Monoclonal antibodies against Babesia duncanii ALD protein and their applications

By preparing high-affinity monoclonal antibodies against the ALD protein of Babesia Duncanii and establishing an indirect immunofluorescence method, the specificity and sensitivity problems of Babesia Duncanii detection in the existing technology are solved, providing a simple and effective diagnostic tool.

CN119462946BActive Publication Date: 2025-10-03HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411469814.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-21
Publication Date
2025-10-03
Estimated Expiration
2044-10-21

AI Technical Summary

Technical Problem

Existing technologies lack highly specific and sensitive methods for detecting Babesia Duncanii, and laboratory testing relies on expensive equipment and professional techniques, resulting in a lack of simple and effective diagnostic tools in clinical practice.

Method used

The ALD gene of Babesia duncanii was cloned and the recombinant protein rBdALD was prepared. Mice were immunized to obtain the hybridoma cell line 2A9. High-affinity monoclonal antibodies were screened and an indirect immunofluorescence detection method was established.

Benefits of technology

It provides a diagnostic tool for Duncan Babesiosis that is easy to operate, low-cost and highly sensitive, suitable for clinical and laboratory testing, and has important clinical prevention and control significance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119462946B_ABST
    Figure CN119462946B_ABST
Patent Text Reader

Abstract

The present invention discloses a monoclonal antibody against the ALD protein of Babesia duncani, secreted by hybridoma cell line 2A9, which has been deposited with the China Center for Type Culture Collection under the accession number CCTCC C2024203. The amino acid sequence of the ALD protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 1. The present invention also discloses an indirect immunofluorescence method for detecting Babesia duncani using the monoclonal antibody, providing a powerful means and tool for the clinical prevention and control of Babesia duncani, a major zoonotic parasite, and having significant significance for preventing the occurrence of the disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and particularly relates to a monoclonal antibody against Babesia duncanii and application thereof. Background Art

[0002] Babesia duncani is a species of hematopoietic protozoan that is an obligate intraerythrocytic parasite belonging to the genus Babesia, order Piroplasma, order Protista, phylum Apicomplexa, class Sporozoa, and order Piroplasma. It is one of the most common pathogens causing babesiosis in humans and rodents. It is primarily transmitted through the bite of hard ticks, but can also be acquired and transmitted through blood transfusions. Clinical manifestations range from asymptomatic to severe, with infection presenting with high fever, headache, chills, hemolytic anemia, jaundice, and hemoglobinuria. Severe cases can lead to organ failure and even death in elderly, immunocompromised, and splenectomized patients. The disease is prevalent worldwide, severely impacting human and animal health.

[0003] Once humans and animals are infected with Babesia duncanii, they develop lifelong immunity to the parasite. To date, there are no effective vaccines or medications to prevent or treat the disease. Therefore, early diagnosis and treatment are crucial for disease control. Currently, there are no commercially available test kits for Babesia duncanii, requiring laboratory testing. Commonly used laboratory diagnostic methods include blood smear microscopy, real-time quantitative PCR, conventional PCR, and clonal sequencing.

[0004] Blood smear microscopy is simple to perform and requires minimal equipment. However, it requires extensive experience and the ability to distinguish subtle morphological differences between Babesia and other protozoa. This leads to subjective diagnostic results, low detection rates, and the risk of false positives and missed detections. Real-time fluorescence quantitative PCR, conventional PCR, and cloning sequencing methods offer high sensitivity and accuracy, but require expensive equipment and high technical and experimental skills, as well as a solid foundation in molecular biology and bioinformatics, limiting their application to laboratory diagnostics. Therefore, a clinically relevant method for detecting Babesia Duncani antigens is urgently needed. Obtaining specific, high-affinity monoclonal antibodies is a prerequisite and foundation for developing a Babesia Duncani test. Furthermore, monoclonal antibodies have a wide range of applications in pathogenicity research and vaccine development.

