Application of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells

By overexpressing or promoting Gemin8 or Rnpc3, reducing misfolded and unfolded proteins in hematopoietic stem progenitor cells, the problem of maintaining protein homeostasis is solved, and the protection of cellular function and disease prevention is achieved.

CN119464221BActive Publication Date: 2025-08-15INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510075231.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-17
Publication Date
2025-08-15
Estimated Expiration
2045-01-17

AI Technical Summary

Technical Problem

How to effectively maintain protein homeostasis of hematopoietic stem progenitor cells, prevent misfolded and unfolded protein aggregation, and thus prevent the occurrence of related diseases.

Method used

By overexpressing or promoting the expression of Gemin8 or Rnpc3, the content of misfolded and unfolded proteins in hematopoietic stem progenitor cells is reduced, and the protein homeostasis is maintained using substances such as Gemin8 or Rnpc3 proteins, genes, expression cassettes, vectors, host cells, active peptides, oligonucleotides or small molecule compounds.

Benefits of technology

It significantly reduces the content of misfolded and unfolded proteins in hematopoietic stem progenitor cells, maintains cellular function, and prevents the occurrence of diseases such as sickle cell anemia, Alzheimer's disease, Parkinson's disease, etc.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464221B_ABST
    Figure CN119464221B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells. The present invention creatively discovers for the first time the new use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells, effectively overcoming the current technical problem faced in this field of how to effectively maintain protein homeostasis in hematopoietic stem and progenitor cells, and provides an effective method for maintaining protein homeostasis in hematopoietic stem and progenitor cells. It also lays the foundation for the development of hematopoietic stem and progenitor cells with better functionality and transplantation potential, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to the application of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells. Background Art

[0002] Proteostasis refers to the maintenance of protein stability by cells through a series of quality control mechanisms. It plays a crucial role in maintaining normal cellular function, proliferation, and survival. Imbalances in the various molecular mechanisms that maintain proteostasis can lead to physiological and pathological processes, including functional and metabolic disorders, abnormal proliferation, and apoptosis. Imbalances in proteostasis can lead to an increase in the production of damaged, degraded, useless, or misfolded proteins, thereby controlling the aging process and, at a macro level, is closely linked to the health and lifespan of living organisms. Stem cells, as a specialized cell population with the capacity for self-renewal and multidirectional differentiation, are particularly critical for maintaining proteostasis, yet the mechanisms by which stem cells maintain proteostasis remain largely unknown. Hematopoietic stem and progenitor cells (HSPCs), which regenerate blood cells throughout the human lifespan, are particularly dependent on proteostasis to maintain their health. Effectively maintaining proteostasis in HSPCs remains a pressing technical challenge in this field. Summary of the Invention

[0003] In view of this, in order to overcome the above-mentioned technical problems existing in the art, the purpose of the present invention is to provide the use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells.

[0004] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0005] The first aspect of the present invention provides the use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells.

[0006] Furthermore, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0007] (1) Gemin8 or Rnpc3 protein;

[0008] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0009] (3) an expression cassette containing the gene described in (2);

[0010] (4) a vector containing the expression cassette described in (3);

[0011] (5) a host cell containing the vector described in (4);

[0012] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0013] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0014] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0015] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0016] Furthermore, the Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.

[0017] In some embodiments, the full name of Gemin8 is gem nuclear organelle associated protein 8. Analysis of the GenTree website shows that this gene is highly conserved in humans and mice. The Gene ID of human Gemin8 in NCBI (https: / / www.ncbi.nlm.nih.gov / ) is 54960, and the Gene ID of mouse Gemin8 in NCBI is 237221. The full name of Rnpc3 is RNA binding region (RNP1, RRM) containing 3. Analysis of the GenTree website shows that this gene is highly conserved in humans and mice. The Gene ID of human Rnpc3 in NCBI is 55599, and the Gene ID of mouse Rnpc3 in NCBI is 67225.

