Diagnosis and treatment integrated nano antibody for targeting shrimp iridovirus deoxyuracil nucleoside triphosphate hydrolase as well as preparation method and application of diagnosis and treatment integrated nano antibody

Abstract

The invention discloses a diagnosis and treatment integrated nano antibody for targeting shrimp iridovirus deoxyuracil nucleoside triphosphate hydrolase as well as a preparation method and application of the diagnosis and treatment integrated nano antibody. According to the invention, a nano-antibody library is constructed on the basis of a squalus leukoderma new antigen receptor variable fragment VNAR, a nano-antibody 4A12-coated VNAR targeting shrimp iridovirus deoxyuracil nucleoside triphosphate hydrolase dUTPase protein is screened from the nano-antibody library, the nucleotide sequence of the nano-antibody 4A12-coated VNAR is shown as SEQ ID No.5, and the amino acid sequence of the nano-antibody 4A12-coated VNAR is shown as SEQ ID No.6. The invention further discloses a preparation method of the nano-antibody 4A12-coated VNAR. The molecular weight of the nano antibody 4A12atVNAR is much smaller than that of a conventional full-length antibody, and the nano antibody 4A12atVNAR has better tissue permeability and capability of being combined with an epitope with a steric hindrance effect, can be massively expressed in a prokaryotic expression system, and is short in period and low in production cost. The nano antibody 4A12-coated VNAR can be used for detection, diagnosis and treatment of shrimp iridovirus.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical engineering technology, and specifically relates to a diagnosis and treatment integrated nano-antibody targeting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase, and a preparation method and application thereof. Background Art

[0002] Decapod iridescent virus 1 (DIV1) is one of the pathogens that infect shrimps and crabs. It belongs to a new genus under the family Iridoviridae, the genus Decapoda Iridescent Virus. DIV1 not only has a wide range of prevalence and distribution, but also a wide range of susceptible hosts. It has an acute onset, strong infectivity, and a high mortality rate, which has caused huge economic losses to the aquaculture industry. According to the disease diagnosis of DIV1 infection published by the World Organization for Animal Health (Office international desépizooties, OIE), there are currently six shrimp species that are susceptible to DIV1, namely Penaeus vannamei, Macrobrachium rosenbergii, Exopalaemon carinicauda, ​​M. nipponense, Procambarus clarkii, and Cherax quadricarinatus. In addition to being detected in artificially cultured crustaceans, DIV1 has also been found in wild animals. In addition to the symptoms and histopathological observation and analysis of diseased shrimp and crabs, molecular biological methods are currently mainly used to diagnose decapod iridovirus diseases, and the targets are mainly the genes encoding the main capsid protein and ATPase of DIV1. These methods include PCR, qPCR, LAMP, qLAMP, RPA, qRPA, etc., and no immunological diagnostic methods have been reported. Current research on DIV1 mainly focuses on the investigation of susceptible hosts, the immune mechanism of host response to DIV1 infection, and omics analysis. It is in the preliminary research stage, and many mechanisms, including viral protein interactions and infection mechanisms, have not yet been revealed. In addition, there is a lack of drugs and treatments to prevent and treat DIV1 infection.

[0003] Deoxyuridine triphosphate nucleotidohydrolase is an enzyme widely present in various organisms, also known as deoxyuridine triphosphatase (dUTPase). Its main function is to remove deoxyuridine triphosphate (dUTP) from cells to prevent it from being incorrectly incorporated into DNA chains, causing mutations or DNA damage. dUTPase is essential for maintaining the balance of intracellular nucleotide pools and ensuring the accuracy and integrity of DNA replication. It has been used as a drug target to play a therapeutic role in Mycobacterium tuberculosis and Plasmodium falciparum.