[0005] Currently, there are no reports of monoclonal antibodies against Babesia duncanii either domestically or internationally. The research team at the State Key Laboratory of Agricultural Microbiology, where the applicant works, selected the aldolase (ALD) gene from Babesia duncanii. Bioinformatics analysis showed that this gene has good antigenicity and high expression levels, suggesting a promising application. Based on this guiding principle, the present invention cloned and expressed the aldolase (BdALD) gene from Babesia duncanii. Mice were immunized with recombinant rBdALD to generate hybridoma cells, which were then screened to obtain a high-affinity monoclonal antibody. Immunoblotting and immunofluorescence experiments verified that this antibody exhibited good specificity, high sensitivity, and excellent detection capabilities for Babesia duncanii. Summary of the Invention

[0006] The present invention aims to provide a monoclonal antibody against the ALD protein of Babesia duncanii and its use in diagnosing Babesia duncanii. The monoclonal antibody can specifically recognize the aldolase in the sugar metabolism pathway of Babesia duncanii and can specifically and sensitively identify Babesia duncanii.

[0007] The technical solution of the present invention is as follows:

[0008] First, the ALD gene of Babesia duncanii was cloned using cDNA from the wild-type strain of Babesia duncanii (frozen in liquid nitrogen in our laboratory) as a template. The gene was expressed in Escherichia coli and the recombinant protein, rBdALD, was extracted and purified. Next, mice were immunized with the rBdALD protein, and splenic lymphocytes from the immunized mice were fused with mouse myeloma cells to identify hybridoma cell lines that secreted monoclonal antibodies. Further screening with rBdALD and Babesia duncanii resulted in hybridoma cell lines that stably secreted high-affinity monoclonal antibodies. Finally, monoclonal antibodies were produced in large quantities from the hybridoma cells using the mouse ascites method. The antibodies were validated for detection of Babesia duncanii using indirect immunofluorescence, ultimately resulting in a monoclonal antibody that specifically and sensitively recognized Babesia duncanii.

[0009] The applicant named the cell line that stably secretes the monoclonal antibody hybridoma cell line 2A9, and deposited it in the China Center for Type Culture Collection of Wuhan University, Wuhan City, Hubei Province on August 26, 2024, with the deposit number CCTCC NO: C2024203.

[0010] SEQ ID NO: 1 is the nucleotide sequence of the ALD gene of Babesia duncanii, with a total length of 1071 bp.

[0011] SEQ ID NO: 2 is the amino acid sequence encoded by the ALD gene of Babesia duncanii, encoding a total of 356 amino acids.

[0012] The monoclonal antibody secreted by the hybridoma cell line 2A9 can be used to prepare a diagnostic kit for Duncan's Babesia.

[0013] The present invention further provides a diagnostic kit for Duncan's Babesia infection, which contains the monoclonal antibody secreted by the hybridoma cell line 2A9.

[0014] Furthermore, the kit is an indirect immunofluorescence kit for diagnosing Duncan's Babesia, and the kit also contains a blood smear, a washing solution, a blocking solution, a fluorescent secondary antibody, and a nuclear staining solution.

[0015] The present invention also provides an indirect immunofluorescence method for detecting Babesia duncanii, comprising the following steps:

[0016] 1) Preparation of worm-infected blood smears;

[0017] 2) Fix and permeabilize blood smears;

[0018] 3) closed blood smear;

[0019] 4) adding the monoclonal antibody to react;

[0020] 5) Add fluorescent secondary antibody for reaction;

[0021] 6) After staining the cell nuclei, observe them using a fluorescence microscope.

[0022] The indirect immunofluorescence method established by the present invention can be used for clinical diagnosis of Duncan Babesia infection, and can also be used for laboratory screening and identification of Duncan Babesia for non-disease diagnosis purposes.

[0023] The beneficial effects of the present invention are:

[0024] This invention, for the first time, uses the ALD protein of Babesia duncanii as an immunogen to generate a monoclonal antibody. The ALD protein is highly immunogenic and expressed in high levels, making it suitable as a molecular marker for the diagnosis of Babesia duncanii. The monoclonal antibody 2A9, obtained through screening, exhibits high affinity and specificity for the ALD protein. The indirect immunofluorescence assay developed offers advantages such as ease of use, a short detection cycle, and low cost. This invention provides a powerful tool for the clinical prevention and control of Babesia duncanii, a major zoonotic parasite, and is of great significance in preventing the occurrence of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : is the map of the pET-28a-BdALD recombinant plasmid constructed by the present invention.

[0026] Figure 2:Identification of recombinant rBdALD by Western blot. 1: rBdALD reacts with mouse positive serum; 2: rBdALD reacts with mouse negative serum.

[0027] Figure 3 : SDS-PAGE photos of five purified monoclonal antibodies. Lane: M. Reference protein; the upper arrow indicates the monoclonal antibody heavy chain band, and the lower arrow indicates the monoclonal antibody light chain band.

