Sex determination gene Rpfmd2 of the bee-margin bug and its application in biological control

Abstract

The invention provides a sex determination gene of the bee-edge bug Rpfmd2 The invention relates to the field of biotechnology and its use in biological control. After knocking down the gene expression level in the bee-marked stink bug using RNA interference technology, the bee-marked stink bug's development and female sex-specific differentiation process are abnormal, and the female insect even produces male-specific external genitalia; in addition, it also leads to a decrease in the egg-laying amount of the female insect and the death of the eggs. All of the above abnormal phenomena lead to the death of the bee-marked stink bug, and indicate that Rpfmd2 The gene plays an important role in the sex differentiation of the bee-edge stink bug. Given that the genes involved in regulating the sex determination of insects are highly specific, the gene can be used as a target for precise prevention and control of the bee-edge stink bug. At the same time, the dsRNA targeting it can disrupt the sex ratio of the bee-edge stink bug and reduce its population, thereby achieving the purpose of effective prevention and control of the bee-edge stink bug. In summary, the present invention provides a theoretical basis for biological control of the bee-edge stink bug.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a sex determination gene Rpfmd2 of a bee stink bug and application thereof in biological control. Background Art

[0002] Riptortus pedestris belongs to the Coreidae family of the order Hemiptera, and is also known as the white-striped bee-edge bug and bean-edge bug. Riptortus pedestris has a wide geographical distribution, mainly distributed in Henan, Hebei, Shaanxi, Anhui, Zhejiang, Jiangxi, Guangxi, Sichuan, Guizhou, Yunnan and other places in China; and mainly distributed in East Asia, South Asia and Southeast Asia abroad, such as South Korea, Japan, India, Pakistan and other places.

[0003] The bee stink bug is an insect with incomplete metamorphosis, and its development needs to go through three stages: fertilized egg, nymph, and adult. Most of the eggs of the bee stink bug are laid on the back of soybean leaves, stems, and pods. They are yellow-brown and flat on the surface. The egg stage is generally 7 to 9 days; the nymph stage is divided into 5 stages, and temperature has a significant impact on the development period of nymphs.

[0004] The bee stink bug is a polyphagous agricultural pest with a wide range of hosts. It harms a variety of crops and fruit trees, especially legumes, such as soybeans, mung beans, broad beans, kidney beans and cowpeas. In addition, it also harms lotus seeds, loofahs, and other vegetables and grain crops. Like other piercing-sucking insects, the nymphs and adults of the bee stink bug pierce the epidermis of bean pods through their piercing-sucking mouthparts and suck nutrients from the plant juice, causing stunted pod development and shrunken grains. In severe cases, the entire soybean plant will die. In addition, the latest field and laboratory experiments have shown that the bee stink bug is one of the main causes of soybean greening disease, which is a physiological disease of soybeans, commonly known as greedy greening and reverse greening. The main disease manifestations are dark green leaves, sparse pods, and unsaturated pods in the late growth period. The soybean yield in areas with severe greening plants has been significantly reduced, and in some areas, the yield has even been completely lost.

[0005] At present, chemical control of the bee stink bug mainly relies on broad-spectrum insecticides, including fenitrothion, diazinon and cypermethrin. Due to the wide distribution range and high mobility of the host of the bee stink bug, the bee stink bug can evade the application of insecticides. In addition, the frequent use of insecticides will reduce the number of natural enemies of the bee stink bug, leading to secondary pest outbreaks. With the development of technologies such as gene sequencing, gene interference (RNAi) and gene editing (CRISPR / Cas9), it is possible to conduct in-depth research on the basic life course of agricultural pests. At the same time, it also provides a new option for agricultural pest control - combining insect sexual differentiation with insect sterilization technology to control agricultural pests, that is, using genetic technology to kill a single sex in the pest population, thereby quickly reducing its population, preventing its large-scale outbreak, and fundamentally solving the occurrence of pests. However, the study of the mechanism of sexual differentiation of the bee stink bug is still in its infancy, that is, there are still few known target genes for the control of the bee stink bug, which has brought obstacles to the future application of biotechnology to control the bee stink bug. Summary of the invention