[0004] Antibodies are immunoglobulins produced by B cells that differentiate into plasma cells under antigen stimulation, and they can specifically bind to the corresponding antigens. Whether in the field of biotechnology or in the diagnosis and treatment of diseases, antibodies play a wide and important role, and related research fields have become research hotspots. The advantages of antibodies are mainly reflected in their high specificity, diversity, and targeted specificity. However, with the deepening of research, their natural limitations have also become prominent: ① Antibodies are large in size and have poor penetration into tissues and solid tumors; ② The small Fv region of the antigen binding site will lead to unstable binding of light and heavy chains, and the recombinant expression step is too difficult, which restricts its scope of application; ③ The Fv region is composed of 6 antibody variable regions of heavy and light chains, and the structural diversity is limited when preparing a fully synthetic antibody library; ④ Glycosylated antibody drugs must be expressed in eukaryotic cell lines, which has a long cycle and high cost. As a biologically active macromolecule, the stability of antibodies also has its own limitations. In many cases, such as temperature changes, high protein concentration, pH, and long-term storage, it will denature or aggregate, which will not only affect its biological activity, but also cause granular substances or precipitation caused by aggregation to cause immunogenicity in clinical use, which brings great risks to patients. Therefore, in the field of biopharmaceuticals, it is very necessary to control the occurrence of aggregation or denaturation, which is also a guarantee for the better development of antibody drugs. Natural antibodies usually have a Y-shaped structure, consisting of two heavy chains and two light chains. In 1993, heavy chain antibodies VHH, which naturally lack light chains and are composed only of heavy chain dimers, were first discovered in camels; after 1995, antigen receptors similar to heavy chain antibodies (new or nurse shark antigen receptor, NAR) without light chains or other protein molecules were also discovered in cartilaginous fish such as nurse sharks, whitebait sharks, spiny dogfish, rays and stingrays. Since NAR molecules are similar to Ig subtypes in several functional features such as transmembrane and secretion, they are also called immunoglobulin new antigen receptors (Immunoglobulin new antigen receptor, IgNAR), which usually contain 1 variable region and 5 constant regions. Compared with the heavy chains of antibodies of other species, the position of the disulfide bonds of IgNAR is different, and CDR3 has one more ring and no FR2-CDR2 fragment, so the molecular weight of IgNAR is slightly smaller. These differences give IgNAR excellent stability and permeability. Because they live in the ocean, shark blood contains 350mM urea to prevent sharks from dehydration, which makes all the proteins in shark blood inherently very stable and allows IgNAR to still function in extreme environments.

[0005] The variable region of the heavy chain antibody in cartilaginous fish is called the variable domain of the shark New Antigen Receptor (VNAR ), using genetic engineering technology, the antigen-binding flexible variable region of IgNAR can be expressed as an independent soluble protein, called shark single-domain antibody. NAR It is a unique type of antibody in the shark immune system, with a small molecular weight (only about 12kDa), which is significantly different from the traditional antibody structure of mammals. It is also called shark nanoantibodies (Nbs). NAR Its small molecular weight and unique folding pattern make it an ideal drug delivery carrier and diagnostic reagent development target.

[0006] Shark Nanobody V NAR With small molecular weight and strong solubility, V can pass through the blood-brain barrier and enter epitopes with steric hindrance (such as grooves, cracks, etc.) to bind to antigens more effectively. It is also easier to penetrate into solid tissues such as tumors, playing an important role in scientific research and drug research. NAR Library technology has successfully obtained V from immune, natural, semi-synthetic and artificial NAR A series of highly specific antibodies were screened from the library. Shark nanobodies are naturally very stable. The variable region fragment V NAR Not only can it be highly expressed in prokaryotes and maintain a certain solubility and stability, it is also suitable for preparation using technologies such as phage display or ribosome display. It is also easy to prepare and can be used to construct antibodies with effective functions and binding affinity, and has certain development prospects.

[0007] Therefore, shark nanobody V NAR It can be used to detect viral infection at an early stage, which helps to take timely prevention and control measures, achieve highly specific detection and treatment of shrimp iridovirus, reduce the risk of infection transmission, promote precise intervention and environmentally friendly aquaculture, and ensure the economic benefits of the aquaculture industry. NAR With good biocompatibility and degradability, its application in aquaculture has little impact on the environment, reduces dependence on traditional antibiotics or chemical drugs, helps promote sustainable aquaculture development, and improves the disease resistance and sustainability of the aquaculture industry. Shark nanoantibodies not only have important scientific significance in the detection and treatment of shrimp iridovirus, but also provide necessary technical support for the healthy development of the aquaculture industry. Summary of the invention

[0008] The purpose of the present invention is to provide a diagnostic and therapeutic nanobody targeting shrimp iridovirus deoxyuridine triphosphate hydrolase and its preparation method and application. The method established by the present invention will help screen nanobodies targeting shrimp iridovirus protein targets and can be applied to the rapid diagnosis and therapeutic drug development of shrimp iridovirus.

[0009] To achieve the above object, the present invention adopts the following technical solution:

[0010] The present invention first selects the variable region fragment V of the new antigen receptor of the white scalloped squirrel NAR As a nanobody framework, the nanobody framework V NAR The amino acid sequence is shown in SEQ ID No.4; the nanobody skeleton V NAR It has two complementary determining clusters CDR1 and CDR3; the amino acid sequence of the CDR1 is the 26th to 33rd positions of SEQ ID No.4, and the amino acid sequence of the CDR3 is the 86th to 92nd positions of SEQ ID No.4.

