau protein associated with neurodegenerative diseases screened from the phage surface-displayed pseudo-antibody library can be used for the detection, diagnosis or treatment of neurodegenerative diseases. The pseudo-antibody 4G7@Irisin96 has a much smaller molecular weight (about 12.6 kDa) than conventional full-length antibodies (molecular weight of about 150 kDa), has better tissue permeability and the ability to bind to antigenic epitopes with steric hindrance effects, can be expressed in large quantities in a prokaryotic expression system, has a short cycle, and has low production costs. The pseudo-antibody 4G7@Irisin96 screened by the present invention has a high affinity (EC 50 ≈1.7nM), and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 These are protein detection images of the purified Tau protein associated with neurodegenerative diseases; A: SDS-PAGE gel image; B: Western Blotting image.
[0047] Figure 2 It is the tertiary structure and structural superposition of the nanobody and Ig-like domain protein; AC: the three-dimensional structure of the nanobody VH, CH2 and CH3; DF: the superposition of the three-dimensional structure of Irisin96 and the nanobody VH, CH2 and CH3 proteins; G: the three-dimensional structure of Irisin96 and the amino acid sequence corresponding to its three loop regions.
[0048] Figure 3 This is the SDS-PAGE detection picture of Irisin protein (containing FLAG tag) after purification.
[0049] Figure 4 The phage surface displayed pseudo antibody Irisin96 library was constructed; A: Irisin96 pseudo antibody library was diluted 10 8 Colonies on the plate after multiple dilution; B: Irisin96 pseudo-antibody library diluted 10 9 Colonies on the plate after multiple dilution; C: Irisin96 pseudo-antibody library diluted 10 10 After multiples, spread the colonies on the plate.
[0050] Figure 5 This is the SDS-PAGE detection image of the protein after purification of 4G7@Irisin96 mimetic antibody (containing FLAG tag) targeting Tau protein associated with neurodegenerative diseases.
[0051] Figure 6 It is an ELISA test to determine the binding of the pseudo-antibody 4G7@Irisin96 to the Tau protein associated with neurodegenerative diseases. DETAILED DESCRIPTION
[0052] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0053] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0054] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.
[0055] SEQ ID No.1: Nucleotide sequence of Tau protein associated with neurodegenerative diseases
[0056] SEQ ID No.2: Amino acid sequence of Tau protein associated with neurodegenerative diseases
[0057] SEQ ID No.3: Nucleotide sequence of irisin
[0058] SEQ ID No.4: Amino acid sequence of irisin
[0059] SEQ ID No.5: Nucleotide sequence of the pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases
[0060] SEQ ID No.6: Amino acid sequence of the pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases
[0061] SEQ ID No.7: Nucleotide sequence of FLAG tag
[0062] SEQ ID No.8: Amino acid sequence of FLAG tag
[0063] Example 1 Expression and purification of Tau protein associated with neurodegenerative diseases
[0064] Codon optimization was performed according to the amino acid sequence of human neurodegenerative disease-related Tau protein (NP_005901.2), and the base sequence after codon optimization is shown in SEQ ID No. 1; the base sequence after codon optimization was inserted between the restriction enzyme cutting sites BamHI and HindIII of the vector pET-28a(+) (Novagen, catalog number: 69864), and the prokaryotic expression vector pET28a-tau was constructed by ligation.
[0065] The nucleotide sequence (i.e., coding sequence) contained in pET28a-tau is the tau codon-optimized nucleotide sequence of SEQ ID No.1 in the sequence list, and the expressed amino acid sequence is the fusion protein with a histidine tag (histag) at the C-terminus of SEQ ID No.2 in the sequence list.
[0066] 10 ng of the recombinant vector pET28a-tau was transformed into Escherichia coli BL21 (DE3) competent cells (NEW ENGLANDBiolabs, Catalog No.: C2527H), and positive clones were screened by kanamycin hydrochloride. After verification by PCR or enzyme digestion or sequencing, the successfully verified positive clone recombinant strain was named BL21-pET28a-tau.