[0018] In some embodiments, proteostasis refers to the dynamic equilibrium state of proteins within cells, which involves multiple aspects such as protein synthesis, degradation, and transport. Maintaining proteostasis is crucial for normal cellular function, and any imbalance can lead to cell dysfunction or even cell death. When certain physiological or pathological factors disrupt proteostasis, it can lead to the aggregation of large amounts of unfolded or misfolded proteins. Misfolded or unfolded proteins can be toxic and cause cell death. Many diseases or conditions (e.g., sickle cell anemia) are caused by misfolded proteins. Misfolded proteins can also aggregate into clumps, which are a hallmark of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease.

[0019] In some embodiments, hematopoietic stem and progenitor cells (HSPCs) are the source of blood and immune cells. HSPCs are multipotent, long-lived, and have the ability to self-regenerate. These hematopoietic stem and progenitor cells include hematopoietic stem cells (HSCs) and / or hematopoietic progenitor cells (HPCs).

[0020] In some embodiments, hematopoietic stem cells refer to stem cells that are capable of giving rise to all blood cell types of the three hematopoietic lineages (erythroid, lymphoid, and myeloid), including the myeloid lineage (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) and the lymphoid lineage (T cells, B cells, NK cells).

[0021] In some embodiments, hematopoietic progenitor cells refer to hematopoietic stem cells that proliferate and differentiate into progenitor cells of various blood cells under the regulation of a certain microenvironment and certain factors. They are also a relatively primitive cell with proliferation ability, but have lost the ability to multidirectionally differentiate and can only proliferate and differentiate toward one or several blood cell lines. Therefore, they are also called committed stem cells. Hematopoietic progenitor cells can differentiate into multipotent cells of several cell types of the hematopoietic system, including but not limited to: granulocytes, monocytes, red blood cells, megakaryocytes, B cells and T cells. Hematopoietic progenitor cells are directed toward the hematopoietic cell lineage and generally do not self-regenerate.

[0022] In some embodiments, the hematopoietic stem and progenitor cells can be obtained from any one or more of the following sources: embryonic tissue, umbilical cord blood, bone marrow, peripheral blood, circulating peripheral blood, stem cell lines, or can be obtained in vitro from other cells, such as embryonic stem cells, induced pluripotent stem cells (iPS cells) or adult pluripotent cells. The cells from the above sources can be expanded in vitro using any method acceptable to those skilled in the art before use. In some cases, the hematopoietic stem and progenitor cells can be isolated from any of the above sources (e.g., bone marrow) or cultured in vitro. If the cells used are derived from an immortal stem cell line, it can further be beneficial to easily obtain and prepare a sufficient number of cells.

[0023] In some embodiments, the Gemin8 or Rnpc3 maintains protein homeostasis in hematopoietic stem and progenitor cells by reducing the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells.

[0024] In some embodiments, the Gemin8 or Rnpc3 comprises Gemin8 or Rnpc3, or a Gemin8 promoter or Rnpc3 promoter. The Gemin8 promoter or Rnpc3 promoter refers to any substance that can upregulate the expression of Gemin8 or Rnpc3, increase the activity of Gemin8 or Rnpc3, improve the stability of Gemin8 or Rnpc3, increase the effective action time of Gemin8 or Rnpc3, or promote the transcription and translation of Gemin8 or Rnpc3. These substances can be used in the present invention.

[0025] In some embodiments, the Gemin8 promoter or Rnpc3 promoter includes but is not limited to: nucleic acid promoter, protein promoter, for example, a vector that overexpresses Gemin8 or Rnpc3, an active peptide that promotes the expression of Gemin8 or Rnpc3, a protein that promotes the expression of Gemin8 or Rnpc3, an oligonucleotide that promotes the expression of Gemin8 or Rnpc3, and a small molecule compound that promotes the expression of Gemin8 or Rnpc3.