[0011] Based on the nanobody backbone V NAR A method for preparing a nanoantibody library, comprising the following steps:

[0012] (1) Splicing out V through primer amplification NAR Nanobody gene fragments with a backbone are connected and inserted into a shuttle vector to form a nanobody gene library;

[0013] (2) The nanobody gene library was electroporated into competent E. coli cells, and the helper phage M13KO7 was used to infect the E. coli carrying the nanobody gene library to obtain the phage surface displayed nanobody library, and the library capacity of the phage surface displayed nanobody library was evaluated.

[0014] Based on the construction of V NAR Nanoantibody library screened a nanoantibody 4A12@V targeting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein NAR The nucleotide sequence is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.6.

[0015] The nanoantibody 4A12@V targeting the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein NAR The preparation method comprises the following steps:

[0016] (1) constructing a prokaryotic expression vector containing the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein gene sequence, expressing the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein, and isolating and purifying the protein dUTPase;

[0017] (2) Using purified dUTPase protein as antigen, use V NARScreening the phage surface display nanoantibody library of the backbone, and obtaining a high-affinity specific binding nanoantibody clone through multiple rounds of panning;

[0018] (3) Express and purify the nanoantibody clone to obtain the high-affinity nanoantibody 4A12@V targeting the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein NAR , the nanobody 4A12@V NAR The amino acid sequence of the nanobody 4A12@V NAR It has two antigen binding regions, CDR1 and CDR3, wherein the amino acid sequence of the CDR1 is the 26th to 35th positions of SEQ ID No.6, and the amino acid sequence of the CDR3 is the 88th to 97th positions of SEQ ID No.6.

[0019] The present invention also provides an antigen-binding fragment or antibody derivative, which is the following A1) or A2):

[0020] A1): an antigen-binding fragment or antibody derivative with an amino acid sequence as shown in SEQ ID No.6;

[0021] A2): An antigen-binding fragment or antibody derivative obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No.6.

[0022] The present invention also provides a biomaterial, which is any one of the following:

[0023] B1): Encoding the antibody 4A12@V according to claim 3 NAR Or a nucleic acid molecule encoding the antigen-binding fragment or antibody derivative according to claim 5;

[0024] B2): an expression cassette containing the nucleic acid molecule described in B1);

[0025] B3): a recombinant vector containing the nucleic acid molecule described in B1);

[0026] B4): a recombinant vector containing the expression cassette described in B2);

[0027] B5): A recombinant microorganism containing the nucleic acid molecule described in B1);

[0028] B6): A recombinant microorganism containing the expression cassette described in B2);

[0029] B7): a recombinant microorganism containing the recombinant vector described in B3);

[0030] B8): A recombinant microorganism containing the recombinant vector described in B4).

[0031] Furthermore, B1) the protein corresponding to the nucleic acid molecule has two antigen binding regions CDR1 and CDR3, the coding gene of CDR1 is nucleotides 76-105 of SEQ ID No.5; the coding gene of CDR3 is nucleotides 262-291 of SEQ ID No.5.

[0032] Furthermore, the nucleic acid molecule described in B1) is any one of the following:

[0033] C1): a DNA molecule having a nucleotide sequence as shown in SEQ ID No. 5;

[0034] C2): hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the nanobody 4A12@V NAR DNA molecules;

[0035] C3): A DNA sequence having more than 80% homology with any of the DNA sequences defined in C1) or C2) and encoding the nanobody 4A12@V NAR of DNA molecules.

[0036] Furthermore, the method for preparing the antigen-binding fragment or antibody derivative comprises the following steps: introducing a nucleic acid molecule encoding the antigen-binding fragment or antibody derivative into a recipient cell to obtain a transgenic cell expressing the antigen-binding fragment or antibody derivative, and culturing the transgenic cell to obtain the antigen-binding fragment or antibody derivative, wherein the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No.5.

[0037] The present invention also provides an ELISA detection kit targeting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein, the kit comprising the antibody 4A12@V NAR , or contains the antigen-binding fragment or antibody derivative, or contains the biological material.

[0038] The present invention also provides any of the following applications:

[0039] D1): Antibody 4A12@V NAR , or the antigen-binding fragment, or the biological material, or the kit in the preparation of a product for detecting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein;

[0040] D2): Antibody 4A12@V NAR , or the antigen-binding fragment, or the biological material, or the kit in the preparation of a product that binds to shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein;

[0041] D3): Antibody 4A12@V NAR Or use of the antigen-binding fragment in preparing a shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein detection reagent;

[0042] D4): Antibody 4A12@V NAR Or use of the antigen-binding fragment in the preparation of shrimp iridovirus diagnostic reagents;

[0043] D5): Antibody 4A12@V NAR Or the use of the antigen binding fragment in the preparation of drugs for preventing and / or treating shrimp iris virus.

