A strain of Parasitium brasiliensis HMA1 and its application

Through the Brazilian syringe HMA1 and its fermentation products, especially laccase, the problem of efficient degradation of bisphenol compounds and organophosphorus flame retardants was solved, laying the foundation for fungal biorepair technology to reduce ecological risks, and achieving rapid and effective degradation effects.

CN119464081BActive Publication Date: 2025-08-08SHANDONG LUWEI PHARMA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411677466.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-22
Publication Date
2025-08-08
Estimated Expiration
2044-11-22

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently degrade bisphenol A and other bisphenol compounds, and there are few researches on biodegradation methods, which leads to the inability to effectively reduce the ecological risk of bisphenol compounds in the environment.

Method used

The Brazilian syringomyelin HMA1 and its fermentation products, especially laccase, are used to degrade bisphenol A, bisphenol B, bisphenol F, organophosphorus flame retardants TCrP and EHDPP, and improve degradation efficiency by optimizing environmental conditions.

Benefits of technology

It has achieved efficient degradation of bisphenol compounds and organic phosphorus flame retardants, providing a theoretical basis for fungal biorepair technology to reduce ecological risks, and the by-products of the degradation process are non-toxic or low-toxic, and are fast and effective under suitable conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464081B_ABST
    Figure CN119464081B_ABST
Patent Text Reader

Abstract

The present invention discloses a strain of Paraconiothyrium brasiliense HMA1 and its application, belonging to the field of microbial engineering and molecular biology technology. The Paraconiothyrium brasiliense HMA1 is deposited in the General Microbiology Center of the China Culture Collection Administration Committee, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date being October 16, 2024, and the deposit number being CGMCC No. 41574. The present invention also provides the application of the Paraconiothyrium brasiliense HMA1 or its fermentation product in the degradation of bisphenol compounds. The present invention is the first invention of utilizing Paraconiothyrium brasiliense to degrade bisphenol compounds, and aims to lay a solid theoretical foundation for the widespread application of fungal bioremediation technology in reducing the ecological risks of bisphenol compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of microbial engineering and molecular biology, in particular to a Pseudomonas brasiliensis HMA1 strain and application thereof. Background Art

[0002] Bisphenol A (2,2-bis(4-hydroxyphenyl)propane, BPA) is a widely used synthetic chemical. BPA is often used as a plasticizer or flame retardant in the manufacture of synthetic polymers, including epoxy resins, polycarbonate plastics, many food and beverage containers, and the linings of metal food cans. It is also used as an antioxidant in the food industry and as a cheaper cosmetic. Due to its widespread use and growing demand, BPA has become a common emerging organic contaminant (EOC) that readily penetrates the environment. BPA has been detected in various environmental media, including air, water, soil, and sediment. BPA is classified as a chemical hazardous to reproductive and developmental health. BPA's chemical formula is similar to that of estrogen and can antagonize estrogen receptors in organisms, causing severe disruption to the endocrine system. Furthermore, BPA is associated with carcinogenicity, immunotoxicity, and transgenerational effects across species. Even at very low doses, it can cause premature puberty in females, reduce sperm count, and lead to prostate hyperplasia. Generally speaking, BPA poses serious risks to human and animal health when released into the environment. Therefore, countries including the United States and Canada passed an international agreement against the use of BPA, banning the sale of baby bottles containing BPA to protect the health of newborns from the effects of BPA leakage.

[0003] Currently, the methods being pursued to degrade this toxic compound primarily involve photodegradation, photoelectrocatalytic oxidation, adsorption, and biodegradation, but these methods are relatively inefficient. Microbial degradation of the endocrine disruptor bisphenol A generally offers lower operating costs than chemical or physical methods. This is primarily due to the relative simplicity of obtaining, cultivating, and utilizing microorganisms, and their proliferation and metabolic activities can be carried out under relatively mild conditions, without the need for complex equipment or large amounts of energy. Furthermore, the byproducts produced during microbial degradation are mostly non-toxic or low-toxic, posing a minimal risk of secondary environmental pollution. Furthermore, microorganisms are widely present in nature, and their use to degrade BPA can contribute to resource recycling and sustainable development. Crucially, under suitable conditions, microorganisms can rapidly and efficiently degrade BPA. These advantages make microbial degradation technology promising and of great practical significance in addressing BPA-related environmental pollution.