[0026] In a specific embodiment of the present invention, the inventors of the present invention have creatively discovered for the first time through a large number of experimental studies the new use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells. Overexpression of Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines, thereby playing a role in maintaining protein homeostasis in hematopoietic stem and progenitor cells, providing new research ideas and strategies for the treatment and / or prevention of various diseases or conditions caused by imbalance of protein homeostasis in hematopoietic stem and progenitor cells.

[0027] The second aspect of the present invention provides a pharmaceutical composition for maintaining protein homeostasis in hematopoietic stem and progenitor cells.

[0028] Furthermore, the pharmaceutical composition comprises Gemin8 or Rnpc3.

[0029] Furthermore, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0030] (1) Gemin8 or Rnpc3 protein;

[0031] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0032] (3) an expression cassette containing the gene described in (2);

[0033] (4) a vector containing the expression cassette described in (3);

[0034] (5) a host cell containing the vector described in (4);

[0035] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0036] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0037] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0038] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0039] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0040] In some embodiments, the pharmaceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th ed, 1995). These substances are used to help stabilize the drug or help improve the activity of the active ingredient (i.e., Gemin8 or Rnpc3 as described above in the present invention) as needed. The substances include but are not limited to: diluents, surfactants, wetting agents, adhesives, fillers, disintegrants, adsorption carriers, lubricants, stabilizers, bactericides, buffers, isotonic agents, chelating agents, and pH control agents. The pharmaceutical composition thus prepared can be administered by any appropriate administration method known to those skilled in the art as needed.

[0041] In some embodiments, the pharmaceutically acceptable carrier and / or excipient may additionally contain liquids, such as water, saline, glycerol, and ethanol.

[0042] The third aspect of the present invention provides a pharmaceutical preparation for maintaining protein homeostasis in hematopoietic stem and progenitor cells.

[0043] Furthermore, the pharmaceutical preparation comprises the pharmaceutical composition described in the second aspect of the present invention.

[0044] In some embodiments, the dosage form of the pharmaceutical preparation includes but is not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, solutions, emulsions, suspensions, controlled-release preparations, aerosols, films, injections, intravenous drips, transdermal absorption preparations, ointments, lotions, adhesive preparations, suppositories, nasal preparations, pulmonary preparations, eye drops, etc., for patient ingestion.

[0045] In some embodiments, suitable modes of administration of the pharmaceutical composition or pharmaceutical formulation include any of a variety of methods and delivery systems known to those skilled in the art to physically introduce the pharmaceutical composition or pharmaceutical formulation of the present invention into the subject, including but not limited to oral administration, parenteral administration, administration by inhalation spray, topical administration, rectal administration, nasal administration, buccal administration, or administration via an implanted reservoir.

[0046] In some embodiments, oral administration or injection administration can be selected, wherein injection administration includes the form of rapid injection or continuous infusion. In the case of a pharmaceutical composition or pharmaceutical formulation for injection administration, it can be in the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it can contain formulation agents such as suspending agents, preservatives, stabilizers and / or dispersants.

[0047] A fourth aspect of the present invention provides a method for maintaining protein homeostasis in hematopoietic stem and progenitor cells.

[0048] Furthermore, the method comprises administering the Gemin8 or Rnpc3 described in the first aspect of the present invention to a hematopoietic stem and progenitor cell system in need thereof.

[0049] Furthermore, the Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.

[0050] The fifth aspect of the present invention provides the use of Gemin8 or Rnpc3 in reducing the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells.

[0051] Furthermore, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0052] (1) Gemin8 or Rnpc3 protein;

[0053] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0054] (3) an expression cassette containing the gene described in (2);

[0055] (4) a vector containing the expression cassette described in (3);

[0056] (5) a host cell containing the vector described in (4);

[0057] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0058] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0059] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0060] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0061] In addition, the present invention also provides a method for treating and / or preventing diseases or conditions caused by imbalance in protein homeostasis of hematopoietic stem and progenitor cells, the method comprising: administering a therapeutically and / or preventively effective amount of the pharmaceutical composition or pharmaceutical preparation provided above of the present invention to a subject in need.