[0044] The nanobody provided by the present invention is a nanobody V displayed on the surface of a bacteriophage. NAR High-affinity nanoantibody 4A12@V targeting shrimp iris virus deoxyuridine triphosphate hydrolase dUTPase protein screened from the library NAR , has therapeutic effects and can be used for the detection, diagnosis and treatment of shrimp iris virus. Nanobody 4A12@V NAR Compared with conventional full-length antibodies (molecular weight of about 150 kDa), the nanoantibody 4A12@V screened by the present invention has a much smaller molecular weight, better tissue permeability and the ability to bind to antigenic epitopes with steric hindrance effects, and can be expressed in large quantities in a prokaryotic expression system, with a short cycle and low production cost. NAR It has a high affinity for the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein (EC 50 ≈180nM), and it is a specific binding, with good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a protein detection image of the purified dUTPase protein of shrimp iris virus DIV1; (A) SDS-PAGE gel image; (B) Western Blotting image.

[0046] Figure 2 It is a novel antigen receptor variable region fragment V of the spiny dogfish NAR Analysis of antigenic complementarity determining clusters CDR1 and CDR3.

[0047] Figure 3 It is a nanobody V displayed on the surface of phage NAR Library construction; (A) V NAR Nanobody library dilution 10 8 Colonies on the plate after multiple smearing; (B) V NAR Nanobody library dilution 109 Colonies on the plate after multiple smearing; (C) V NAR Nanobody library dilution 10 10 After multiple counts, spread the colonies on the plate.

[0048] Figure 4 4A12@V is a dUTPase protein targeting shrimp iridovirus DIV1 NAR Protein detection diagram after purification of nanoantibody (containing FLAG tag); (A) SDS-PAGE gel image; (B) Western Blotting image.

[0049] Figure 5 ELISA assay for nanoantibody 4A12@V NAR Binds to the dUTPase protein of shrimp iridovirus DIV1.

[0050] Figure 6 It is the nanobody 4A12@V NAR Effect of treating shrimp infected with iridovirus DIV1; (A) Survival rate of Penaeus vannamei after infection with different concentration gradients of iridovirus DIV1; (B) Nanoantibody 4A12@V NAR Survival rate of Penaeus vannamei infected with iridovirus DIV1 treated with inactivated nanoantibody 4A12@V NAR and PBS as negative control. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0052] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0053] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0054] SEQ ID No.1: dUTPase nucleotide sequence of iridovirus DIV1

[0055] SEQ ID No.2: Amino acid sequence of dUTPase of iridovirus DIV1

[0056] SEQ ID No.3: Variable region fragment V of the new antigen receptor of white scalloped squidNAR The nucleotide sequence

[0057] SEQ ID No.4: Variable region fragment V of the new antigen receptor of white scalloped shark NAR The amino acid sequence

[0058] SEQ ID No.5: Nanobody 4A12@V targeting dUTPase protein of shrimp iridovirus DIV1 NAR The nucleotide sequence

[0059] SEQ ID No.6: Nanobody 4A12@V targeting dUTPase protein of iridovirus DIV1 NAR The amino acid sequence

[0060] SEQ ID No.7: Nucleotide sequence of FLAG tag

[0061] SEQ ID No.8: Amino acid sequence of FLAG tag

[0062] Example 1 Expression and purification of dUTPase protein of shrimp iridovirus DIV1

[0063] Codon optimization was performed according to the amino acid sequence of the dUTPase protein of shrimp iris virus DIV1 (GenBank: ATE87147.1), and the base sequence after codon optimization is shown in SEQ ID No. 1; the base sequence after codon optimization was inserted between the restriction enzyme sites BamHI and XhoI of the vector pET-28a (+) (Novagen, catalog number: 69864), and the prokaryotic expression vector pET28a-dUTPase was constructed by ligation.

[0064] The nucleotide sequence (ie, coding sequence) of pET28a-dUTPase is the dUTPase codon-optimized nucleotide sequence of SEQ ID No. 1 in the sequence list, and the expressed amino acid sequence is the fusion protein with a histidine tag at the C-terminus of SEQ ID No. 2 in the sequence list.

[0065] 10 ng of the recombinant vector pET28a-dUTPase was transformed into Escherichia coli BL21 (DE3) competent cells (NEWENGLAND Biolabs, catalog number: C2527H), and positive clones were screened by kanamycin. After verification by PCR or enzyme digestion or sequencing, the successfully verified positive clone recombinant strain was named BL21-pET28a-dUTPase.

[0066] The recombinant strain BL21-pET28a-dUTPase was inoculated into LB liquid medium (Luria-Bertani broth, containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) containing kanamycin at a final concentration of 50 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.2 mmol / L and induce at 25°C and 200 rpm for 12-16 hours. Centrifuge at 4°C and 6000 rpm for 20 minutes to collect the induced protein-expressing bacteria, and resuspend the bacterial precipitate in PBS buffer. Ultrasonicate the bacteria in an ice-water bath, centrifuge at 4°C and 12000 rpm for 30 minutes to collect the supernatant, and after affinity binding with Ni-NTA filler, elute the purified protein through an imidazole gradient, and dialyze to remove the imidazole.

