Methods for knocking out the sATP6v0d2 gene in PK15 cell lines and their application in inhibiting Japanese encephalitis virus infection
By knocking out the sATP6v0d2 gene in porcine kidney PK15 cells using CRISPR/Cas9 technology, a cell line that significantly inhibits Japanese encephalitis virus infection was constructed. This solves the problem of inhibiting Japanese encephalitis virus infection, provides a tool for research and drug screening, and has important application value.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HENAN AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-11-18
- Publication Date
- 2026-06-30
AI Technical Summary
Current technologies lack effective methods to inhibit Japanese encephalitis virus infection, especially in porcine kidney PK15 cells, and the regulatory role of the sATP6v0d2 gene in Japanese encephalitis virus infection has not been thoroughly studied.
Using CRISPR/Cas9 gene editing technology, sgRNA targeting the sATP6v0d2 gene was designed and transfected into porcine kidney PK15 cells via the LentiCRISPRv2 vector. Single-clonal cell lines with sATP6v0d2 gene knockout were screened and significantly inhibited infection by Japanese encephalitis virus.
A PK15 cell line with sATP6v0d2 gene knockout was successfully constructed, which significantly inhibited the infection of Japanese encephalitis virus. This provides a tool cell line for studying the infection mechanism of Japanese encephalitis virus and screening antiviral drugs, and has broad application prospects.
Smart Images

Figure CN119464379B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the method of knocking out the sATP6v0d2 gene in PK15 cell lines and its application in inhibiting Japanese encephalitis virus infection. Background Technology
[0002] Japanese encephalitis (JEV) is an acute zoonotic central nervous system disease caused by the Japanese encephalitis virus (JEV). This virus belongs to the Flaviviridae family of arboviruses, is a single-stranded positive-sense RNA virus, and possesses an envelope. JEV invades cells and enters endosomes via receptor-mediated endocytosis. The weakly acidic environment within the endosome induces conformational changes in glycoproteins, initiating the release of the viral genome into the cytoplasm for subsequent translation and assembly. JEV can be transmitted among multiple species via mosquitoes, with pigs being the primary source of infection and amplification host. JEV infection typically leads to abortion, stillbirth, mummified fetuses, and weak piglets in pregnant sows, while boars suffer from testicular swelling that renders them infertile, severely impacting the pig industry and causing significant economic losses. Due to a relative lack of in-depth research into the pathogenesis of Japanese encephalitis, there is currently no specific drug for its treatment. Prevention and mitigation of the spread of the Japanese encephalitis virus (JE virus) currently rely on mosquito control, vaccination, and the administration of broad-spectrum medications. Therefore, finding cell lines capable of inhibiting JE virus infection is a prerequisite for designing and developing novel anti-JE virus drugs, and such work is urgently needed.
[0003] Gene editing technology utilizes molecular biology techniques to precisely modify, mutate, or cut specific genes within cells. After approximately 40 years of development and innovation, the third-generation CRISPR / Cas9 gene editing technology, which relies on clustered, regularly spaced short palindromic repeats, uses small sgRNA molecules to specifically edit target genes. Compared to the first-generation ZFN and second-generation TALEN gene editing technologies, it is more convenient, efficient, and time-saving. Currently, CRISPR / Cas9 is widely used in cutting-edge research in biology, medicine, and other fields, and this technology allows for the convenient and rapid establishment of gene knockout cell lines.
[0004] The invasion of host cells by Japanese encephalitis virus (JEV) depends on an acidic intracellular environment. This acidic environment is primarily created by V-ATPase, which consumes ATP to transport H+ from the cytoplasm to the endosomal lumen. ATP6v0d2 is an important subunit of the V-ATPase complex, mainly expressed in osteoclasts, macrophages, and kidney cells. Current research on the function of ATP6v0d2 focuses on processes such as osteoclast fusion, protein degradation, autophagy-lysosome formation, and tumor microenvironment acidification. No research has been reported on whether ATP6v0d2 regulates JEV infection by altering the intracellular acidic environment.
[0005] Previous research in this invention found that knocking down the expression of the sATP6v0d2 gene using RNAi technology limited Japanese encephalitis virus (JE virus) infection, indicating that sATP6v0d2 participates in regulating JE virus infection and can serve as a target for designing and screening novel anti-JE virus drugs. Based on this, to further investigate and confirm the regulatory role of sATP6v0d2 in JE virus infection, this invention designed a specific sgRNA targeting the sATP6v0d2 gene. Using CRISPR / Cas9 technology, complete knockout of this gene was achieved in porcine kidney PK15 cells. For the first time, it was discovered that sATP6v0d2 knockout monoclonal cell lines can significantly inhibit JE virus infection, providing tools and materials for research on ATP6v0d2 gene function and JE virus infection, with broad application prospects.
[0006] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention
[0007] The technical problem to be solved by this invention is to overcome the above-mentioned technical defects and provide a method for knocking out the sATP6v0d2 gene in PK15 cell lines and its application in inhibiting Japanese encephalitis virus infection. By combining CRISPR / Cas9 technology, sATP6v0d2 knockout was achieved in porcine kidney PK15 cells. The resulting monoclonal cell line can significantly inhibit Japanese encephalitis virus infection and can be used as a tool cell line for studying the molecular mechanism of Japanese encephalitis virus infection and screening antiviral drugs, thus having high application value.