[0006] In view of the above problems, the present invention provides a sex determination gene Rpfmd2 of the bee edge stink bug and its use in biological control. The Rpfmd2 gene sequence is shown in SEQ ID NO. 1. After the present invention uses RNA interference technology (RNAi) to knock down the gene in the bee edge stink bug, the development of the bee edge stink bug and the female sex-specific differentiation process are abnormal, and the female insect even produces male-specific external genitalia; in addition, it also leads to a decrease in the egg laying of female insects and the death of eggs. All of the above abnormal phenomena lead to the death of the bee edge stink bug, and indicate that the Rpfmd2 gene plays an important role in the sex differentiation of the bee edge stink bug. In view of the high specificity of genes involved in regulating the sex determination of insects, the gene can be used as a target for precise control of the bee edge stink bug, and the dsRNA targeting it can achieve the purpose of effectively controlling the bee edge stink bug by disrupting the sex ratio of the bee edge stink bug and reducing its population. In summary, the present invention provides a theoretical basis for biological control of the bee edge stink bug.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] In one aspect, the present invention provides a use of a sex determination gene Rpfmd2 of a bee-margin stink bug for controlling the bee-margin stink bug, wherein the gene comprises a nucleotide sequence as shown in SEQ ID NO. 1 in the sequence list.

[0009] Previous studies have shown that the Nlfmd2 gene of brown planthopper regulates the development of female brown planthoppers [1], but the homologous gene Rpfmd2 in the bee stink bug has not been reported, and its role in the male-female differentiation of the bee stink bug is unknown, so this aspect has conducted a preliminary exploration of this gene. The present invention discloses for the first time the nucleotide sequence of the Rpfmd2 gene (SEQ ID NO: 1) and the protein sequence encoded by it (SEQ ID NO: 2), and conducts a preliminary exploration of the function of the Rpfmd2 gene, and finds that the Rpfmd2 gene plays an important role in all growth and development stages of the bee stink bug, and finds that compared with the role of fmd2 in male brown planthoppers, after knocking down the Rpfmd2 gene, the mortality rate of male bee stink bugs in the nymph stage is significantly higher. In summary, the present invention provides a new target for the green control of the bee stink bug, and further expands the functional research of the fmd2 gene.

[0010] Furthermore, the bee-spotted stink bug is a bee-spotted stink bug in the adult, nymph and egg stages.

[0011] On the other hand, the present invention provides a use of a sex determination gene of a bee-shaped edge bug for controlling the bee-shaped edge bug by affecting at least one physiological process of the bee-shaped edge bug's emergence into adulthood, molting, reproductive organ development, egg laying, and egg hatching, wherein the gene comprises a nucleotide sequence as shown in SEQ ID NO. 1 in the sequence list.

[0012] The experimental data provided by the present invention proves that the Rpfmd2 gene mainly regulates the process of female differentiation of the bee-margin bug.

[0013] Furthermore, the reproductive organ is a female reproductive organ.

[0014] In another aspect, the present invention provides a dsRNA for controlling the bee-margin stink bug, wherein the dsRNA specifically targets the Rpfmd2 gene (SEQ ID NO. 1).

[0015] Further, the dsRNA comprises a sequence as shown in SEQ ID NO. 9 and / or SEQ ID NO. 13 in the sequence listing; further, the dsRNA shown in SEQ ID NO. 9 (dsRpfmd2 com ) has the best silencing effect and has a greater impact on the growth and development of the point bee-margin stink bug, so dsRpfmd2 is preferred com .

[0016] In another aspect, the present invention provides a use of a dsRNA for controlling a bee-margin stink bug, wherein the dsRNA is the same as described above.

[0017] In another aspect, the present invention provides a method for controlling the point bee stink bug, which uses the dsRNA as described above to control the point bee stink bug.

[0018] Furthermore, the concentration of the dsRNA is 1-2 μg / μL.

[0019] It should be understood that, in addition to fiber injection, the dsRNA can be used in combination with other materials / techniques, such as being encapsulated in nanoparticles and sprayed on the surface of crops, or constructing transgenic plants that can stably express the dsRNA to achieve the purpose of controlling the point bee stink bug.

[0020] In some specific embodiments, the dsRNA is introduced into the body of the bee-margin stink bug by microinjection.

[0021] The beneficial effects of the present invention include:

[0022] 1. Interference with the Rpfmd2 gene will lead to abnormal growth or development of the bee-margin stink bugs at different stages (egg stage, nymph and adult), which will then lead to their death. This shows that the Rpfmd2 gene can be used as a target for the prevention and control of bee-margin stink bugs at all stages, not just at a specific age.