[0067] The purity of the purified protein was verified by SDS-PAGE. The protein obtained by purification and elution from the supernatant of the recombinant strain BL21-pET28a-dUTPase bacterial solution after disruption contained a clear target protein size band ( Figure 1 A), and the purified protein was verified by Western Blotting to obtain the DIV1 dUTPase protein (theoretical molecular weight of about 23.4 kDa) containing a His tag at the C-terminus ( Figure 1 B), the target protein band size is consistent with the theoretical value.

[0068] Example 2 Phage Surface Display of Nanobodies Specific for dUTPase of Shrimp Iridescent Virus DIV1 NAR Library construction and screening

[0069] The variable region fragment of the new antigen receptor V of the spiny dogfish was selected NAR (PDB ID: 4HGM, A chain) as the backbone, its amino acid sequence is SEQ ID No.4, and the coding gene sequence is SEQ ID No.3; there are two complementary determining clusters, CDR1 and CDR3, and the middle is composed of hypervariable regions Hv2 and Hv4 ( Figure 2 ). The gene sequence encoding CDR1 is from position 76 to position 99 of SEQ ID No.3, and the amino acid sequence is from position 26 to position 33 of SEQ ID No.4; the gene sequence encoding CDR3 is from position 256 to position 276 of SEQ ID No.3, and the amino acid sequence is from position 86 to position 92 of SEQ ID No.4.

[0070] The variable region fragment of the novel antigen receptor of the spiny dogfish V NAR(nucleotide sequence is SEQ ID No.3, amino acid sequence is SEQ ID No.4) as the skeleton, refer to the existing literature (Grzeschik J, et al. Methods Mol Biol. 2018, 1701: 147-167.; Doreen D, et al., Methods Mol Biol. 2018, 1827: 109-127.;Solemani Zadeh A, et al. Methods Protoc. 2019, 2(1): 17.;Dooley H. Methods Mol Biol. 2022, 2421: 57-72.;Gasperin-Bulbarela J, et al., Methods Mol Biol. 2022, 2446: 71-93.;Kolmar H, et al., Methods Mol Biol. 2023, 2702: 227-243.) Primers were designed for CDR1 and CDR3 and a phage surface display library was constructed ( Figure 3 ), applied to the screening of nanoantibodies targeting the dUTPase protein of shrimp iridovirus DIV1.

[0071] Construction of phage surface display V NAR The primers of the nanobody library are as follows:

[0072] FR1_F: 5'-CTACCGTGGCCCAGGCGGCCACCCGTGTTGATCAGAGC-3'

[0073] CDR1_R:5'-CTGATACCAATAGGTAGA NNN CAGAACGCAGGTAATGGTAAC-3' (series length primer, wherein N is any base of A, T, C, G, and the number of N is an integer multiple of 3, and the multiple is an integer between 5 and 10);

[0074] CDR1_F: 5'-ACCTATTGGTATCAGCAGAAAC-3';

[0075] CDR3_R:5'-GGTACCTGCACCATCACC NNN TGCACGACAATAATAGGTTG-3' (series length primer, wherein N is any base of A, T, C, G, and the number of N is an integer multiple of 3, and the multiple is an integer between 7 and 20);

[0076] FR4_R: 5'-TGGTGCTGGCCGGCCTGGCCTTTAATTTCCACTTTGGTACCT GCACCATCAC-3'

[0077] The steps for constructing the nanobody library are as follows:

[0078] Primer pairs (FR1_F and CDR1_R), (CDR1_F and CDR3_R) were used to generate the NAR The nucleotide (SEQ ID No. 3) was used as a template and GeneMorph II-Random Mutagenesis Kits (Aglient, Catalog No.: 200550) was used to PCR amplify the FR1-CDR1 and CDR1-CDR3 gene fragments respectively (the operation steps refer to the kit instructions); the PCR product kit (QIAGEN, Catalog No.: 28006) was used to recover the products obtained by PCR amplification. The full-length fragment of the FR1-CDR1-CDR3-FR4 gene was amplified using FR1-CDR1 and CDR1-CDR3 as templates, FR1_F and FR4_R as primers, and the PCR product kit (QIAGEN, Catalog No.: 28006) was used to recover the products obtained by PCR amplification. After digestion with SfiI restriction endonuclease (New England Biolabs, Catalog No.: R0123L), the plasmid was ligated into the phagemid vector pComb3XSS (Addgene, Catalog No.: 63890) that was also digested with SfiI to construct pComb3XSS-V NAR The recombinant vector of the nanoantibody library was electroporated into Escherichia coli TG1 competent cells (Agilent, Catalog No.: 200123), and infected with helper phage M13KO7 (New England Biolabs, Catalog No.: N0315S) to obtain the phage surface displayed nanoantibody library. The library capacity can reach 1.2×10 11 pfu / mL( Figure 3 ).