[0028] Figure 4 Western blot analysis of the specificity of five monoclonal antibodies. Lanes: M. reference protein; 2A9: Whole-zoan antigen of Babesia duncan reacts with 2A9 monoclonal antibody; 5F12: Whole-zoan antigen of Babesia duncan reacts with 5F12 monoclonal antibody; 5D3: Whole-zoan antigen of Babesia duncan reacts with 5D3 monoclonal antibody; 5H3: Whole-zoan antigen of Babesia duncan reacts with 5H3 monoclonal antibody; 5F1: Whole-zoan antigen of Babesia duncan reacts with 5F1 monoclonal antibody.

[0029] Figure 5 : Luminescence analysis of insects after incubation with five monoclonal antibodies. Monoclonal antibodies: five monoclonal antibodies obtained in this study; Hoechst: nuclear dye (blue); Merge: merging of two layers.

[0030] Figure 6 :The specificity of monoclonal antibodies was detected by indirect immunofluorescence. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following examples should also be deemed to fall within the scope of protection of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 1989), or are implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not specified in the examples are all commonly used materials well known in the art.

[0032] Example 1: Preparation of Babesia duncanii rBdALD recombinant protein

[0033] 1.1 Cloning and expression of the Babesia duncanii ALD gene

[0034] The corresponding gene was cloned using PCR primers. The cDNA of the WT strain of Babesia duncanii was used as a template and the target fragment was amplified using cloning primers (BdALD-F1 / BdALD-R1). After sequencing to confirm the correct sequence, the ALD target fragment and the pET-28a prokaryotic expression vector were double-digested with enzymes. After enzyme digestion, the fragments were ligated and identified using primers (BdALD-F2 / BdALD-R1) for prokaryotic expression.

[0035] The specific primer sequences are as follows (the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Wuhan Branch):

[0036] BdALD-F1 / BdALD-R1

[0037] Upstream primer: BdALD-F1:GCGC GGATCC ATGGTTGTTTTGTCTCAAGA (the underlined part is the BamH1 restriction site)

[0038] Downstream primer: BdALD-R1:GCTA CTCGAG GTAAATGTACTTGGCCTCGA (the underlined part is the XholI restriction site)

[0039] BdALD-F2 / BdALD-R1

[0040] Upstream primer: BdALD-F2:TAATACGACTCACTATAGGG

[0041] Downstream primer: BdALD-R1: GCTACTCGAGGTAAATGTACTTGGCCTCGA

[0042] The PCR reaction system for cloning the BdALD gene is as follows:

[0043]

[0044] PCR reaction conditions: 95°C for 3 min; 95°C for 15 sec, 52°C for 15 sec, 72°C for 1 min; 72°C for 5 min; 35 cycles.

[0045] The PCR product amplified with the BdALD-F1 / BdALD-R1 primers was recovered and digested with BamH1 and XholI. Simultaneously, the pET-28a plasmid (Merck Serono Co., Ltd., i.e., Merck) was also double-digested with BamH1 and XholI. The digested BdALD gene and the pET-28a plasmid were ligated with Ligation Mix to obtain a recombinant plasmid (pET-28a-BdALD). The plasmid map is shown in Figure 1 .

[0046] After transforming DH5α E. coli with the recombinant plasmid, incubate in a 37°C shaker (180 rpm) for 12 hours. After the extracted plasmid is verified and sequenced correctly using T7, transform it into BL21 E. coli and inoculate it into 6 mL of fresh Kan-resistant liquid culture medium at a ratio of 1:100. Incubate the culture in a 37°C shaker at 180 rpm overnight. After T7 verification and sequencing, transform the BL21 E. coli and culture it in LB liquid culture medium to an OD of 0.6. Take 1 mL of the culture medium as a pre-induction control. Simultaneously, add IPTG at a ratio of 1:1000 to induce expression of the target protein. Incubate the culture in a 37°C shaker for 3-4 hours. Take 1 mL of the culture medium for treatment. Samples were centrifuged at 8000 rpm for 2 minutes, the supernatant discarded, and the suspension resuspended in 30 μL of phosphate-buffered saline (PBS; formulation: 0.2 g KCl, 8 g NaCl, 1.44 g Na₂HPO₄, 0.24 g KH₂PO₄, 1000 mL distilled water, pH = 7.6) and 30 μL of loading buffer (1 mL 1 M Tris-HCl (pH = 6.8), 0.31 g 200 mM DDT, 0.4 g 4% SDS, 0.02 g 0.2% bromophenol blue, 2 mL 20% glycerol, 7 mL ultrapure water). The suspension was then boiled in 100°C water for 10 minutes. Expression was confirmed by SDS-PAGE gel electrophoresis.