[0023] 2. The present invention confirms that the Rpfmd2 gene has a greater impact on the female differentiation of the bee-margin stink bug. Therefore, interfering with the Rpfmd2 gene will cause a large number of female insects to die, thereby causing an imbalance in the sex ratio within the bee-margin stink bug population and significantly reducing the number of individuals in the population. In addition, knocking down the Rpfmd2 gene in insect eggs will also reduce the amount of eggs laid by female insects and the hatching rate, thereby greatly reducing the number of offspring of the bee-margin stink bug.

[0024] 3. The sequence of insect sex-determining genes is highly specific among species, so the Rpfmd2 gene of the bee-margin stink bug has the potential and value for precise control of the bee-margin stink bug;

[0025] 4. The present invention provides two dsRNAs (dsRpfmd2) that specifically and efficiently downregulate the expression of the Rpfmd2 gene. The dsRNAs (SEQ ID NO. 9 and SEQ ID NO. 13) can both cause the bee stink bug to die due to molting, and thus can be subsequently applied to the biological control of the bee stink bug. SEQ ID NO. 9 is preferred. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1: Nucleic acid and amino acid sequences of Rpfmd2 gene;

[0028] Figure 2 :The expression pattern of Rpfmd2 gene; E: (Egg 0-3 h, 6 h, 12 h, 24 h, 36 h, 48 h, 72 h, 96 h, 120 h and 144 h) are different time points in the embryonic period of D. cerana; 1 st , 2 nd , 3 rd , 4 th and 5 th They represent the five stages of the bee-margin bug, which lasts 21 to 25 days;

[0029] Figure 3 :Statistics of mortality of 1st or 2nd instar nymphs of the bee-margin bug after interfering with the Rpfmd2 gene, where A is 1 st Relative expression level of Rpfmd2 gene in different instars of Pseudomonas aeruginosa (n = 3), B = 1 st Survival rate of the bee-margined stink bugs at different ages (n = 50), C = 1 st The number of nymphs of the different sexes of the bee-shaped stink bug that emerged into adults (n = 50), D is 2 nd Relative expression of Rpfmd2 gene in different instars of Pseudomonas aeruginosa (n = 3), E = 2 nd Survival rate of the bee-margined bugs at different ages (n = 50), F = 2 nd The number of nymphs of the different sexes of the instar that emerged into adults (n = 50);

[0030] Figure 4 :External morphology of 1-2 instar nymphs of the bee-margin bug after Rpfmd2 gene interference (n = 30), the scale bars in the figures are 2 mm;

[0031] Figure 5 :External genitalia of the third-instar adult of the bee-margin bug after Rpfmd2 gene interference (n = 30), the scale bars in the figures are 0.5 mm, the white arrows point to the female ovipositor, and the red arrows point to the male clasper;

[0032] Figure 6 :The reproductive organs of the third-instar adult of the bee-margin bug after the Rpfmd2 gene was interfered with (n = 30), the scale bars in the figures are 1 mm;

[0033] Figure 7 : Statistics on the number of eggs laid and the hatching rate of female bee-margin bugs on the 8th day after the Rpfmd2 gene was interfered, where A is the number of eggs laid (n = 20); B is the hatching rate (n = 20);

[0034] Figure 8:The external morphology of the third-instar bee-margin bug after interfering with the Rpfmd2 gene, where A is 3 rd Relative expression levels of Rpfmd2 gene in different age groups of P. punctatus (n = 3). B is the relative expression levels of Rpfmd2 gene in different age groups of P. punctatus (n = 3). rd Molting of different instars of the bee-margin bug (n = 30). DETAILED DESCRIPTION

[0035] The present invention is further elaborated in detail below in conjunction with the accompanying drawings and specific embodiments of the specification. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work are within the scope of protection of the present invention.

[0036] The technical means not described in detail in the following examples are all conventional techniques well known to professionals in the field; the materials and reagents used are shown in Table 1. The primers of the present invention are synthesized by Shanghai GenScript Biotech Co., Ltd.; the rest are reagents and materials that are commercially available unless otherwise specified.

[0037] Table 1 Some of the reagents used in the examples and their sources

[0038]

[0039] Example 1: Acquisition of the Rpfmd2 gene of the bee-margin stink bug

[0040] The NlFMD2 (MW082039.1) gene was retrieved from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and the homologous sequence comparison function in a specific species (Riptortus pedestris (taxid:329032)) provided by the website was used to obtain the CDS (Coding Sequence) sequence with the highest homology to the NlFMD2 gene in Riptortus pedestris, which is the Rpfmd2 gene described in the present invention (nucleotide sequence is shown in SEQ ID NO. 1, amino acid residue sequence is shown in SEQ ID NO. 2, see Figure 1 ). The CDS sequence of the Rpfmd2 gene is 978 bp in length, encoding a protein containing 325 amino acid residues and a molecular weight of 34.28 kDa.