[0079] The purified dUTPase protein of shrimp iridovirus DIV1 was coated as an antigen in a 96-well plate and incubated overnight at 4°C. NAR The nanoantibody library was screened to obtain phage nanoantibody candidate clones that specifically bind to the antigen. After 4 rounds of screening, a nanoantibody clone was enriched and named nanoantibody 4A12@V NAR .

[0080] After sequencing, the nanoantibody 4A12@V was obtained. NARThe amino acid sequence is SEQ ID No.6, and the encoding gene sequence is SEQ ID No.5. The numbers are determined according to the amino acid sequence, wherein the nucleotide sequence of CDR1 is positions 76-105 of SEQ ID No.5: GGTTATAGCTTAAGCAATAATAGTTATTA C; the amino acid sequence is positions 26-35 of SEQ ID No.6: GYSLSNNSYY; the nucleotide sequence of CDR3 is positions 262-291 of SEQ ID No.5: CACTATGGTTCGGGGACTTATCCCC TTGAC; the amino acid sequence is positions 88-97 of SEQ ID No.6: HYGSGTYPLD.

[0081] Example 3 Nanobody 4A12@V NAR Expression and purification of

[0082] The nanoantibody 4A12@V targeting the dUTPase protein of shrimp iridovirus DIV1 NAR The gene fusion FLAG tag gene (Merck) was inserted into the multiple cloning sites NcoI and XhoI of the vector pET-22b(+) (Novagen, Cat. No. 69744) and ligated to construct the expression vector pET22b-4A12@V NAR -FLAG.

[0083] Expression vector pET22b-4A12@V NAR -FLAG structure description is as follows: 4A12@V with FLAG tag NAR The DNA molecule of the nucleotide fragment (nucleotide sequence is the connection of SEQ ID No.5 and SEQ ID No.7) replaces the small fragment between the NcoI and XhoI restriction endonuclease sites in pET-22b(+), keeping the other nucleotides of pET-22b(+) unchanged, and the obtained recombinant vector with FLAG tag is expressed. Expression vector pET22b-4A12@V NAR -FLAG contains the nucleotide sequence (i.e., coding sequence) from 4A12@V NAR The recombinant 4A12@V NAR -FLAG protein gene, expressing an amino acid sequence of a fusion protein of SEQ ID No.6 and SEQ ID No.8.

[0084] 10 ng of expression vector pET22b-4A12@V NAR-FLAG was transformed into E. coli BL21 (DE3) competent cells. Positive clones were screened and verified by PCR, 2% agarose gel electrophoresis or restriction digestion or sequencing. The successfully verified positive clone recombinant strain was named as recombinant strain BL21-pET22b-4A12@V NAR -FLAG.

[0085] The recombinant strain BL21-pET22b-4A12@V NAR -FLAG was inoculated into LB medium containing ampicillin at a final concentration of 100 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.2 mmol / L, and induce at 16°C, 200 rpm for 16-20 hours. Centrifuge at 4°C, 6000 rpm for 15 minutes to collect the induced protein-expressing bacteria, and resuspend the bacterial precipitate in PBS buffer. Ultrasonic disruption of the bacteria under ice-water bath conditions, centrifugation to collect the supernatant, affinity binding through Ni-NTA filler, imidazole concentration gradient elution to purify the nanoantibody protein, and dialyze to remove imidazole, and SDS-PAGE to verify the purity of the target protein.

[0086] Recombinant strain BL21-pET22b-4A12@V NAR -FLAG-containing bacterial suspension was broken and the supernatant was purified and eluted. There was a clear target protein size band in the protein, and the protein purity was very high; the molecular weight was consistent with the theoretical molecular weight of 13.2kDa ( Figure 4 ), that is, to express and purify 4A12@V containing a FLAG tag at the C-terminus NAR Nanobody fusion proteins.