[0047] 1.2 Purification of rBdALD protein

[0048] After inducing expression of recombinant BL21 E. coli as described above, the cell suspension was centrifuged at 8000 rpm for 10 minutes, the supernatant discarded, and the cells were washed once with 500 mL of PBS, centrifuged again at 8000 rpm for 10 minutes, and then washed again with 500 mL of PBS. The supernatant was discarded, the cells were resuspended in 30 mL of PBS, and then disrupted using a hydraulic disrupter. After disruption, the cells were centrifuged at 12000 rpm for 30 minutes. 40 μL of the supernatant was added to 50 μL of 2x loading buffer and 10 μL of DTT, vortexed to mix, and boiled in boiling water for 10 minutes as the supernatant. A small amount of the precipitate was added to 30 μL of PBS and 40 μL of loading buffer and boiled for 10 minutes as the precipitate. SDS-PAGE gel electrophoresis confirmed that the majority of rBdALD expression was in the supernatant.

[0049] Specifically, the purification steps are as follows:

[0050] (1) Add 4 mL of Ni-NTA metal chelated His protein purification medium to the affinity chromatography column;

[0051] (2) Add 12 mL of ddH2O to the affinity chromatography column for washing;

[0052] (3) Add 12 mL of His-binding buffer (NaCl 17.532 g, Tris-base 1.21 g, NaH2PO4·2H2O 7.8 g, dH2O to 1 L, adjust pH to 8.0) to equilibrate the column;

[0053] (4) Add protein expression supernatant filtered through a 0.45 μm pore size filter and collect the first few drops of filtered liquid, numbered 1;

[0054] (5) Add 50 mL of His-binding buffer to wash the column and collect the first few drops of liquid, numbered 2;

[0055] (6) Add 10 mL of different concentrations of imidazole (5%-100% imidazole gradient elution) (100% imidazole solution: 2.72 g imidazole dissolved in 100 mL His-Binding Buffer) to elute the target protein, and collect the first few drops, numbered 3;

[0056] (7) Add 50 μL of SDS loading buffer to each tube numbered 1 to 3 and boil for 10 min;

[0057] (8) Prepare an SDS-PAGE polyacrylamide gel and add 10 μL of the treated sample to each well for electrophoresis (DC voltage of 80 V for the stacking gel and 120 V for the separation gel). After electrophoresis, remove the gel and stain it with Coomassie Brilliant Blue overnight. Then destain to confirm that the purified target protein has been obtained.

[0058] 1.3 Identification of the reactogenicity of the recombinant protein rBdALD

[0059] The purified recombinant protein rBdALD was first subjected to SDS-PAGE electrophoresis and then transferred to a NC membrane at 110V. After 2 hours, the NC membrane was blocked with TBST-5% skim milk powder for 2 hours and washed 3 times with TBST for 5 minutes each. The NC membrane was placed in 1:100 diluted Babesia duncanii positive serum and negative serum, respectively, incubated at room temperature for 1 hour, and washed 3 times with TBST for 5 minutes each. The secondary antibody (1:5000 diluted goat anti-mouse IgG) was added, incubated at room temperature for 1 hour, washed 3 times with TBST for 5 minutes each, and then ECL was added for color development. Western blot results showed that the purified rBdALD reacted specifically with the positive serum at 40kDa, but did not react with the negative serum (see Figure 2 ).

[0060] Example 2: Preparation of monoclonal antibodies

[0061] 1.1 Immunization of mice

[0062] BALB / C mice were immunized with the Babesia duncanii rBdALD antigen prepared above, and the immunization procedure was as follows:

[0063] (1) On day 0, blood was collected and serum was collected as negative serum. For the primary immunization, 80 μg of Babesia duncanii rBdALD antigen per mouse was added with Freund's complete adjuvant and injected subcutaneously at multiple points on the back of the neck, 0.2 mL per mouse.