[0041] Next, according to the sequence shown in SEQ ID NO. 1, PCR primers for amplifying the Rpfmd2 gene were designed using the NCBI online website, specifically, the primers were Rpfmd2-S: 5'-ACCCACTATTGCTGCTATTT-3' (SEQ ID NO. 3), Rpfmd2-AS: 5'-CAACACCCACTGCTAAAGA-3' (SEQ ID NO. 4); the steps of obtaining the PCR reaction template were as follows: the laboratory-reared population of the bee-margin stink bug was collected from the wild in Suzhou. In the laboratory, the bee-margin stink bug was fed with soybean seedlings and soybeans, the temperature of the insect room was set at 26±0.5℃, and the light was set at 12 h of light and 12 h of darkness; the total RNA of 2 female insects and 2 male insects in the adult stage was extracted using the TRIZOL method, and a total of 1 μg of RNA was used for reverse transcription reaction, the reverse transcription system was 10 μL, and the reagent used was a high-efficiency second-generation qPCR-specific reverse transcription reagent (genomic-free) kit in the form of a premixed solution of Novozymes; the reaction solution was diluted 10 times (i.e., 9.8 μL of the reaction solution was diluted into 89.2 μL of double distilled water), and then a template for amplifying the Rpfmd2 gene was obtained, and the reagent used for amplification was Taq enzyme; the complete open reading frame sequence of the Rpfmd2 gene obtained by the above polymerase chain reaction (PCR) was connected to the pMD-19T vector, and the reagent used was TAKARA's pMD™19-T Vector Cloning Kit. After the recombinant plasmid was preliminarily screened with the antibiotic ampicillin, it was sequenced and verified, and then the pMD-19T vector containing the Rpfmd2 gene sequence (Rpfmd2-pMD-19T) was prepared.

[0042] Example 2: The Rpfmd2 gene of the bee stink bug is constitutively expressed

[0043] This example explores the expression level of the Rpfmd2 gene in different ages of the bee-margin stink bug, and lays a certain theoretical foundation for exploring the function of the gene. The operation is as follows: first, the total RNA of the bee-margin stink bug (n = 3) at each growth stage is extracted, and a reverse transcription reaction is performed to generate cDNA, and the cDNA is diluted, and the dilution multiple is 1. The diluted cDNA is used as a template for real-time fluorescence quantification. The specific process of the experiment is the same as that described in Example 1; the real-time fluorescence quantification primers of the Rpactin (internal reference) and Rpfmd2 genes are designed using the NCBI website, specifically, qPCR-Rpactin-S: CTCCTGAGTCAAGCACAATA (SEQ ID NO. 5), qPCR-Rpactin-AS: GCATCACACCTTCTACAATG (SEQ ID NO. 6); qPCR-Rpfmd2-S: AAAAATCAAATAAAATGAACGG (SEQ ID NO. 7), qPCR-Rpfmd2-AS: AAGTGAAATAAGAGAATGGCAC (SEQ ID NO. 8) The remaining steps of the real-time fluorescence quantitative experiment are detailed in the instructions of the reagents described in Table 1; the results of the fluorescence quantitative PCR experiment were analyzed using the relative quantitative △△CT method, and the results are shown in Figure 2 .

[0044] Depend on Figure 2 As shown in the data, in eggs laid within 36 h, the expression level of the Rpfmd2 gene remained basically the same, and reached a peak at 36 h; with the growth and development of the bee-margin bug, although its expression level fluctuated, it still maintained at a high level; in summary, the Rpfmd2 gene is expressed throughout the entire developmental period of the bee-margin bug, that is, it is constitutively expressed.