[0004] Therefore, it is of great significance to find new and effective solutions to eliminate such toxic compounds. However, there are few studies on the use of microbial methods and strains to degrade and remove bisphenol compounds. Summary of the Invention

[0005] The present invention aims to provide a strain of C. brasiliensis HMA1 and its use to address the problems of the prior art. The present invention demonstrates that C. brasiliensis HMA1 can be used to degrade bisphenol A, bisphenol B, and bisphenol F, as well as the organophosphorus flame retardants TCrP and EHDPP. Furthermore, the laccase produced by C. brasiliensis HMA1 can also be used to degrade bisphenol A.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: A strain of Paraconiothyrium brasiliense HMA1 was deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 16, 2024, and the deposit number is CGMCC No. 41574.

[0008] The strain originated from the campus of Shandong University of Technology.

[0009] Technical Solution 2: A fermentation method of the aforementioned Conchaetomium brasiliensis HMA1, comprising the steps of inoculating the mycelium of the aforementioned Conchaetomium brasiliensis HMA1 into a PDY broth medium for fermentation.

[0010] Technical solution three: A fermentation product obtained by fermentation according to the fermentation method.

[0011] Furthermore, the fermentation product includes laccase.

[0012] The laccase is produced by inoculating HMA1 mycelia in PDY broth medium. The laccase produced by Pseudomonas brasiliensis HMA1 can be used to degrade bisphenol A.

[0013] Technical solution 4: An application of the aforementioned Parasitoids brasiliensis HMA1 or the aforementioned fermentation product in the degradation of bisphenol compounds.

[0014] Furthermore, the bisphenol compounds include BPB and BPF.

[0015] BPB (Bisphenol B): Bisphenol B; BPF (Bisphenol F): Bisphenol F.

[0016] Technical Solution 5: An application of the aforementioned Parasitoids brasiliensis HMA1 or the aforementioned fermentation product in the degradation of bisphenol A.

[0017] Technical Solution 6: An application of the aforementioned Pseudomonas brasiliensis HMA1 or the aforementioned fermentation product in the degradation of organophosphorus flame retardants.

[0018] Furthermore, the organophosphorus flame retardant includes TCrP and EHDPP.

[0019] TCrP (Tricresyl Phosphate): tricresyl phosphate; EHDPP (Ethylhexyl Diphenyl Phosphate): ethylhexyl diphenyl phosphate.

[0020] Technical Solution 7: A microbial agent for degrading bisphenol compounds, comprising the aforementioned Pseudomonas aeruginosa HMA1 or the aforementioned fermentation product; the aforementioned bisphenol compounds include bisphenol A, bisphenol B, and bisphenol F.

[0021] The strain or the fermentation product serves as the main component of the microbial agent, which also includes auxiliary materials commonly used in microbial agents. The auxiliary materials include organic carriers, inorganic carriers, carbon sources, nitrogen sources, minerals, antifreeze agents, drying protectants, adhesives, natural adhesives, synthetic adhesives, phosphate buffers, antioxidants, surfactants, and preservatives.

[0022] The present invention discloses the following technical effects:

[0023] The present invention isolated strain HMA1 from a soil sample and optimized the environmental conditions of its degradation process. Based on the elucidation of intermediate metabolites, the strain or its fermentation products were used to further propose a pathway for the degradation of BPA by the fungal strain. The mechanism of BPA degradation was studied by producing laccase and detecting the potential of extracellular laccase to eliminate BPA. The Paraconiothyrium brasiliense HMA1 was deposited at the General Microbiology Center of the China Culture Collection Administration, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, on October 16, 2024, and the deposit number is CGMCC No. 41574.