[0067] The recombinant strain BL21-pET28a-tau was inoculated into LB liquid medium (Luria-Bertani broth, containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) containing kanamycin hydrochloride at a final concentration of 50 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mmol / L, and induce at 16°C and 180 rpm for 16-20 hours. Centrifuge at 4°C and 6000 rpm for 20 minutes to collect the induced protein-expressing bacteria, and resuspend the bacterial precipitate in PBS buffer. Ultrasonicate the bacteria under ice-water bath conditions, centrifuge at 4°C and 12000 rpm for 30 minutes to collect the supernatant, and after affinity binding with Ni-NTA filler, elute the purified protein through imidazole gradient, and dialyze to remove imidazole.
[0068] The purity of the purified protein was verified by SDS-PAGE. Figure 1 The results showed that the protein obtained by purification and elution of the supernatant after the recombinant strain BL21-pET28a-tau bacterial liquid was broken had a clear target protein size band, and the purified protein was verified by Western Blotting to obtain the neurodegenerative disease-related Tau protein containing a His tag at the C-terminus.
[0069] Example 2 Design and construction of pseudo-antibody framework based on irisin protein structure
[0070] Based on the analysis of the resolved protein structure of irisin (PDB ID: 4LSD), irisin was selected as the underlying protein of the pseudoantibody, whose amino acid sequence is shown in SEQ ID No.4, and the encoding gene sequence is shown in SEQ ID No.3; it has three loop regions, corresponding to the CDR regions of the single-domain antibody VH or the nanobody CH2 / CH3: the gene sequence encoding loop1 is from positions 73 to 96 of SEQID No.3, and the amino acid sequence is from positions 25 to 32 of SEQ ID No.4; the gene sequence encoding loop2 is from positions 154 to 171 of SEQ ID No.3, and the amino acid sequence is from positions 52 to 57 of SEQ ID No.4; the gene sequence encoding loop3 is from positions 229 to 249 of SEQ ID No.3, and the amino acid sequence is from positions 77 to 83 of SEQ ID No.4.
[0071] Based on the structural characteristics of the framework region (Framework, FR) of single-domain antibody VH and nanobody CH2 / CH3 ( Figure 2 ), the first 96 amino acids of irisin were cut as the mimetic antibody framework ( Figure 2 G), the mimetic antibody backbone was named Irisin96. The primers for constructing the prokaryotic expression plasmid of the irisin-derived mimetic antibody are as follows:
[0072] FR1_F: 5'-CTACCGTGGCCCAGGCGCCCGATAGCCCGAGCGCACC-3'
[0073] FR4_R: 5'-TGGTGCTGGCCGGCCTGGCCTTCACGCGGTGTTTTAAAC-3'
[0074] The steps for constructing the irisin-derived pseudoantibody expression plasmid are as follows:
[0075] Using the irisin nucleotide (SEQ ID No. 3) as a template, a primer pair (FR1_F and FR4_R) was used to amplify the gene fragment (1-288) corresponding to amino acids 1-96 of irisin, which was digested with SfiI restriction endonuclease (New England Biolabs, catalog number: R0123L) and ligated into the phagemid vector pComb3XSS (Addgene, catalog number: 63890) also digested with SfiI to construct the truncated irisin Irisin96 expression plasmid pComb3XSS-Irisin96.