[0064] (2) On day 14, the first booster immunization was performed with 80 μg / mouse of Babesia duncanii rBdALD antigen plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0065] (3) On day 28, the second booster immunization was performed with 80 μg / mouse of Babesia duncanii rBdALD antigen plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0066] (4) On day 42, the third booster immunization was performed with 80 μg / mouse of Babesia duncanii rBdALD antigen plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0067] (5) After 50 days, serum was collected and titered using an indirect ELISA method. The plate was coated with the rBdALD antigen of Babesia duncanii, and diluted mouse serum was added and incubated at 37°C. After washing, the plate was added with HRP-labeled goat anti-mouse secondary antibody (purchased from Southern Biotech) and incubated at 37°C. After washing, TMB substrate was added for color development. The plate with the highest titer was selected for continued immunization for fusion.

[0068] (6) Day 54: Pre-fusion shock immunization: Babesia duncanii rBdALD antigen dose 50 μg / mouse, direct intraperitoneal injection, 0.2 mL / mouse.

[0069] (7) On day 57, spleen cells were harvested and prepared for fusion.

[0070] 1.2 Preparation of hybridoma cells: PEG-mediated fusion method

[0071] Preparation of SP2 / 0 tumor cells:

[0072] (1) Cryopreserved SP2 / 0 tumor cells were centrifuged at 1000 rpm to remove the freezing solution and then revived with 1640 basal medium (containing 20% ​​fetal bovine serum, 1% double-antibody storage solution, final concentrations: streptomycin 100 μg / mL, penicillin 100 μg / mL). The cells were added to a T25 cell culture flask and cultured at 37°C in an atmosphere of 5% CO2 and saturated humidity.

[0073] Preparation of feeder cells:

[0074] (1) Take a 6-8 week old non-immunized BALB / C mouse, remove the eyeball and bleed it, then kill the mouse and soak it in 75% alcohol solution for 5 minutes. The collected serum is the negative serum.

[0075] (2) Fix the mouse's limbs and cut the skin with ophthalmic scissors and ophthalmic forceps; use another set of ophthalmic scissors and ophthalmic forceps to cut a small opening in the peritoneum, add 3 mL of basal culture medium, blow and beat a few times, aspirate and place into a sterilized 50 mL conical bottom centrifuge tube, which is the peritoneal macrophage.

[0076] (3) Fix the mouse's limbs, cut the peritoneum with ophthalmic scissors and ophthalmic forceps, remove the spleen and place it in a dish filled with incomplete culture medium, gently wash it, and peel off the surrounding connective tissue.

[0077] (4) Move the spleen to another dish filled with incomplete culture medium, punch a hole in the spleen with a syringe, and gently blow the culture medium with a syringe until only a layer of skin is left on the spleen. Resuspend the cells in HAT culture medium and count them until the cell density reaches 1×10 5 100 μL of cell suspension was added to a 96-well cell culture plate for culture.

[0078] (5) Transfer the spleen cell suspension in the plate to a centrifuge tube. Filter the cell suspension using a 100-200 mesh cell sieve, centrifuge at 1000 rpm for 10 minutes, and discard the supernatant.

[0079] (6) Resuspend the precipitate with the previously prepared HAT complete medium (20% fetal bovine serum + 1% double antibody (streptomycin and penicillin) + 1 / 50 volume of HAT (50×) + 1640 basal medium) (i.e. feeder cell culture medium), and 5 / hole use.

[0080] Preparation of splenocytes from immunized mice:

[0081] The boosted mice were sacrificed by cervical dislocation, and the spleens were removed and splenocytes were prepared using the same procedures as for preparing splenocytes from feeder cells. Finally, the spleens were resuspended in 1640 basal medium for later use.

[0082] Cell fusion:

[0083] (1) Resuspend SP2 / 0 cells and immune mouse spleen cells in incomplete medium 1640 and count them using a cell counter. Add the immune mouse spleen cells and myeloma SP2 / 0 cells to a 50 mL centrifuge tube at a ratio of 5:1-10:1 and centrifuge at 1000 rpm for 10 minutes. Prepare warm water at approximately 37°C.

[0084] (2) After centrifugation, discard the supernatant and the liquid on the tube wall (which can be dried with sterilized paper). Gently tap the precipitate from the centrifugation of the SP2 / 0 and immune mouse mixture to loosen it, and immerse the bottom of the centrifuge tube in 37°C warm water.

[0085] (3) Take out 1 ml of the incubated fusion agent PEG 1450 from the incubator and evenly add it to the mixed cell pellet within 60 seconds (stir gently while adding).