[0024] This invention demonstrates that Pseudomonas brasiliensis HMA1 can be used to degrade bisphenol compounds and the organophosphorus flame retardants TCrP and EHDPP. Furthermore, the laccase produced by Pseudomonas brasiliensis HMA1 can also be used to degrade bisphenol A. This invention is the first to utilize Pseudomonas brasiliensis to degrade bisphenol compounds, laying a solid theoretical foundation for the widespread application of fungal bioremediation technology to reduce the ecological risks of BPA. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 Identification of strain HMA1, where A is the growth morphology and color of strain HMA1 on PDA medium; B is the growth of strain HMA1 on the back of the PDA plate; C is the phylogenetic tree of strain HMA1;

[0027] Figure 2 The effects of environmental and nutritional factors on the degradation of BPA by Paraconiothyrium brasiliense HMA1 strain, where A is temperature; B is pH; C is nitrogen source; and D is NaCl concentration.

[0028] Figure 3 Figure 3 shows the efficiency of HMA1 strain in degrading low (A) and high (B) BPA concentrations after 5 and 10 days of incubation.

[0029] Figure 4 is the biodegradation rate of different bisphenols and organophosphorus flame retardants (100 mg / L) by HMA1 strain after 2 and 4 days of incubation;

[0030] Figure 5 The pathway for degradation of BPA by HMAl strain includes 1,2-bis(4-hydroxyphenyl)-2-propanol (I), 4,4-dihydroxy-α-methylstilbene (II), 2,2-bis(4-hydroxyphenyl)-1-propanol (III), 2,3-bis(4-hydroxyphenyl)-1,2-propanediol (IV), 4-hydroxybenzoyl alcohol (V), and hydroquinone (HQ) (VI);

[0031] Figure 6 The degradation and mineralization of BPA by HMA1 strain, the initial concentration of BPA was 150 mg / L;

[0032] Figure 7 Figure 3 shows the positive (A) and negative (B) plate method for detecting the production of laccase by HMA1 strain using ABTS as substrate; C shows the removal of BPA at different concentrations by laccase. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Example 1

[0039] 1. Sample Collection

[0040] Soil samples were collected from Shandong University of Technology.

[0041] 2. Isolation of strains

[0042] The collected soil samples were suspended in sterile saline solution. 100 μL of the suspension, after ten-fold serial dilutions, was plated onto the agar surface of polydimethylsiloxane (PDA) plates and incubated at 28°C for 7 days. The different strains obtained were recultured and purified in PDA. All isolates were examined under a light microscope to confirm purity and identify morphology. The fungal strains obtained were stored as spore suspensions in glycerol and stored at -80°C until further use.

[0043] 3. Preparation and Detection of Bisphenol A-Degrading Fungal Inoculum

[0044] All isolates obtained from the screening were cultured on PDB at 28°C in a rotary shaker (150 rpm) for 5 days, then centrifuged at 4500 rpm for 10 minutes to collect the mycelia of each isolate. The collected mycelia were resuspended and washed twice in physiological saline and re-centrifuged to collect the washed mycelia. To test the ability of the screened isolates to degrade bisphenol A (BPA), 3 g of wet mycelia of each isolate were inoculated into a 250 mL Erlenmeyer flask containing 70 mL of sterile MSM and supplemented with 100 mg / L BPA as the sole carbon source. The inoculated flasks were incubated at 28°C in a rotary shaker (150 rpm) for 5 days. 1 mL of each culture was filtered through a 0.22-μm nylon membrane, and the BPA residual concentration was measured by HPLC to determine the degradation rate. The BPA degradation efficiency was calculated as follows: Degradation efficiency (%) = (C i— C f ) / C i ×100, where C i and C f represent the initial and final concentrations of BPA, respectively.