[0062] In some embodiments, the diseases or disorders caused by the imbalance of protein homeostasis in hematopoietic stem and progenitor cells include but are not limited to sickle cell anemia, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and different types of spinocerebellar ataxia.

[0063] In some embodiments, the subject comprises one or more animals, including, for example, cattle, horses, sheep, primates, avian, and rodent species. The subject can be a mammal, bird, fish, reptile, or amphibian. The mammal includes a human or a non-human mammal. In other embodiments, the subject can be a mouse, rat, hamster, ferret, gerbil, rabbit, monkey, chimpanzee, horse, pony, donkey, sheep, pig, chicken, goat, cat, or dog. In a preferred embodiment, the subject is a human.

[0064] Compared with the prior art, the present invention has the following beneficial effects:

[0065] The present invention creatively discovered for the first time a new use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells, effectively overcoming the current technical problem faced in this field of how to effectively maintain protein homeostasis in hematopoietic stem and progenitor cells. It provides an effective method for maintaining protein homeostasis in hematopoietic stem and progenitor cells, and also lays the foundation for the development of hematopoietic stem and progenitor cells with better functionality and transplantation potential, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 : After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the expression level of Gemin8 was detected;

[0067] Figure 2 : After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in the cells was detected by flow cytometry;

[0068] Figure 3 : After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in the cells was detected by flow cytometry;

[0069] Figure 4 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the expression level of Gemin8 was detected;

[0070] Figure 5 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in the cells was detected by flow cytometry;

[0071] Figure 6 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in the cells was detected by flow cytometry;

[0072] Figure 7 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the expression levels of UPR-related genes ERDJ4, CHOP, and their downstream gene GADD34 were detected by RT-qPCR;

[0073] Figure 8 : Analysis of translation efficiency in c-Kit+ cells with Gemin8 knockdown;

[0074] Figure 9 : After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the expression level of Rnpc3 was detected;

[0075] Figure 10 : After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in the cells was detected by flow cytometry;

[0076] Figure 11 : After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in the cells was detected by flow cytometry;

[0077] Figure 12 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the expression level of Rnpc3 was detected;

[0078] Figure 13 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in the cells was detected by flow cytometry;

[0079] Figure 14 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in the cells was detected by flow cytometry;

[0080] Figure 15 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the expression levels of UPR-related genes ERDJ4, CHOP, and their downstream gene GADD34 were detected by RT-qPCR;

[0081] Figure 16: Analysis of translation efficiency in c-Kit+ cells with Rnpc3 knockdown;

[0082] Figure 17 : Schematic diagram of the lentiviral infection vector overexpressing Gemin8;

[0083] Figure 18 : Schematic diagram of the lentiviral infection vector overexpressing Rnpc3. DETAILED DESCRIPTION

[0084] The present invention will be further described below with reference to specific embodiments. The following specific embodiments are intended only to illustrate the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0085] The reagents and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods not specifying specific conditions in the present invention are generally performed under conventional conditions or conditions recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0086] Example 1 Application of higher-level expression of Gemin8 in maintaining protein homeostasis in hematopoietic stem and progenitor cells

[0087] 1. Experimental methods

[0088] Screening strategy: Mouse c-Kit+ LSK cells and LKS- cells were sorted for polysome profiling. RNA-binding proteins that bind to 80s and polysomes during translation were analyzed. Gemin8 was screened based on the results of ultra-low-level protein profiling.