[0076] 20 ng of pComb3XSS-Irisin96 recombinant plasmid verified by sequencing was transformed into competent E. coli HB2151 (Agilent Life Sciences, Catalog No.: 930684) cells, and the positive cloned recombinant strain verified by PCR and 2% agarose gel electrophoresis or restriction digestion was used for protein expression. The specific operation is as follows:
[0077] The recombinant strain was inoculated into SB liquid medium (SuperBroth, containing 32 g / L tryptone, 20 g / L yeast extract, 5 g / L NaCl) containing ampicillin at a final concentration of 100 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.1mmol / L and induce at 16℃, 180rpm for 16-20 hours. Collect the induced bacteria by centrifugation at 4℃, 6000rpm for 10 minutes, and resuspend the bacterial pellet in PBS buffer. Ultrasonicate the bacteria in an ice-water bath, collect the supernatant by centrifugation, pass through Ni-NTA filler, and obtain the purified protein by imidazole gradient elution, and remove imidazole by dialysis. The purity was verified by SDS-PAGE ( Figure 3 ), after the recombinant strain induced expression of the bacterial solution was broken, the supernatant purified and eluted protein had a clear target protein size band.
[0078] Example 3 Construction and panning of a pseudo-antibody library based on the pseudo-antibody framework Irisin96
[0079] The pseudo-antibody framework Irisin96 ( Figure 2 ) construct a pseudoantibody library, the amino acid sequence of the pseudoantibody Irisin96 is the 1st to 96th position of SEQ ID No.4, and the coding gene sequence is the 1st to 288th position of SEQ ID No.3. It has three loop regions, corresponding to the CDR regions of single-domain antibody VH or nanobody CH2 / CH3 respectively: the gene sequence encoding loop1 is the 73rd to 96th position of SEQ ID No.3, and the amino acid sequence is the 25th to 32nd position of SEQ ID No.4; the gene sequence encoding loop2 is the 154th to 171st position of SEQ ID No.3, and the amino acid sequence is the 52nd to 57th position of SEQ ID No.4; the gene sequence encoding loop3 is the 229th to 249th position of SEQ ID No.3, and the amino acid sequence is the 77th to 83rd position of SEQ ID No.4.
[0080] Referring to the literature (Caucheteur D, et al., Methods Mol Biol. 2018, 1827: 93-108; Moreno E, et al., BMC Res Notes, 2022, 15 (1): 124; Chuangyong Liu, et al., Biotechnol Bioeng, 2024, 121 (6): 1973-1985.), primers were designed for the loop region and a phage surface display library was constructed ( Figure 4 AC) and applied to the screening of pseudo antibodies against Tau protein associated with neurodegenerative diseases.
[0081] The primers for constructing the phage surface display pseudo-antibody library are as follows:
[0082] FR1_F: 5'-CTACCGTGGCCCAGGCGCCCGATAGCCCGAGCGCACC-3'
[0083] loop1_R: 5'-CTGGCTGATTGCAAAACC NNN ATCCCAGCTAACAACTGC-3' (series length primer, wherein N is any base of A, T, C, G, and the number of N is an integer multiple of 3, and the multiple is an integer between 5 and 8);
[0084] FR2_F: 5'-GGTTTTGCAATCAGCCAGCAG-3';
[0085] loop2_R: 5'-ATCCCACAGTGCACAGCT NNN TTCTTGGATAAAGCGCAG-3' (series length primer, wherein N is any base of A, T, C, G, and the number of N is an integer multiple of 3, and the multiple is an integer between 6 and 10);
[0086] FR3_F: 5'-AGCTGTGCACTGTGGGATTTAG-3';
[0087] loop3_R: 5'-CCGGTTCGCTTGCCGG NNN TGCCTGCACGTGAACAATATATTC' (series length primer, wherein N is any base of A, T, C, G, and the number of N is an integer multiple of 3, and the multiple is an integer between 7 and 15);
[0088] FR4_R: 5'-TGGTGCTGGCCGGCCTGGCCTTCACGCGGTGTTTTAAAC-3'
[0089] The steps for constructing the pseudo antibody Irisin96 library are as follows:
[0090] Primer pairs (FR1_F and loop1_R), (FR2_F and loop2_R), (FR3_F and loop3_R) were used with Irisin nucleotide (SEQ ID No. 3) as template using GeneMorph II-Random Mutagenesis Kits (Aglient, Catalog No.: 200550) to amplify FR1-loop1, FR2-loop2 and FR3-loop3 gene fragments respectively (refer to the kit manual for the operating steps); the PCR amplification products were recovered using a PCR product kit (QIAGEN, Catalog No.: 28006). The FR1-loop1-FR2-loop2 gene fragment was amplified using FR1-loop1 and FR2-loop2 as templates and FR1_F and loop2_R as primers; the FR3-loop3-FR4 gene fragment was amplified using FR3-loop3 as a template and FR3_F and FR4_R as primers; the FR1-loop1-FR2-loop2 and FR3-loop3-FR4 as templates and FR1_F and FR4_R as primers were used to amplify the full-length FR1-loop1-FR2-loop2-FR3-loop3-FR4 gene fragment. The products obtained by PCR amplification were recovered using a PCR product kit (QIAGEN, catalog number: 28006). After digestion with SfiI restriction endonuclease (New England Biolabs, catalog number: R0123L), the vector was ligated into the phagemid vector pComb3XSS (Addgene, catalog number: 63890) that was also digested with SfiI to construct the pComb3XSS-Irisin96 pseudo-antibody library recombinant vector, which was then electroporated into Escherichia coli TG1 competent cells (Agilent, catalog number: 200123) and infected with helper phage M13KO7 (New England Biolabs, catalog number: N0315S) to obtain the phage surface displayed pseudo-antibody library. The library capacity can reach 2×10 10 pfu / mL( Figure 4 ).
[0091] The purified neurodegenerative disease-related Tau protein was coated as an antigen in a 96-well plate and incubated overnight at 4°C. The phage surface-displayed Irisin96 pseudo-antibody library was used for panning to obtain phage pseudo-antibody candidate clones that specifically bind to the antigen. After 6 rounds of screening, one pseudo-antibody clone was enriched and named pseudo-antibody 4G7@Irisin96.
[0092] After sequencing, the amino acid sequence of the pseudoantibody 4G7@Irisin96 was obtained as shown in SEQ ID No.6, and its encoding gene sequence was shown in SEQ ID No.5, and the loop sequences corresponding to the single-domain antibody VH complementary determining clusters CDR1, CDR2 and CDR3 were numbered according to the amino acid sequence; wherein, the nucleotide sequence of loop1 was 73-96 of SEQ ID No.5: GGCTTCTCCCTGAACACTTATTCT; the amino acid sequence was 25-32 of SEQ ID No.6: GFSLNTYS; the nucleotide sequence of loop2 was 154-174 of SEQ ID No.5: ATTCTACTTGGTGTAATC; the amino acid sequence was 52-58 of SEQ ID No.6: ISNFGVI; the nucleotide sequence of loop3 was 232-255 of SEQ ID No.5: AAATACGGCTCTGAATGGGGTGGT; the amino acid sequence was 78-85 of SEQ ID No.6: KYGSEWGG.
[0093] Example 4 Expression and purification of mimetic antibody 4G7@Irisin96
[0094] The pseudo-antibody 4G7@Irisin96 gene fused with the FLAG tag gene (Merck) targeting the neurodegenerative disease-related Tau protein was inserted between the multiple cloning sites NcoI and XhoI of the vector pET-28a(+) (Novagen, catalog number: 69864), and the expression vector pET28a-4G7@Irisin96-FLAG was constructed by ligation.
[0095] The structure of the expression vector pET28a-4G7@Irisin96-FLAG is described as follows: a small fragment between the NcoI and XhoI restriction endonuclease sites in pET-28a(+) is replaced with a DNA molecule of a 4G7@Irisin96 nucleotide fragment (nucleotide sequence is the connection of SEQ ID No.5 and SEQ ID No.7) with a FLAG tag, and the other nucleotides of pET-28a(+) remain unchanged, thereby obtaining a recombinant vector expressing a FLAG tag. The expression vector pET28a-4G7@Irisin96-FLAG contains a nucleotide sequence (i.e., a coding sequence) of a recombinant 4G7@Irisin96-FLAG protein gene formed by connecting the 4G7@Irisin96 gene (SEQ ID No.5) and the FLAG tag gene (SEQ IDNo.7), and expresses a fusion protein of the amino acid sequence of SEQ ID No.6 and SEQID No.8.