[0045] The BPA degradation capacity of each culture was tested by HPLC, and it was found that the isolate designated HMA1 had a degradation rate of 100% for BPA (100 mg / L). HMA1 was identified by 18S rRNA gene sequencing. The 18S rRNA gene sequence of HMA1 was compared with BLAST to obtain sequences of related strains, and a phylogenetic tree of HMA1 was constructed ( Figure 1 C in the results, the closest strain is strain SM1, with a similarity of 98.7% and a query coverage of 99%. Figure 1 ) and 18S rRNA gene sequencing, and the strain, designated HMA1, was identified as Paraconiothyrium brasiliense. Paraconiothyrium brasiliense HMA1 has been deposited with the General Microbiology Center of the China Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, on October 16, 2024, under the accession number CGMCC No. 41574.

[0046] 4. Molecular Identification of HMA1

[0047] 4.1 DNA extraction

[0048] The genomic DNA of HMA1 was extracted using the DNA Rapid Plant System Isolation Kit.

[0049] 4.2 PCR amplification

[0050] The total volume of the PCR reaction mixture was 25 μL, containing 50 ng of template DNA, 12.5 μL of PCR Master Mix, 0.5 μL each of the universal fungal primers ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID NO. 1) and ITS4: TCCTCCGCTTATTGATATGC (SEQ ID NO. 2), and the remaining volume was filled with 11.5 μL of DNA-free water. The reaction mixture was thermocycled in a Mastercycler from Eppendorf, Germany, following the programmed PCR conditions: 35 cycles of denaturation at 95°C for 10 min, annealing at 56°C for 30 s, extension at 72°C for 1.45 min, and a final extension at 72°C for 3.30 min to complete strand synthesis. PCR products were analyzed by electrophoresis on 1% agarose TBE gels and visualized using a gel documentation system from Syngene, USA. The PCR products were then purified.

[0051] 4.3 Sequencing and phylogenetic analysis

[0052] PCR products were sequenced and the resulting sequences were deposited in GenBak. BLAST comparisons were performed to identify similar sequences. Phylogenetic analyses inferred from the data were constructed using MEGA-X software version 11, and alignments were performed using Clustal Omega. Phylogenetic tree construction was performed using the neighbor-joining (NJ) method for the prepared sequences. Phylogenetic tree branch stability was estimated using the p-distance substitution model and a bootstrap of 1000 replicates.

[0053] 5. Effects of environmental and nutritional factors on BPA degradation by HMA1

[0054] To investigate the effects of environmental and nutritional factors on BPA degradation by HMA1, four different parameters were investigated. Batch experiments were conducted with varying initial pH (5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, and 9), incubation temperature (15°C, 20°C, 25°C, 30°C, 35°C, and 40°C), nitrogen sources (1% ammonium sulfate, sodium nitrite, ammonium citrate, ammonium tartrate, sodium nitrate, ammonium acetate, and ammonium chloride), and NaCl concentrations (0%, 0.2%, 0.4%, 0.6%, 0.8%, 1%, 1.2%, and 1.4%). After inoculum preparation, 250 mL Erlenmeyer flasks were inoculated with 70 mL of MSM and 100 mg / L of BPA, respectively, and 3 g of HMA1 mycelium (wet weight). The inoculated flasks were incubated on a rotary shaker (150 rpm) for 3 days, and BPA degradation rates were determined by HPLC. All experiments were performed with three individuals, with three replicates per group.