[0087] Example 4 ELISA method for determination of nanobody 4A12@V NAR Binding ability to dUTPase protein of shrimp iridovirus DIV1

[0088] The dUTPase protein (10 μg / mL) of shrimp iridovirus DIV1 containing histidine tag obtained in Example 1 was coated in a 96-well plate, incubated at 4°C overnight, and then blocked with 1% (w / v) BSA at 37°C for 1 hour. 4A12@V containing FLAG tag obtained in Example 4 was added at a concentration serial dilution (0, 50, 100, 150, 200 nM). NAR-FLAG nanobody protein, incubated at 37°C for 2 hours, washed four times with PBS + 0.05% (v / v) Tween 20 solution, then added with horseradish peroxidase (HRP) labeled anti-FLAG tag mouse monoclonal antibody (Sigma, catalog number: A8592), incubated at 37°C for 1 hour, and washed four times with PBS + 0.05% (v / v) Tween 20 solution. Nanobody backbone V NAR As a negative control. NAR The amino acid sequence of the protein is SEQ ID No. 4, which is obtained by prokaryotic expression and purification. Nanobody skeleton V NAR The preparation of refers to the following steps:

[0089] Nanobody backbone V NAR The nucleotide (SEQ ID No.3) was tandemly connected with the FLAG tag gene (Merck, SEQ ID No.7) and synthesized by Beijing Qingke Biotechnology Co., Ltd. and connected with the multiple cloning sites NcoI and XhoI of the vector pET-22b(+) (Novagen, Catalog No.: 69744) to construct the expression vector pET22b-V NAR -FLAG.

[0090] Vector pET22b-V NAR -FLAG structure is described as follows: Use V with FLAG tag NAR The DNA molecule of the nucleotide fragment (nucleotide sequence is the connection of SEQ ID No.3 and SEQ ID No.7) replaces the small fragment between the NcoI and XhoI restriction endonuclease sites in pET-22b (+), keeping the other nucleotides of pET-22b (+) unchanged, and the obtained recombinant vector expressing with FLAG tag is obtained. Recombinant vector pET22b-V NAR -FLAG contains a nucleotide sequence (i.e., a coding sequence) which is represented by V in the sequence list. NAR The recombinant V NAR -FLAG protein gene, the expressed amino acid sequence is the fusion protein V of SEQ ID No.4 and SEQ ID No.8 in the sequence list NAR -FLAG.

[0091] 10 ng of plasmid (pET22b-V NAR-FLAG) was transformed into E. coli BL21 (DE3) competent cells. Positive clones were screened and verified by PCR, 2% agarose gel electrophoresis or restriction digestion or sequencing. The successfully verified positive clone recombinant strain was named recombinant strain BL21-pET22b-V NAR -FLAG.

[0092] The recombinant strain BL21-pET22b-V NAR -FLAG was inoculated into LB liquid medium containing ampicillin at a final concentration of 100 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.2mmol / L and induce at 16℃, 200rpm for 16-20 hours. Collect the induced bacteria by centrifugation at 4℃, 6000rpm for 15 minutes, and resuspend the bacterial precipitate in PBS buffer. Ultrasonicate the bacteria in an ice-water bath, collect the supernatant by centrifugation, purify it with Ni-NTA filler and dialyze to remove imidazole.

[0093] ELISA results Figure 5 As shown, the nanobody 4A12@V NAR EC binding of -FLAG(■) to dUTPase protein of shrimp iridovirus DIV1 50 was 180 nM, while the negative control nanobody backbone V NAR -FLAG(●) cannot interact with the dUTPase protein of shrimp iridovirus DIV1, indicating that the nanoantibody 4A12@V NAR The interaction with the dUTPase protein of shrimp iridovirus DIV1 is specific binding; indicating that the nanobody 4A12@V NAR It can be used for the diagnosis of iridovirus DIV1 and can specifically identify the dUTPase of iridovirus DIV1.

[0094] Example 5 Nanobody 4A12@V NAR Evaluation of therapeutic effects on Litopenaeus vannamei infected with iridovirus DIV1

[0095] Healthy Litopenaeus vannamei was infected with shrimp iris virus DIV1. DIV1 stock solution was diluted to 10 1 , 10 2 , 10 3 , 10 4 The survival rate of Penaeus vannamei decreased significantly after 40 hours of infection, and after 100 hours, except for the 10 dilution times. 4 The survival rate of all other infections dropped below 50% ( Figure 6 A) Application of nanoantibody 4A12@V to DIV1-infected Litopenaeus vannamei NARTreatment with inactivated nanobody 4A12@V NAR With PBS as the control, the survival rate of Penaeus vannamei began to decline after 55 hours of infection, but after the nanoantibody 4A12@V NAR The survival rate of the treated group was significantly higher than that of the inactivated nanoantibody 4A12@V NAR Compared with the PBS control group, the survival rate of the treatment group remained above 60% at 72 hours, while the survival rate of the control group was less than 40%, and the inactivated nanoantibody 4A12@V NAR There was no significant difference compared with the PBS control group ( Figure 6 B), indicating that the nanobody 4A12@V NAR It has the effect of treating Penaeus vannamei infected with iridovirus DIV1.