[0096] 10 ng of expression vector pET28a-4G7@Irisin96-FLAG was transformed into E. coli BL21 (DE3) competent cells. Positive clones were screened and verified by PCR, 2% agarose gel electrophoresis or restriction digestion or sequencing. The successfully verified positive clone recombinant strain was named as recombinant strain BL21-pET28a-4G7@Irisin96-FLAG.
[0097] The recombinant strain BL21-pET28a-4G7@Irisin96-FLAG was inoculated into LB medium containing kanamycin hydrochloride at a final concentration of 50 μg / mL, and the OD 600 When the concentration reaches 0.6-0.8, add IPTG with a final concentration of 0.1mmol / L, and induce at 16℃, 180rpm for 16-20 hours. Centrifuge at 4℃, 6000rpm for 15min to collect the induced protein-expressing bacteria, and resuspend the bacterial precipitate in PBS buffer. Ultrasonic disruption of the bacteria under ice-water bath conditions, centrifugation to collect the supernatant, affinity binding through Ni-NTA filler, imidazole concentration gradient elution to purify the antibody protein, and dialyze to remove imidazole, SDS-PAGE to verify the purity of the target protein.
[0098] Depend on Figure 5 The results show that after the recombinant strain BL21-pET28a-4G7@Irisin96-FLAG was broken, the supernatant purified and eluted proteins had a clear target protein size band, and the purity of the protein was very high; the molecular weight was about 13kDa, which was consistent with the theoretical molecular weight, that is, the 4G7@Irisin96 pseudo-antibody fusion protein containing a FLAG tag at the C-terminus was expressed and purified.
[0099] Example 5 ELISA method to determine the binding ability of the mimetic antibody 4G7@Irisin96 to the Tau protein associated with neurodegenerative diseases
[0100] The neurodegenerative disease-related Tau protein (10 μg / mL) containing the His tag obtained in Example 1 was coated in a 96-well plate, incubated at 4°C overnight, and blocked with 1% (w / v) BSA at 37°C for 1 hour overnight. The 4G7@Irisin96-FLAG mimetic antibody protein containing the FLAG tag obtained in Example 4 was added with a concentration series dilution (0, 50, 100, 150, 200 nM), incubated at 37°C for 2 hours, and then washed four times with PBS+0.05% (v / v) Tween20 solution, and then horseradish peroxidase (HRP)-labeled anti-FLAG tag mouse monoclonal antibody (Sigma, catalog number: A8592) was added, incubated at 37°C for 1 hour, and then washed four times with PBS+0.05% (v / v) Tween 20 solution. The mimetic antibody backbone Irisin96 was used as a negative control. The pseudo-antibody framework Irisin96 is obtained by prokaryotic expression and purification of the protein at positions 1 to 96 of the amino acid sequence of SEQ ID No. 4. The pseudo-antibody framework Irisin96 is prepared according to the following steps:
[0101] The nucleotides of the pseudo-antibody backbone Irisin96 (positions 1-288 of SEQ ID No. 3) were concatenated with the FLAG tag gene (Merck, SEQ ID No. 7) and synthesized by Beijing Qingke Biotechnology Co., Ltd. and connected to the multiple cloning sites NcoI and XhoI of the vector pET-30a(+) (Novagen, catalog number: 69909) to construct the expression vector pET30a-Irisin96-FLAG.