[0008] To solve the above problems, the technical solution of the present invention is a method for knocking out the sATP6v0d2 gene in PK15 cell lines, comprising the following steps:
[0009] Step 1: Design sgRNA sequences (sgRNA1, sgRNA2, or sgRNA3) targeting the sATP6v0d2 gene; sgRNA1 and sgRNA2 are located in the first exon region of the sATP6v0d2 gene, and sgRNA3 is located in the second exon region of the sATP6v0d2 gene.
[0010] Step 2: Add CACCG to the 5' end of the sense strand, AAAC to the 5' end of the antisense strand, and C to the 3' end of the antisense strand to synthesize single-stranded sgRNA using the primers from Step 1.
[0011] Step 3: The single-stranded sgRNA from Step 2 is annealed to synthesize double-stranded sgRNA with BsmBI enzyme sticky ends.
[0012] Step 4: The double-stranded sgRNA from Step 3 is recombined into the LentiCRISPRv2 vector via enzyme ligation.
[0013] Step 5: Transfect the recombinant plasmid from Step 5 into PK15 cells;
[0014] Step 6: Use puromycin to screen successfully transfected cells;
[0015] Step 7: Use the extreme dilution method to screen and obtain PK15 monoclonal cell lines with sATP6v0d2 knockout.
[0016] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection, wherein the Japanese encephalitis virus is epidemic Japanese encephalitis virus.
[0017] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection. The cell line is selected from the porcine kidney PK15 cell line, which is a classic cell line tool for studying the pathogenesis of porcine viral diseases.
[0018] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection, wherein the reagent for knocking out sATP6v0d2 expression is sgRNA targeting the sATP6v0d2 gene.
[0019] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection. The sgRNA is selected from sgRNA1, sgRNA2, or sgRNA3. The target sequence of sgRNA1 is: CGCTGAGCTGTACTTCAATG; the target sequence of sgRNA2 is: CAATGTGGACCATGGCTACC; and the target sequence of sgRNA3 is: CAAGAAGTTGCCGTAATCAG.
[0020] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection, wherein the sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R primers:
[0021] sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3';
[0022] sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3'.
[0023] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection, wherein the sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F and sgRNA2-R primers:
[0024] sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3';
[0025] sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3'.
[0026] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in inhibiting Japanese encephalitis virus infection, wherein the sgRNA3 is a double-stranded fragment formed by annealing sgRNA3-F and sgRNA3-R primers:
[0027] sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG-3';
[0028] sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3'.
[0029] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is applied in the inhibition of Japanese encephalitis virus infection. The method for knocking out sATP6v0d2 expression in PK15 cells is as follows: the function of the protein encoded by the sATP6v0d2 gene in PK15 cells is lost through CRISPR / Cas9 gene editing technology.
[0030] The advantages of this invention compared to existing technologies are:
[0031] 1. This invention provides an sgRNA targeting the sATP6v0d2 gene, and achieves sATP6v0d2 gene knockout expression in porcine kidney PK15 cells using CRISPR / Cas9 gene editing technology.
[0032] 2. This invention provides a method for constructing an sATP6v0d2 knockout cell line by transfecting a recombinant vector containing the sATP6v0d2 sgRNA fragment into a host cell;
[0033] 3. The monoclonal cell line obtained according to the present invention can significantly inhibit the infection of Japanese encephalitis virus, providing tools and materials for research on the function of ATP6v0d2 gene and Japanese encephalitis virus infection, and has broad application prospects. Attached Figure Description
[0034] Figure 1 This is a map of the LentiCRISPRv2 vector containing the sgRNA sequence of the present invention.
[0035] Figure 2 This is a schematic diagram of the sgRNA targeting the sATP6v0d2 genomic region in this invention;
[0036] Figure 3 Sequencing maps of the recombinant plasmids LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, and LentiCRISPRv2-sgRNA3 of this invention.
[0037] Figure 4 This is a graph showing the results of Western blotting detection of sATP6v0d2 protein expression in wild-type and knockout cell lines in this invention; GAPDH was used as an internal control.
[0038] Figure 5 This is a graph showing the distribution of sATP6v0d2 protein in wild-type and knockout cell lines detected by immunofluorescence in this invention; Hoechst-labeled cell nuclei; scale bar 20 micrometers;
[0039] Figure 6This is a graph showing the results of viability analysis of wild-type and sATP6v0d2 knockout porcine kidney PK15 cells in this invention.
[0040] Figure 7 This is a diagram showing the morphological results of wild-type and sATP6v0d2 knockout porcine kidney PK15 cells detected by phase contrast microscopy (20×) according to the present invention; scale bar 200 micrometers;
[0041] Figure 8 The scratch repair results (A) of wild-type and sATP6v0d2 knockout porcine kidney PK15 cells in this invention.