[0086] (4) After addition, continue to stir gently for 30 seconds and let it stand for 1 minute. Then slowly add 10 mL of RPMI-1640 basal medium preheated at 37°C. Add 1 mL dropwise in the first minute, 1 mL in the second minute, 3 mL in the third to fourth minute, and 5 mL in the fifth minute. Stir gently each time. Finally, slowly add 30 mL of RPMI1640 basal medium.

[0087] (5) After gently inverting to mix, centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the pellet with feeder cell solution.

[0088] (6) Use a spray gun to evenly spread the resuspended liquid into a 96-well cell culture plate, 100 μl / well, and place it in a 5% CO2, 37°C incubator for culture.

[0089] On the second day, observe for contamination. On the fourth day, add one drop of HAT medium. On the 8th to 10th day, remove 100 μL of medium from each well and replace it with 100 μL of HT medium.

[0090] 1.3 Screening of hybridoma cells

[0091] Antibody detection was performed using an indirect ELISA method. Recombinant protein rBdALD was coated at 500 ng per well and incubated overnight at 4°C. The next day, the wells were removed and washed three times with PBST (phosphate-buffered saline containing 0.5% Tween-20). After patting dry, the wells were blocked with 5% BSA in a 37°C incubator for 1 hour and then washed three times with PBST. 100 μL of hybridoma cell supernatant was added, and SP2 / 0 cell supernatant was set as a control group. The cells were incubated at 37°C for 60 min, washed 3 times with PBST, and 1:5000 diluted goat anti-mouse IgG-HRP was added. The cells were incubated at 37°C for 60 min, washed 5 times with PBST, and 100 μL / well of color development solution (Biosharp) (substrate buffer: TMB stock solution = 19:1, and 30% H2O2 0.2 μL / ml) was added. The cells were developed in the dark for 10 min, and 50 μL of stop solution (0.25% HF) was added to each well to terminate the reaction. The OD value was measured at a wavelength of 630 nm using a microplate reader.

[0092] Cloning of hybridoma cells:

[0093] (1) Prepare mouse feeder cells and plate them into 96-well plates.

[0094] (2) Gently blow off the hybridoma cells to be cloned with a 200 μL pipette tip and count them.

[0095] (3) The cells were diluted to three concentrations with HT complete medium (20% fetal bovine serum + 1% double antibody (streptomycin and penicillin) + 1 / 50 volume of HT (50×) + 1640 basal medium), i.e., 50, 10, and 5 cells per milliliter of culture medium. The three concentrations of cell suspension were added to 96-well cell culture plates at 100 μl / well, so that each well contained 5, 1, and 0.5 cells, respectively.

[0096] (4) On the 4th day, the cell suspension was replaced once, and the cell growth in each well was observed and recorded.

[0097] (5) On the 7th to 10th day, when the cells have grown to 1 / 5-1 / 3 of the visual field, the antibody titer of the hybridoma cells is tested, and the wells with high antibody titer, good colony morphology, and single colony growth are selected to continue monocloning.

[0098] (6) After three subclonings, the positive hybridoma cells were transferred to a 24-well cell culture plate and cultured. HT medium was added to the original wells. When the cells in the 24-well plate grew well, the hybridoma cells were frozen.

[0099] Cryopreservation and thawing of hybridoma cells:

[0100] (1) Cryopreservation of hybridoma cells

[0101] It is very important to freeze the hybridoma cells in the original well and the subcloned cells obtained in each cloning. The freezing method of hybridoma cells is the same as that of other cell lines. In principle, the cell volume of each cryopreservation tube should be 1×10 6 The number of hybridoma cells in the original well may vary depending on the culture environment. The formula for cell freezing solution (volume ratio) is: 90% fetal bovine serum, 10% DMSO (dimethyl sulfoxide). It is best to pre-chill the freezing solution, and be gentle and quick when handling. For freezing, the temperature can be immediately lowered from room temperature to 0°C, then placed in a -70°C ultra-low temperature freezer and transferred to liquid nitrogen the next day. Cryopreservation can also be performed using a cell freezing device. Frozen cells should be regularly revived to check cell activity and the stability of secreted antibodies. Cells can be stored in liquid nitrogen for several years or longer.