[0045] Example 3: Study on the physiological function of the Rpfmd2 gene of the bee-margin stink bug 1

[0046] Although it is known that the fmd2 gene is involved in regulating the process of sexual differentiation of brown planthoppers, its role in the growth and development of the bee-margin stink bug is still unknown. Therefore, this example uses dsRNA (double strand RNA) to target and silence the Rpfmd2 gene of the bee-margin stink bug to explore the physiological function of the Rpfmd2 gene. The present invention designed multiple dsRNAs and tested the interference efficiency in the bee-margin stink bug. It was found that dsRpfmd2 com (SEQ ID NO. 9) and dsRpfmd2 103 The interference efficiency is relatively high, so the two double-stranded RNAs are used for subsequent experiments. The specific operations are as follows:

[0047] 3.1 Synthesis of dsRNA targeting Rpfmd2 gene: dsRNA targeting Rpfmd2 gene (dsRpfmd2 com , SEQID NO. 9) was obtained by using the Rpfmd2-pMD-19T vector as a template and a T7 RNAi Transcription Kit in vitro transcription kit. The specific primer in the transcription system has a T7 promoter at the N-terminus. Specifically, dsRpfmd2 com -S: 5'-TAATACGACTCACTATAGGGAGAGGGACCACTTCAGCACATAT-3' (SEQ ID NO. 10), dsRpfmd2 com -AS: 5'-TAATACGACTCACTATAGGGAGATCCTCTCATTCCAGCCATAC-3' (SEQ ID NO. 11); the synthesized dsRNA was detected using 1% agarose gel, a single band of the expected size was recovered, the concentration was determined, and the gel recovery product was diluted to a dsRNA concentration of 1-2 μg / μL (preferably 1 μg / μL in this embodiment), and then stored at -80°C.

[0048] 3.2 Injection of dsRNA: Use a needle puller P-97 (‌Sutter) with the following program parameters: heat = 800, pull = 150, vel = 150, time = 80 min, pull the capillary into a glass needle suitable for microinjection, and inject the dsRNA (dsRpfmd2) described in step 3.1. com ) or negative control dsgfp (SEQ ID NO. 12) was injected into a glass needle; 1st, 2nd or 3rd instar larvae of the bee-edge bug or unmated female / male bee-edge bugs were selected and anesthetized with carbon dioxide for 1-3 minutes, the bee-edge bugs were placed under a stereoscope, and 0.5-1 μL dsRNA (preferably 1 μL in this embodiment) was injected into the mesothoracic hind legs of the bee-edge bugs using a microinjector, wherein the parameters set for the microinjector were as follows: injection pressure (injection pressure, Pi) 1,000 hPa, pressure maintenance time (injection time, ti) 0.5 s, compensation pressure (compensation pressure, pc) 20 hPa.

[0049] 3.3 dsRpfmd2 comInterference efficiency detection: The efficiency of silencing target genes of dsRpfmd2 determines the reliability and accuracy of the subsequent research results of Rpfmd2 gene function. Therefore, the interference efficiency of dsRpfmd2 was detected by real-time fluorescence quantitative experiment. The detection steps are as follows: 3 days after the dsRNA was used to interfere with the expression of Rpfmd2 gene in bee-edge bugs, the two groups (dsRpfmd2 com Three individuals were randomly selected from the bee-edge bugs (n = 3) in the dsgfp group and the dsgfp group, and RNA was extracted from the samples in the same group (n = 3) and reverse transcribed into cDNA, and the cDNA was diluted. The specific operation was the same as described in Example 2. Figure 3 From A and D in the figure, we can see that dsRpfmd2 com It can significantly down-regulate the expression of target genes in the bee-margined bugs at different stages, so subsequent physiological phenotype observation experiments can be carried out.

[0050] 3.4 Determination of physiological indicators

[0051] The measurement of physiological indicators includes the following:

[0052] (1) Mortality statistics: The injected nymphs were reared under the same rearing conditions as described in Example 1, and the number of surviving nymphs was counted every 24 hours;

[0053] (2) Phenotypic observation: Observe the appearance of male and female nymphs and the reproductive organs of adults using a microscope;

[0054] (3) Statistics on number of eggs laid and hatching rate.

[0055] Depend on Figure 3 As shown in Figures B and E, silencing the Rpfmd2 gene will cause the death of 1st and 2nd instar nymphs of the bee-margin bug. After 20 days of injection of dsRpfmd2, only 20% of the nymphs survived, and interfering with the expression of the Rpfmd2 gene will cause the nymphs to die due to molting ( Figure 4 ); In addition, compared with male insects, the Rpfmd2 gene has a greater impact on female insects. Specifically, the emergence rate of female nymphs of different ages is 0, but a small number of male insects can still emerge normally into adults ( Figure 3 C and F in the figure); Second, females of the bee-margin bug with Rpfmd2 gene silenced showed external genital malformations. Specifically, the female genitals degenerated and even had male genitals, but the male genitals developed normally ( Figure 5 ); Third, the ovaries of female bee-margin bugs with the Rpfmd2 gene silenced did not develop, but the testes developed normally ( Figure 6), which may be because the Rpfmd2 gene is mainly involved in the female-specific development of the bee-shaped edge bug, and has limited effect on the development of male insects. Furthermore, after downregulating the expression of the Rpfmd2 gene, the egg-laying amount of the bee-shaped edge bug decreased, and no nymphs hatched ( Figure 7 ).