[0089] After overexpressing Gemin8 in a 32D mouse hematopoietic stem cell line (purchased from the ATCC cell resource bank, mouse IL-3-dependent cells), misfolded and unfolded proteins in the cells were detected by flow cytometry. The specific experimental method is as follows:

[0090] Using a lentiviral infection vector that overexpresses Gemin8 (such as Figure 17Lentiviral vector (pLV[Exp]-EGFP / Puro-EF1A) was purchased from Yunzhou Biotechnology Co., Ltd. to overexpress Gemin8. The sequence corresponding to Gemin8 is shown in SEQ ID NO: 1. The specific steps for lentiviral packaging and infection of 32D cells are as follows:

[0091] (1) Mix the plasmids (4.5 μg of pMD2.G, 1.5 μg of pSPAX2, and 6 μg of pLV[Exp]-EGFP / Puro-EF1A>mGemin8, totaling 12 μg), and add 800 μL of Optimum (for cells in a 10 cm dish). (2) Add the Lipofectamine™ LTX reagent to the plasmid at a 1:1 mass-volume ratio (e.g., 12 μg of plasmid requires 12 μL), mix thoroughly by inverting, centrifuge, and let stand at room temperature for 5 min. (3) Add the transfection reagent LTX to the plasmid at a 1:2-1:2.5 ratio, mix thoroughly by inverting, centrifuge, and let stand at room temperature for 30 min. (4) After 30 min, replace the cell culture medium with 10 mL of DMEM medium per dish, supplemented with 10% fetal bovine serum (FBS), L-glutamine (Gln) (200 μg). mM, 100×) and sodium pyruvate (100 mM, 100×); (5) Add the mixed transfection reagent to the cells, mix well, and incubate at 37°C, 5% CO in a culture incubator for 4-6 h; (6) Change the medium, add 30% FBS, L-Glutamine, sodium pyruvate and PS to 15 mL per dish in DMEM; (7) Collect the virus after 48 h; (8) Filter the 293T cell supernatant with a 0.45 μm filter; (9) High-speed centrifugation, level the centrifuge tube with culture medium and then ultracentrifuge at 20,000 rpm, 4°C, 3 h; (10) Discard the supernatant and dissolve the cell basal culture medium; (11) Infect 32D cells, add the infection promoter polybrene (8 mg / mL, 1000×), and change the cell medium after 14-16 h; 36 h later, EGFP-positive cells were sorted by flow cytometry to obtain purified 32D cells overexpressing Gemin8.

[0092] Misfolded proteins were detected using a kit (PROTEOSTAT ®Aggresome detection kit, ENZO, ENZ-51035-0025), the operation process is as follows: (1) collect cells, resuspend the cell pellet in 1 mL 4% tissue cell fixative, and add PBS to wash the cell pellet; resuspend each sample in 500 μL 1× Assay Buffer, add 2000-fold diluted PROTEOSTAT ® Aggresome Red Detection Reagent was incubated at room temperature for 30 min and then analyzed by flow cytometry.

[0093] The unfolded protein detection method is as follows: (1) Tetraphenylethene maleimide (TPE-MI) is added to the cell culture medium and incubated; (2) The cells are collected and centrifuged at 1000 rpm for 5 min; after resuspending in 300 μL PBS, flow cytometry analysis is performed.

[0094] After knocking down Gemin8 in a 32D mouse hematopoietic stem cell line (purchased from the ATCC cell resource bank, mouse IL-3-dependent cells), misfolded and unfolded proteins in the cells were detected by flow cytometry, and the expression levels of UPR-related genes were detected by RT-qPCR. The specific experimental methods are as follows:

[0095] The lentiviral vector plasmid for knocking down Gemin8 was purchased from Jiman Biotechnology (Shanghai) Co., Ltd. The vector backbone was PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro-WPRE. The shRNA NC sequence was constructed as follows: TTCTCCGAACGTGTCACGT (SEQ ID NO: 2), and the shGemin8 sequence was as follows: AGAGTGCGACCTGAGCAATAT (SEQ ID NO: 3).