[0102] The structure of the vector pET30a-Irisin96-FLAG is described as follows: a small fragment between the NcoI and XhoI restriction endonuclease cleavage sites in pET-30a(+) is replaced with a DNA molecule of an Irisin96 nucleotide fragment with a FLAG tag (the nucleotide sequence is the 1st to 288th position of SEQ ID No.3 connected to SEQ ID No.7), and the other nucleotides of pET-30a(+) remain unchanged, thereby obtaining a recombinant vector expressing a FLAG tag. The recombinant vector pET30a-Irisin96-FLAG contains a nucleotide sequence (i.e., a coding sequence) that is a recombinant Irisin96-FLAG protein gene formed by connecting the Irisin96 gene (the 1st to 288th position of SEQ ID No.3) and the FLAG tag gene (SEQ ID No.7) in the sequence list, and the expressed amino acid sequence is the fusion protein Irisin96-FLAG of the 1st to 96th position of SEQ ID No.4 in the sequence list and SEQ ID No.8.
[0103] 10 ng of plasmid (pET30a-Irisin96-FLAG) was transformed into competent E. coli BL21 (DE3) cells. Positive clones were screened and verified by PCR, 2% agarose gel electrophoresis or restriction digestion or sequencing. The successfully verified positive clone recombinant strain was named as recombinant strain BL21-pET30a-Irisin96-FLAG.
[0104] The recombinant strain BL21-pET30a-Irisin96-FLAG was inoculated into LB liquid medium containing kanamycin hydrochloride at a final concentration of 50 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.1mmol / L and induce at 16℃, 180rpm for 16-20 hours. Collect the induced bacteria by centrifugation at 4℃, 6000rpm for 15min, and resuspend the bacterial precipitate in PBS buffer. Ultrasonicate the bacteria in an ice-water bath, collect the supernatant by centrifugation, purify it with Ni-NTA filler and dialyze to remove imidazole.
[0105] ELISA results Figure 6 As shown, the EC of the mimetic antibody 4G7@Irisin96-FLAG(●) binding to Tau protein associated with neurodegenerative diseases 50 The concentration of 4G7@Irisin96 in the negative control antibody was 1.7 nM, while the negative control antibody skeleton Irisin96-FLAG (▲) could not interact with Tau protein, indicating that the interaction between the antibody 4G7@Irisin96 and Tau protein was specific binding.
[0106] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. Irisin96, a pseudo-antibody framework constructed based on irisin, characterized in that: The amino acid sequence of the pseudo-antibody framework Irisin96 is positions 1-96 of SEQ ID No.4; the pseudo-antibody framework Irisin96 has three antigen-binding loop regions: loop1, loop2 and loop3; the amino acid sequence of loop1 is positions 25-32 of SEQ IDNo.4, the amino acid sequence of loop2 is positions 52-57 of SEQ ID No.4, and the amino acid sequence of loop3 is positions 77-83 of SEQ ID No.
4.
2. A method for preparing a mimetic antibody library based on the mimetic antibody framework Irisin96 according to claim 1, characterized in that: The steps include: (1) Amplifying and splicing the pseudo-antibody gene fragments with Irisin96 as the backbone through primers, and connecting and inserting them into the shuttle vector to form a pseudo-antibody gene library; (2) The pseudo-antibody gene library was electroporated into competent E. coli cells, and the helper phage M13KO7 was used to infect the E. coli carrying the pseudo-antibody gene library to obtain the phage surface displayed pseudo-antibody library, and the library capacity of the phage surface displayed pseudo-antibody library was evaluated.
3. A pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases, characterized in that: The nucleotide sequence is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.
6.
4. The method for preparing a pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases as claimed in claim 3, characterized in that: The steps include: (1) constructing a prokaryotic expression vector containing a Tau protein gene sequence associated with neurodegenerative diseases, expressing the Tau protein, and isolating and purifying the Tau protein; (2) Using purified Tau protein as the antigen, a phage surface-displayed pseudo-antibody library with Irisin96 as the backbone was used for screening, and a high-affinity specific binding pseudo-antibody clone was obtained through multiple rounds of panning; (3) Expressing and purifying the pseudo-antibody clone to obtain a high-affinity pseudo-antibody 4G7@Irisin96 targeting Tau protein associated with neurodegenerative diseases, wherein the pseudo-antibody 4G7@Irisin96 has three antigen-binding regions, loop1, loop2 and loop3, wherein the amino acid sequence of loop1 is positions 25-32 of SEQ ID No.6, the amino acid sequence of loop2 is positions 52-58 of SEQ ID No.8, and the amino acid sequence of loop3 is positions 78-85 of SEQ ID No.