[0102] (2) Cell recovery method

[0103] Carefully remove the cryovial from liquid nitrogen and place it in a 37°C water bath. Thaw the frozen cells within 1 minute. Wash the cells twice with 1640 basal medium and culture them in a 37°C, 5% (v / v) CO2 incubator. When the cells form colonies, assay for antibody activity.

[0104] Scale-up preparation of monoclonal antibodies (in vivo ascites induction method):

[0105] Preparation of ascites: First, 0.5 mL of Freund's incomplete adjuvant was injected intraperitoneally into BALB / C mice. Seven days later, 1×10 6 Ascites will develop 10 days after inoculation of the hybridoma cells. Closely monitor the animal's health and signs of ascites. Once ascites has accumulated as much as possible and before the mouse dies, sacrifice the mouse and aspirate the ascites into a test tube using a syringe. Typically, 5 to 10 mL of ascites can be obtained from one mouse, and this can be collected repeatedly. The monoclonal antibody content in the ascites can reach 5 to 10 mg / mL. This is currently the most commonly used method. Alternatively, the cells in the ascites can be frozen and, after thawing, transferred into the peritoneal cavity of mice. This results in faster and more abundant ascites.

[0106] 1.4 Purification and identification of monoclonal antibodies

[0107] 1.4.1 Monoclonal Antibody (MAB) Purification

[0108] (1) Take an appropriate amount of Protein G suspension, load it into the chromatography column, and wash the equilibrated column with 10 column volumes of equilibration / wash buffer (0.15 M NaCl, 20 mM Na2HPO4, pH 7.0).

[0109] (2) After high-speed centrifugation of the antibody-containing ascites, mix the supernatant with the equilibration / washing buffer, adjust the pH and ion concentration, and slowly add it to the chromatography column.

[0110] (3) Wash with 10-15 column volumes of equilibration / wash buffer to remove non-specifically adsorbed contaminants until no protein is detected in the effluent.

[0111] (4) Use 5-10 column volumes of elution buffer (0.1 M glycine, pH 3.0), clamp the outflow tube, let it stand for 5 minutes, and then collect the effluent. Repeat three times.

[0112] (5) The eluted antibody was neutralized by adding 2 / 5 volume of neutralizing solution (1 M Tris-HCl, pH 8.5).

[0113] (6) The antibody was concentrated to the required volume using a 10K ultrafiltration tube, the concentration was determined, and the antibody was stored at -20°C.

[0114] (7) The concentration of the purified monoclonal antibody was measured using a BCA protein test kit (purchased from Biyuntian Company) and the monoclonal antibody was identified by SDS-PAGE. The results are shown in Figure 3 .

[0115] 1.4.2 Identification of monoclonal antibody specificity using Western blot

[0116] Whole-worm protein of Babesia duncanii and purified rBdALD were subjected to SDS-PAGE electrophoresis and semi-dry transferred to nitrocellulose membrane (110 V, 2 h). The membrane was blocked with 5% skim milk at room temperature for 2 h, washed three times with TBST, and incubated overnight at 4°C with purified monoclonal antibodies 2A9 (3.6 mg / mL), 5F12 (1.5 mg / mL), 5D3 (8.5 mg / mL), 5H3 (4.7 mg / mL), and 5F1 (1.8 mg / mL) as primary antibodies. The membrane was washed three times with TBST and incubated with 1:2000 diluted HRP-goat anti-mouse IgG for 1 hour. The membrane was washed three times with TBST and then washed three times with TBS, and developed by ECL chemiluminescence. The results showed that all five monoclonal antibodies could react with the whole-worm antigen of Babesia duncanii, but only 2A9 produced a specific target band, which could recognize the purified rBdALD (40 kDa) and the 40 kDa protein in Babesia duncanii, with good specificity; 5F12, 5D3, 5H3, and 5F1 produced non-target bands, and had low affinity with the whole-worm antigen of Babesia duncanii ( Figure 4 ).