[0096] The methods for lentivirus packaging and infection of 32D cells were the same as above; the methods for detecting misfolded and unfolded proteins were the same as above; the steps for detecting the expression levels of UPR-related genes by RT-qPCR were as follows: (1) Total RNA extraction: discard the culture medium, add 500 μL Trizol to lyse the cells, and mix thoroughly; add 100 μL CHCl3, mix vigorously for 15 s, and let it stand at room temperature for 2 min; centrifuge, 12000 g, 4°C, 15 min; aspirate the aqueous phase into a clean RNase-free 1.5 mL centrifuge tube; add 250 μL IPA, mix by inversion, and let it stand at room temperature for 10 min; centrifuge, 12000 g, 4°C, 10 min; discard the supernatant, add 1 mL pre-cooled 75% ethanol to wash the RNA precipitate; centrifuge, 12000 g, 4°C, 5 min; discard the supernatant, dry at room temperature, and add 10-30 μL ultrapure water to dissolve it; use NanoDrop to determine the concentration and purity of RNA. (2) Reverse transcription: Take 1 μg RNA for reverse transcription, reaction system A is shown in Table 1; 70℃, 10 min, quickly transfer to ice to cool; add reaction system B (as shown in Table 2), shake and centrifuge to mix evenly, and prepare cDNA through the following procedure: 42℃, 1 h; the prepared cDNA can be stored at 4℃ for a short time or at -20℃ for a long time; (3) RT-qPCR real-time fluorescence quantitative PCR: prepare PCR reaction system on ice (as shown in Table 3); add PCR system to 96-well plate or 384-well plate in sequence, centrifuge for 1 min; turn on the machine, start the software, put in the PCR well plate, and set the program shown in Table 4; run the program, collect data, and analyze the expression of mRNA. The relevant qPCR primer sequences are shown in Table 5.

[0097] Table 1 Reaction system A

[0098]

[0099] Table 2 Reaction system B

[0100]

[0101] Table 3 PCR reaction system

[0102]

[0103] Table 4 Reaction procedure

[0104]

[0105] Table 5 Related qPCR primer sequences

[0106]

[0107] In addition, this example further analyzed the translation efficiency of c-Kit+ cells with Gemin8 knockdown. The specific experimental method is as follows: Click-iT™ Plus OPP Alexa Fluor™ 647 Protein Synthesis Detection Kit (Invitrogen, C10458) was used. The specific operation process is as follows: mice were killed by cervical dislocation; mouse bone marrow cells were isolated; the cell suspension after erythrocyte lysis was diluted and the cells were counted; 1×10 7 Cells were centrifuged at 4°C, 600 g for 5 min, and the supernatant was removed. The cell pellet was resuspended in 1 mL of 4% tissue cell fixative and incubated at room temperature for 1 h. The cells were centrifuged at 4°C, 600 g for 5 min, and the supernatant was removed. 0.1% Triton X-100 was added to permeabilize the cell membrane and incubated at room temperature for 30 min. The cells were centrifuged at 4°C, 600 g for 5 min, and the cell pellet was washed with PBS. 100 μL of detection solution was added to each sample and incubated at room temperature for 30 min. The detection solution was prepared fresh, with the formula for 1 mL being: 880 μL Click-iT ® OPP Reaction Buffer, 20 μL Copper Protectant, 2.5 μL Alexa Fluor ® picolyl azide, 100 μL Click-iT ® Reaction Buffer Additive; centrifuge at 4°C, 600 g, 5 min, remove the supernatant; resuspend each sample in 300 μL PBS and analyze by flow cytometry.

[0108] 2. Experimental results

[0109] The results showed that after overexpression of Gemin8 in 32D mouse hematopoietic stem and progenitor cell lines, Gemin8 was significantly overexpressed ( Figure 1 ), in 32D cells with significant overexpression of Gemin8, the amount of misfolded proteins aggregated in the cells ( Figure 2 ), unfolded protein content ( Figure 3 ) were significantly reduced.

[0110] The results showed that after knocking down Gemin8 in 32D mouse hematopoietic stem and progenitor cell lines, Gemin8 was significantly knocked down ( Figure 4), in 32D cells with significant knockdown of Gemin8, the amount of misfolded proteins aggregated in the cells ( Figure 5 ), unfolded protein content ( Figure 6 ) were significantly increased, and the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 ( Figure 7 ) were significantly increased, proving that Gemin8 does play an important role in maintaining HSC protein homeostasis. Overexpression of Gemin8 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines.