[0096] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Based on nanobody framework V NAR A method for preparing a nanoantibody library, characterized in that: The steps include: (1) Primer amplification and splicing of the variable region fragment V of the new antigen receptor of white horn shark NAR The nanobody gene fragments, which are nanobody backbones, are connected and inserted into the shuttle vector to form a nanobody gene library; (2) The nanobody gene library was electroporated into competent E. coli cells, and the helper phage M13KO7 was used to infect the E. coli carrying the nanobody gene library to obtain the phage surface displayed nanobody library, and the library capacity of the phage surface displayed nanobody library was evaluated.

2. A nanobody 4A12@V targeting the deoxyuridine triphosphate nucleoside hydrolase dUTPase protein of shrimp iridovirus NAR , characterized in that, The nucleotide sequence is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.

6.

3. A nanobody 4A12@V targeting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein according to claim 2 NAR The preparation method is characterized in that The steps include: (1) constructing a prokaryotic expression vector containing the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein gene sequence, expressing the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein, and isolating and purifying the protein dUTPase; (2) Using purified dUTPase protein as antigen, using nanobody V NAR Screening the phage surface display nanoantibody library of the backbone, and obtaining a high-affinity specific binding nanoantibody clone through multiple rounds of panning; (3) Express and purify the nanoantibody clone to obtain the high-affinity nanoantibody 4A12@V targeting the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein NAR , the nanobody 4A12@V NAR The amino acid sequence of the nanobody 4A12@V NAR It has two antigen binding regions, namely complementary determining clusters CDR1 and CDR3, wherein the amino acid sequence of the CDR1 is the 26th to 35th positions of SEQ ID No.6, and the amino acid sequence of the CDR3 is the 88th to 97th positions of SEQ ID No.

6.

4. An antigen-binding fragment or antibody derivative, characterized in that: It is the following A1) or A2): A1): an antigen-binding fragment or antibody derivative with an amino acid sequence as shown in SEQ ID No.6; A2): An antigen-binding fragment or antibody derivative obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No.

6.

5. A biomaterial, characterized in that: It is any of the following: B1): Encoding the antibody 4A12@V according to claim 2 NAR Or a nucleic acid molecule encoding the antigen-binding fragment or antibody derivative according to claim 4; B2): an expression cassette containing the nucleic acid molecule described in B1); B3): a recombinant vector containing the nucleic acid molecule described in B1); B4): a recombinant vector containing the expression cassette described in B2); B5): A recombinant microorganism containing the nucleic acid molecule described in B1); B6): A recombinant microorganism containing the expression cassette described in B2); B7): a recombinant microorganism containing the recombinant vector described in B3); B8): A recombinant microorganism containing the recombinant vector described in B4).

6. The biomaterial according to claim 5, characterized in that: B1) The protein corresponding to the nucleic acid molecule has two antigen binding regions CDR1 and CDR3, the coding gene of CDR1 is nucleotides 76-105 of SEQ ID No.5; the coding gene of CDR3 is nucleotides 262-291 of SEQ ID No.

5.

7. The biomaterial according to claim 5, characterized in that: B1) The nucleic acid molecule is any one of the following: C1): a DNA molecule having a nucleotide sequence as shown in SEQ ID No. 5; C2): hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the nanobody 4A12@V NAR DNA molecules; C3): A DNA sequence having more than 80% homology with any of the DNA sequences defined in C1) or C2) and encoding the nanobody 4A12@V NAR of DNA molecules.

8. An ELISA detection kit targeting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein, characterized in that: The kit comprises the antibody 4A12@V according to claim 2 NAR , or comprising the antigen-binding fragment or antibody derivative as described in claim 4, or comprising the biological material as described in claim 6.

9. Any of the following applications: D1): Antibody 4A12@V as described in claim 2 NAR , or the antigen-binding fragment as claimed in claim 4, or the biological material as claimed in claim 5, or the kit as claimed in claim 8 in the preparation of a product for detecting shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein; D2): Antibody 4A12@V as described in claim 2 NAR , or the antigen-binding fragment as claimed in claim 4, or the biological material as claimed in claim 5, or the kit as claimed in claim 8 for preparing a product that binds to the shrimp iris virus deoxyuridine triphosphate nucleoside hydrolase dUTPase protein; D3): Antibody 4A12@V as described in claim 2 NAR Or use of the antigen-binding fragment as claimed in claim 4 in the preparation of a shrimp iris virus deoxyuridine triphosphate hydrolase dUTPase protein detection reagent; D4): Antibody 4A12@V as described in claim 2 NAR Or use of the antigen-binding fragment according to claim 4 in the preparation of a shrimp iris virus diagnostic reagent; D5): Antibody 4A12@V as described in claim 2 NAR Or use of the antigen-binding fragment as claimed in claim 4 in the preparation of a drug for preventing and / or treating shrimp iris virus.

Images