[0055] The results are as follows Figure 2As shown in Figure A, HMA1 can degrade BPA (100 mg / L) at different rates at all tested temperatures. The degradation efficiency of HMA1 for BPA increases as the temperature increases from 15°C to the optimal value at 30°C, while at 35°C and 40°C, the degradation efficiency drops sharply again with increasing temperature. At temperatures of 15, 20, 25, 30, 30, 35 and 40°C, the degradation rates are 49%, 53, 95, 100, 32 and 12%, respectively. The effect of pH on the degradation of BPA by HMA1 was evaluated over a wide pH range (5-9) with an increment of 0.5. The results showed that HMA1 exhibited a high tolerance for the degradation of BPA. The overall pH value was tested, and at pH 5 and 9, the degradation exceeded 62 and 67%, respectively. Figure 2 B). When pH 7.5 is the optimal value, the BPA degradation rate is the highest (100% is 100 mg / L). When the pH is higher than the optimal value, the degradation rate decreases. The influence of nitrogen source in the degradation medium was tested using organic nitrogen source and inorganic nitrogen source. Figure 2 The results of C showed that HMA1 was able to use all the detected nitrogen sources, with degradation rates of citric acid, sodium nitrate, acetic acid, tartaric acid and sodium nitrite of 82%, 88%, 93%, 90% and 76% respectively, while the best degradation rates of chloride and sulfate were 97% and 98% respectively. The present invention also studied the effect of salt stress on BPA degradation of HMA1 under different NaCl concentrations. The results showed that with the increase of NaCl concentration, the degradation rate of the strain decreased significantly. Figure 2 As shown in D, the degradation efficiency of HMA1 under 0.6% NaCl treatment was maintained at 52% compared with the control (without NaCl), and the degradation rate dropped to 30% under 1.4% NaCl treatment. The degradation rate was the highest in the culture medium without NaCl.

[0056] 6. Degradation efficiency of BPA by HMA1 at maximum and minimum concentrations

[0057] The degradation ability of HMA1 against high and low concentrations of BPA was tested. MSM culture medium was supplemented with different concentrations of BPA (low concentrations included 0.5 mg / L, 1 mg / L, 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L, and 12 mg / L; high concentrations included 50 mg / L, 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L, 900 mg / L, and 1000 mg / L). All flasks were inoculated with 3 g wet weight of fresh mycelium of HMA1 and incubated at 28°C in a rotary shaker (160 rpm). The degradation efficiency was assessed by measuring the residual BPA concentration in each flask after 5 and 10 days of culture.

[0058] 7. Substrate Utilization Test

[0059] To investigate HMA1's ability to degrade pollutants other than BPA, the present invention tested six BPA-related pollutants (BPB, BPF, and BPS) and organophosphorus flame retardants (TPP, TCrP, and EHDPP). These included BPB (Bisphenol B), BPF (Bisphenol F), BPS (Bisphenol S), TPP (Triphenyl Phosphate), TCrP (Tricresyl Phosphate), and EHDPP (Ethylhexyl Diphenyl Phosphate).

[0060] MSM (50 mL in a 250 mL flask) was added with 100 mg / L of each substrate, inoculated with 3 g of HMA1 mycelium, and incubated at 28°C in a rotary shaker at 150 rpm. The residual concentration of the substrate after the second and fourth days was measured by HPLC to monitor the degradation rate. BPB, PBF, and BPS were filtered through a 0.22 μm nylon membrane (1 mL) and then subjected to HPLC. TPP, TCrP, and EHDPP were mixed with equal volumes of acetonitrile, and a sample (1 mL) was taken and filtered before being subjected to HPLC. The results are shown in Figure 2. Figure 4 As shown, HMA1 exhibited excellent degradation rates for the four substrates, while the other two were not degraded. In summary, strain HMA1 could degrade BPB, BPF, TCrP, and EHDPP by 85%, 87%, 89%, and 90%, respectively, after 2 days of culture, and could completely degrade them after 4 days of culture.

[0061] 8. Analysis of BPA degradation intermediates

[0062] To identify intermediates released during BPA degradation, 11 g of HMA1 mycelium (wet weight) was inoculated into 300 mL of MSM, supplemented with 100 mg / L BPA, and incubated at 28°C on a rotary shaker (130 rpm). At the specified incubation times, 50 mL samples were withdrawn from the culture and filtered through a membrane filter. The mycelium-free filtrate was acidified with HCl (pH 2-3) and extracted twice with equal volumes of ethyl acetate. The organic layer was separated, dried, and resuspended in 1 mL of HPLC-grade methanol. All suspensions were filtered through 0.22 μm nylon membranes. Intermediates were detected by high-performance liquid chromatography-mass spectrometry (HPLC-MS, QTOF). Data acquisition and processing were performed using Agilent MS Hunter Qualitative Analysis B.06 software.