[0111] By analyzing the translation efficiency of Gemin8 KD c-Kit+ cells, it was found that the translation efficiency of the cells ( Figure 8 ), suggesting that Gemin8 may maintain the protein homeostasis of c-Kit+ by maintaining its lower translation efficiency.

[0112] Example 2 Application of higher level expression of Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells

[0113] 1. Experimental methods

[0114] Screening strategy: Mouse c-Kit+ LSK cells and LKS- cells were sorted for polysome profiling to analyze RNA-binding proteins that bind to 80s and polysomes and play a role in translation. Rnpc3 was screened based on the results of extremely low-level protein profiling.

[0115] After overexpressing Rnpc3 in a 32D mouse hematopoietic stem cell line (purchased from the ATCC cell resource bank, mouse IL-3-dependent cells), misfolded and unfolded proteins in the cells were detected by flow cytometry. The specific experimental method is as follows:

[0116] The lentiviral vector plasmid (e.g. Figure 18 The vector for overexpressing Rnpc3 was purchased from Yunzhou Biotechnology Co., Ltd. The vector backbone was pLV[Exp]-EGFP / Puro-EF1A, and the sequence of Rnpc3 was shown in SEQ ID NO: 12.

[0117] The methods for lentiviral packaging and infection of 32D cells were the same as above; the methods for detecting misfolded and unfolded proteins were the same as above.

[0118] After knocking down Rnpc3 in a 32D mouse hematopoietic stem and progenitor cell line (purchased from the ATCC Cell Resource Bank, mouse IL-3-dependent cells), misfolded and unfolded proteins were detected by flow cytometry, and the expression levels of UPR-related genes were assessed by RT-qPCR. The lentiviral vector plasmid for knocking down Rnpc3 was purchased from Jiman Biotechnology (Shanghai) Co., Ltd. The vector backbone consists of PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro-WPRE. The shRNA NC sequence is shown in SEQ ID NO: 2, and the shRnpc3 sequence is ACAGAGAATGAACAGATTAAT (SEQ ID NO: 13). Other detection methods were the same as above.

[0119] In addition, this example further analyzed the translation efficiency of c-Kit+ cells with Rnpc3 knockdown, and the detection method was the same as above.

[0120] 2. Experimental results

[0121] The results showed that after overexpression of Rnpc3 in 32D mouse hematopoietic stem and progenitor cell lines, Rnpc3 was significantly overexpressed ( Figure 9 ), in 32D cells with significant overexpression of Rnpc3, the amount of misfolded proteins accumulated in the cells ( Figure 10 ), unfolded protein content ( Figure 11 ) were significantly reduced.

[0122] The results showed that knockdown of Rnpc3 in 32D mouse hematopoietic stem and progenitor cell lines significantly reduced Rnpc3 expression ( Figure 12 ), in 32D cells with significant Rnpc3 knockdown, the amount of misfolded proteins accumulated in the cells ( Figure 13 ), unfolded protein content ( Figure 14 ) were significantly increased, and the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 ( Figure 15 ) were significantly increased, demonstrating that Rnpc3 does play an important role in maintaining HSC protein homeostasis. Overexpression of Rnpc3 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines.

[0123] By analyzing the translation efficiency of Rnpc3 KD c-Kit+ cells, it was found that the translation efficiency of the cells ( Figure 16 ), suggesting that Rnpc3 may maintain the protein homeostasis of c-Kit+ by maintaining its lower translation efficiency.

Claims

1. A method for maintaining protein homeostasis of hematopoietic stem and progenitor cells in vitro for non-therapeutic purposes, characterized in that: The method is to construct an in vitro hematopoietic stem and progenitor cell line that overexpresses Gemin8 or Rnpc3 gene.

2. The method according to claim 1, characterized in that The overexpression of Gemin8 or Rnpc3 gene can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.