[0056] Example 4: Study on the physiological function of the Rpfmd2 gene of the bee-margin stink bug 2

[0057] In order to avoid the phenomenon described in Example 3, dsRpfmd2 com This example provides another dsRpfmd2 (dsRpfmd2 103 ) and the phenotypic changes caused by them to further confirm the physiological function of Rpfmd2. 103 The full-length sequence of the gene is GAGGCUAUGGCGACUACUACGGUAGUGGAUAUGGUGGCAAUUAUGGUGGUGGCUACGGUGGUUAUGACUAUUCUGGUGGAUAUGGAGGUGGUUAUGGAAGUUA (SEQ ID NO. 13), and the amplification primers are: dsRpfmd2 103 -S: 5'- TAATACGACTCACTATAGGGAGAGAGGCTATGGCGACTACTACG-3' (SEQ IDNO. 14), dsRpfmd2 103 -AS: 5'-TAATACGACTCACTATAGGGAGATAACTTCCATAACCACCTCCA-3' (SEQ ID NO. 15), dsRpfmd2 was synthesized according to the steps described in Example 3 103 The dsRNA was injected into the 3rd instar larvae of the bee-margin stink bug using microinjection, and the interference efficiency was detected 3 days later (as described in Example 3), and the phenotype was observed after the larvae emerged as adults.

[0058] Depend on Figure 8 From A in dsRpfmd2 103 The expression of the Rpfmd2 gene can also be significantly downregulated, and we found that female insects also molted and died ( Figure 3). In summary, this embodiment uses two different dsRpfmd2 to inhibit the expression of the Rpfmd2 gene of the bee stink bug, and statistically analyzes the physiological indicators and shapes of bee stink bugs of different ages and sexes, confirming that the Rpfmd2 gene affects the physiological processes of the bee stink bug, such as emergence into adulthood, molting, reproductive organ development, egg laying, and egg hatching, especially the females. Therefore, the Rpfmd2 gene can be used as an important target for the prevention and control of bee stink bugs of different ages. At the same time, the dsRpfmd2 provided by this aspect can accurately and effectively inhibit the expression of the Rpfmd2 gene ( Figure 3 A and D in Figure 8 A in ), where dsRpfmd2 com The interference effect of dsRpfmd2 is better (i.e., the silencing efficiency is higher and the molting death phenomenon is more obvious), and it is longer and has higher targeting specificity, so dsRpfmd2 is preferred. com (SEQ ID NO. 9); In addition to the microinjection adopted in the present invention, RNA interference technology is used in combination with other technical means / materials to directly or indirectly introduce it into the body of the bee-edge stink bug, such as transferring a plasmid that can stably express dsRpfmd2 into crops preferred by the bee-edge stink bug, or spraying nanoparticles wrapped with dsRpfmd2 onto crops, so that the dsRNA can be indirectly introduced when the bee-edge stink bug is feeding, thereby achieving the purpose of reducing the bee-edge stink bug population.

[0059] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is limited by the attached claims rather than the above description. Therefore, it is intended to include all changes within the meaning and scope of the equivalent elements of the claims in the present invention, and any figure marks in the claims should not be regarded as limiting the claims involved.

[0060] References

[0061] [1] Ji-Chong Zhuo et al., A feminizing switch in a hemimetabolousinsect.Sci. Adv.7,eabf9237(2021).DOI:10.1126 / sciadv.abf9237.

Claims

1. A use of dsRNA for controlling the bee-margin stink bug, characterized in that: The dsRNA comprises the sequence shown in SEQ ID NO. 9 in the sequence listing.

2. A method for preventing and controlling bee-margin stink bugs, characterized in that: The method uses a dsRNA comprising a sequence as shown in SEQ ID NO. 9 in the sequence list to control the bee stink bug.

3. The method according to claim 2, characterized in that The concentration of the dsRNA is 1-2 μg / μL.

4. The method according to claim 2, characterized in that The dsRNA is introduced into the body of the bee-margin bug by microinjection.

Images