[0063] 9.Total organic carbon (TOC) and mineralization rate detection

[0064] To test the ability of HMA1 to mineralize BPA and assimilate degradation intermediates, the total TOC in the degradation medium was estimated. HMA1 (wet mycelium) was inoculated into sterilized TEM (400 mL, 1 L Erlenmeyer flask) and supplemented with 150 mg / L BPA as the sole carbon source. The inoculated culture was incubated at 28°C in a rotary shaker (150 rpm) for 10 days. 20 mL samples were removed daily under sterile conditions, the mycelium was filtered out, and the filtrate was stored at -20°C for further determination of TOC and BPA losses.

[0065] 10. Analytical methods

[0066] Agilent EC-C18 column (C 18 BPA, BPB, BPF, and BPS were detected using an HPLC (Agilent 1260, USA) with a 4.6 × 150 mm × 4 μm column and a diode array detector (DAD). The mobile phase consisted of 85% acetonitrile and 15% water (0.1% acetic acid) at a flow rate of 1 mL / min and a detection wavelength of 220 nm. The injection volume was 2 μL. For the detection of TPP, TCrP, and EHDPP, the same HPLC conditions were used, except that the mobile phase ratio was changed to 95% acetonitrile and 5% water. Metabolite detection was performed using an Agilent 1290 HPLC-Agilent 6530 QTOF equipped with a Waters ACQUITY UPLC HSS T3 column (2.1 × 100 mm, 1.8 μm). The mobile phase consisted of acetonitrile (A) and 0.1% formic acid in water (B). The gradient was as follows: 30% A (0-5 min); 30-50% A (5-6 min); 50% A (6-11 min); 50-70% A (11-12 min); 70-90% A (12-13 min); 90% A (13-18 min); 90-50% A (18-20 min); 50-30% A (20-22 min); and 30% A (22-25 min). The flow rate was 0.5 mL / min, and the injection volume was 2 μL. The column oven temperature was maintained at 30°C. The ESI source was operated in negative mode, with a mass range of 50 to 500 m / z in the scan mode. The capillary voltage was 3.5 kV.

[0067] The BPA degradation metabolites of HMA1 were identified by HPLC-OTOF. The results are shown in Table 1. The intermediates of BPA degradation include six intermediate metabolites, including 1,2-bis(4-hydroxyphenyl)-2-propanol, 2,2-bis(4-hydroxyphenyl)-2-propanol, 2,3-bis(4-hydroxyphenyl)-1,2-propanediol, 4-hydroxybenzaldehyde, 4-hydroxyacetophenone and 4-hydroxybenzoic acid. The molecular formula and structure of each metabolite are shown in Table 1.

[0068] Table 1

[0069]

[0070] Degradation pathways such as Figure 5 As shown, BPA is hydroxylated to 1,2-bis(4-hydroxyphenyl)-2-propanol and 2,2-bis(4-hydroxyphenyl)-1-propanol in pathways (I) and (II), respectively. In pathway (I), 1,2-bis(4-hydroxyphenyl)-2-propanol is converted to 4,4-dihydroxy-α-methylstyrene and further oxidized to p-hydroxybenzaldehyde (p-HBAL) and p-hydroxyacetophenone (p-HAP). p-HBAL is converted to p-hydroxybenzoic acid (p-HBA), and p-HAP is oxidized to hydroquinone (HQ). Both p-HBA and HQ are mineralized into CO2 and fungal biomass via the benzoate degradation pathway. Another degradation pathway, (II), converts 2,2-bis(4-hydroxyphenyl)-1-propanol to 2,3-bis(4-hydroxyphenyl)-1,2-propanediol.