8.
5. An antigen-binding fragment or a mimetic antibody derivative, characterized in that: It is the following A1) or A2): A1) an antigen-binding fragment or a mimetic antibody derivative whose amino acid sequence is shown in SEQ ID No.6; A2) A protein tag is connected to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 6 to obtain an antigen-binding fragment or a pseudo-antibody derivative.
6. A biomaterial, characterized in that It is any of the following: B1): a nucleic acid molecule encoding the mimetibody 4G7@Irisin96 of claim 3 or the antigen-binding fragment of claim 5; B2): an expression cassette containing the nucleic acid molecule described in B1); B3): a recombinant vector containing the nucleic acid molecule described in B1); B4): a recombinant vector containing the expression cassette described in B2); B5): A recombinant microorganism containing the nucleic acid molecule described in B1); B6): A recombinant microorganism containing the expression cassette described in B2); B7): a recombinant microorganism containing the recombinant vector described in B3); B8): A recombinant microorganism containing the recombinant vector described in B4).
7. The biomaterial according to claim 6, characterized in that: The nucleic acid molecule as described in B1) has three antigen-binding loop regions: loop1, loop2 and loop3, the coding gene of loop1 is nucleotides 73-96 of SEQ ID No.5; the coding gene of loop2 is nucleotides 154-174 of SEQ ID No.5; the coding gene of loop3 is nucleotides 232-255 of SEQ ID No.
5.
8. The biomaterial according to claim 6 or 7, characterized in that: The nucleic acid molecule as described in B1) is any one of the following: C1): a DNA molecule having a nucleotide sequence as shown in SEQ ID No. 5; C2): a DNA molecule that hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the mimetic antibody 4G7@Irisin96; C3): A DNA molecule that has more than 80% homology with any of the DNA sequences defined in C1) or C2) and encodes the pseudoantibody 4G7@Irisin96.
9. An ELISA detection kit targeting Tau protein associated with neurodegenerative diseases, characterized in that: The kit comprises the mimetic antibody 4G7@Irisin96 as described in claim 3, or comprises the antigen-binding fragment or mimetic antibody derivative as described in claim 5, or comprises the biomaterial as described in claim 6.
10. Any of the following applications: D1): Use of the mimetic antibody 4G7@Irisin96 as claimed in claim 3, or the antigen-binding fragment as claimed in claim 5, or the biomaterial as claimed in claim 6, or the kit as claimed in claim 9 in the preparation of a product for detecting Tau protein associated with neurodegenerative diseases; D2): Use of the mimetic antibody 4G7@Irisin96 as claimed in claim 3, or the antigen-binding fragment as claimed in claim 5, or the biomaterial as claimed in claim 6, or the kit as claimed in claim 9 in the preparation of a product that binds to Tau protein associated with neurodegenerative diseases; D3): Use of the mimetic antibody 4G7@Irisin96 as claimed in claim 3 or the antigen-binding fragment as claimed in claim 5 in the preparation of a Tau protein detection reagent associated with neurodegenerative diseases; D4): Use of the mimetic antibody 4G7@Irisin96 as claimed in claim 3 or the antigen-binding fragment as claimed in claim 5 in the preparation of a diagnostic reagent for neurodegenerative diseases; D5): Use of the mimetic antibody 4G7@Irisin96 as described in claim 3 or the antigen-binding fragment as described in claim 5 in the preparation of drugs for preventing and / or treating neurodegenerative diseases.