[0117] Example 3: Identification of Babesia Duncanii using indirect immunofluorescence

[0118] Blood smears were prepared from 1 μL of Babesia duncanii-infected blood, fixed with paraformaldehyde at room temperature for 30 minutes, and then permeabilized with 0.5% Triton X-100 for 5-10 minutes; washed three times with PBS, and blocked with PBS containing 3% (m / v) bovine serum albumin (BSA, purchased from Sigma) for 30 minutes at 37°C; washed three times with PBS, and then 2A9, 5F12, 5D3, 5H3, and 5F1 monoclonal antibodies diluted in PBS containing 3% (m / v) BSA were added, and incubated overnight at 4°C; washed three times with PBS, and then 488-labeled goat anti-mouse IgG fluorescent secondary antibody diluted in PBS containing 3% (m / v) BSA was added, and incubated at 37°C for 1 hour; washed three times with PBS, and cell nuclei were stained with Hoechst for 10 minutes at room temperature; washed three times with PBS, and then mounted with an anti-fluorescence quencher, and the experimental results were observed under an upright fluorescence microscope. The nucleus of Babesia Duncanii appears blue (Hoechst), and the ALD of Babesia Duncanii appears green when stained with the BdALD monoclonal antibody. Superposition of the two reveals the blue nucleus of Babesia Duncanii in red blood cells and the ALD protein present in the cytoplasm of Babesia Duncanii (Merge).

[0119] like Figure 5 As shown in the image analysis, observations and statistics under an upright fluorescence microscope revealed that monoclonal antibody 2A9 achieved a luminescence efficiency of 92.9%, making it suitable as a molecular marker for identifying the cytoplasm of Babesia Duncanii. Although monoclonal antibodies 5H3, 5D3, and 5F12 also recognized the cytoplasm of Babesia Duncanii, their affinity was low and their luminescence efficiency was lower. Monoclonal antibody 5D3 had a luminescence efficiency of 35.2%, monoclonal antibody 5F12 had a luminescence efficiency of 13.3%, and monoclonal antibody 5H3 had a luminescence efficiency of 22.2%. Monoclonal antibody 5F1 did not recognize the cytoplasm of Babesia Duncanii. Therefore, 2A9 was ultimately selected as the molecular marker for identifying the cytoplasm of Babesia Duncanii.

[0120] In addition, 1 μL of blood infected with Babesia duncanii and 1 μL of blood infected with Babesia gibsoni were used to prepare blood smears, and the above-mentioned method was used with 2A9. The experimental results were observed under an upright fluorescence microscope. Figure 6 As shown, the nuclei of Babesia duncanii and Babesia gibsoni appear blue (Hoechst), and the BdALD monoclonal antibody 2A9 stains the ALD of Babesia duncanii in green (2A9). Superposition of the two reveals the blue nuclei of Babesia duncanii in red blood cells and the ALD protein present in the cytoplasm of Babesia duncanii (Merge), while the ALD of Babesia gibsoni stained with the BdALD monoclonal antibody 2A9 does not show green fluorescence (2A9).

Claims

1. A monoclonal antibody against the Babesia duncani ALD protein, secreted by the hybridoma cell line 2A9. The hybridoma cell line 2A9 was deposited with the China Center for Type Culture Collection under the accession number CCTCC NO: C2024203. The amino acid sequence of the ALD protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

1.

2. A hybridoma cell line 2A9 was deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: C2024203.

3. A method for preparing the monoclonal antibody according to claim 1, characterized in that: The monoclonal antibody is prepared in large quantities by using the hybridoma cell line 2A9 with the deposit number CCTCCNO: C2024203 and the ascites induction method in mice.

4. Use of the monoclonal antibody according to claim 1 in the preparation of a diagnostic kit for Duncan's Babesia.

5. A diagnostic kit for Duncan's Babesia, comprising the monoclonal antibody according to claim 1.

6. The diagnostic kit according to claim 5, wherein: This kit is an indirect immunofluorescence kit for diagnosing Duncan's Babesia. The kit also contains blood smear, washing solution, blocking solution, fluorescent secondary antibody and nuclear staining solution.

7. The diagnostic kit according to claim 6, wherein: The fluorescent secondary antibody is 488-labeled goat anti-mouse IgG, and the nuclear staining solution is Hoechst.

8. A method for detecting Babesia duncanii for non-diagnostic purposes, characterized in that The following steps are involved: 1) Preparation of worm-infected blood smears; 2) Fix and permeabilize blood smears; 3) closed blood smear; 4) adding the monoclonal antibody according to claim 1 for reaction; 5) Add fluorescent secondary antibody for reaction; 6) After staining the cell nuclei, observe them using a fluorescence microscope.

Citation Information

Patent Citations

  • Monoclonal antibody resistant to vole babesia and application thereof

    CN108314735A

  • Babesia mocroti antigen proteins 2D33 and 2D36 and application of Babesia mocroti antigen proteins

    CN109371043A