[0071] After incubation for 2, 3, 4, 5 and 6 days, the TOC mineralization rate of HMA1 decreased from 115 mg / L to 95 mg / L, 80 mg / L, 40 mg / L, 25 mg / L and 20 mg / L, respectively (e.g. Figure 6 As shown in Figure 3 ), it can be seen that HMA1 mineralized more than 78% of BPA in just 5 days, and TOC did not decrease significantly with increasing incubation time, reaching 80% consumption, and 150 mg / L BPA was completely degraded after 4 days of incubation.

[0072] 11. Detection, production and purification of laccase

[0073] Detection of laccase production by HMA1: HMA1 was grown on PDA agar plates with a final concentration of 3 mM 2,2'-amino-bis3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and incubated at 28°C for 5 days. A positive result indicated the formation of a green ( Figure 7A). To produce laccase, 800 mL of PDY broth medium was inoculated with HMA1 mycelium and incubated at 28°C on a rotary shaker. After 5 days of incubation, sterilized CuSO₄ was added to the culture to induce laccase production, and incubation continued for 10 days. The fungal culture was filtered, and 80% NH₄SO₄ was added to the mycelium-free culture medium, which was then stored at 4°C overnight to precipitate the protein. The precipitated protein was centrifuged at 15,000 rpm for 20 minutes in a cool (4°C) environment, and the pellet was dissolved in sodium acetate buffer (100 mM, pH 5) and dialyzed against the same buffer.

[0074] 12. Laccase Activity Assay

[0075] Laccase activity assay: The reaction mixture consisted of 250 μL ABTS (1 mM), sodium acetate buffer (100 mM, pH 5), and 50 μL enzyme, which was made up to 700 μL with the same buffer. OD values were monitored at 420 nm and 30°C using a UV-2600 spectrophotometer (SHIMADZU, Japan). Enzyme activity was expressed as the amount of enzyme required to produce 1 μmol ABTS (ε420 = 36,000 M). -1 cm -1 ).

[0076] 13. Laccase degrading BPA

[0077] Different concentrations of BPA (50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, 250 mg / L, 300 mg / L, 350 mg / L, 400 mg / L, 450 mg / L, 500 mg / L, and 600 mg / L) were added to 0.1 M sodium acetate buffer and inoculated with 10 units of laccase. The reaction mixture (10 mL) was incubated at 40°C and 185 rpm for 24 hours. Samples were taken at intervals (0, 3, 6, 9, 12, 15, 18, 21, and 24 minutes) to monitor the degradation rate of each BPA concentration and analyze the results using HPLC.

[0078] like Figure 7 As shown in Figure B, due to the production of laccase by HMA1, a blue-purple oxidation zone was observed behind and around the fungal colony. The activity of partially purified laccase in removing BPA was investigated under conditions of BPA concentrations of 50 to 500 μg. Figure 7 As shown in Figure (C), BPA removal efficiency gradually increased with prolonged enzyme incubation time. Laccase completely degraded 50 μg of BPA within 6 hours. As BPA concentration increased, the removal times for 200 μg, 300 μg, and 500 μg of BPA increased to 12 hours, 18 hours, and 24 hours, respectively. A 24-hour incubation period was required to remove 55% of BPA (600 μg).

[0079] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A use of Paraconiothyrium brasiliense HMA1 or its fermentation product in the degradation of organophosphorus flame retardants, characterized in that: The brasiliensis HMA1 is deposited in the General Microbiology Center of the China Culture Collection Administration Committee, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 16, 2024, and the deposit number is CGMCC No. 41574. The fermentation method of the fermentation product is: inoculating the mycelium of the brasiliensis HMA1 into PDY broth medium for fermentation; the organophosphorus flame retardant is tritolyl phosphate and ethylhexyl diphenyl phosphate.