[0042] And analytical statistical chart (B); scale bar 500 micrometers;
[0043] Figure 9 The distribution (A) and fluorescence intensity comparison (B) of the lysosomal labeling probe LysoTracker Red in wild-type and sATP6v0d2 knockout porcine kidney PK15 cells of this invention; Hoechst labeling of cell nuclei; scale bar 20 micrometers;
[0044] Figure 10 This invention provides a real-time quantitative method for detecting the relative mRNA content of Japanese encephalitis virus (JEV) in (A) and (B) cells of wild-type and sATP6v0d2 knockout porcine kidney PK15 cells.
[0045] Figure 11 This invention presents the immunoblotting results and grayscale statistics of Japanese encephalitis virus E protein expression in wild-type and sATP6v0d2 knockout porcine kidney PK15 cells.
[0046] Figure 12 This invention presents the immunofluorescence detection results (A) and statistical analysis (B) of the distribution of Japanese encephalitis virus E protein in wild-type and sATP6v0d2 knockout porcine kidney PK15 cells; Hoechst labeling of cell nuclei; scale bar 200 micrometers. Detailed Implementation
[0047] The following description, in conjunction with embodiments, provides a clear and complete explanation of the technical solutions of the present invention, enabling those skilled in the art to fully understand the invention. This detailed description should not be construed as a limitation of the invention, but rather as a more exhaustive description of certain aspects, characteristics, and embodiments of the invention.
[0048] It should be understood that the technical terms used in this invention are for describing particular embodiments only and are not intended to limit the invention. Unless otherwise stated, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0049] Although the present invention only describes preferred methods and materials, similar or equivalent methods and materials may also be used in the implementation or testing of the present invention.
[0050] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. The specification and embodiments of this invention are merely exemplary.
[0051] The terms “including,” “having,” and “containing” used in this article are all open-ended, meaning they include but are not limited to.
[0052] The Japanese encephalitis virus (SA-14-14-2) vaccine strain involved in the following examples was purchased from Wuhan Keqian Biotechnology Co., Ltd., and preserved by the Animal Metabolic Regulation and Immune Response Team of the College of Life Sciences, Henan Agricultural University.
[0053] The LentiCRISPRv2 vector used in the following examples was preserved by the Animal Metabolic Regulation and Immune Response Team of the College of Life Sciences, Henan Agricultural University. The vector's scaffold structure is as follows: Figure 1 As shown.
[0054] Example 1: Design of sgRNA targeting the sATP6v0d2 gene
[0055] The sATP6v0d2 gene sequence information (NC_010446.5) was queried in the NCBI database, and the first and second exons of the gene were selected as the target design regions.
[0056] Based on the sgRNA design principles, the sATP6v0d2 sequence was analyzed at http: / / crispr-era.stanford.edu / index.jsp, and the results are as follows: Figure 2 As shown, three pairs of 20bp sgRNA fragments were selected based on the scoring and named as follows: sgRNA1 (CGCTGAGCTGTACTTCAATG), sgRNA2 (CAATGTGGACCATGGCTACC), and sgRNA3 (CAAGAAGTTGCCGTAATCAG). A CACCG sticky terminator was added to the 5' end of each sgRNA fragment, and AAAC and C sticky terms were added to the 5' and 3' ends of the reverse sequence, respectively, to serve as primers targeting the sATP6v0d2 gene sgRNA. These sgRNA primers were synthesized by BGI Genomics Co., Ltd.
[0057] The sgRNA primer sequences are as follows:
[0058] sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3';
[0059] sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3';
[0060] sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3';
[0061] sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3';
[0062] sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG-3';
[0063] sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3';
[0064] Example 2: Construction of LentiCRISPRv2-sgRNA recombinant plasmid
[0065] sgRNA primer annealing: The primers from Example 1 were dissolved and diluted to 20 μM with ultrapure water to prepare a 20 μL annealing reaction system: upstream primer (F), 3 μL; downstream primer (R), 3 μL; add ultrapure water to 20 μL. The reaction system was placed in a PCR instrument and incubated at 95°C for 10 minutes, then cooled by 5°C every three minutes until it reached 16°C, finally obtaining the double-stranded sgRNA fragment.
[0066] LentiCRISPRv2 vector digestion: The LentiCRISPRv2 vector was digested with BsmBI restriction endonuclease. A 20 μL digestion reaction mixture was prepared as follows: LentiCRISPRv2 vector, 3 μg; BsmBI, 1 μL; 10×CutSmart buffer, 2 μL; ultrapure water to a final volume of 20 μL. The reaction mixture was incubated at 37°C for 6 hours. The reaction products were then subjected to agarose gel electrophoresis, and the digested LentiCRISPRv2 linearized vector with sticky ends was recovered using a Novizan gel recovery kit.
[0067] sgRNA ligation to LentiCRISPRv2 vector: Double-stranded sgRNA fragments were ligated to linearized LentiCRISPRv2 vector using a 20 μL ligation reaction mixture: 13 μL double-stranded sgRNA; 4 μL linearized LentiCRISPRv2 vector; 1 μL T4 ligase; 2 μL 10×T4 Ligase Buffer. The reaction mixture was incubated in a PCR instrument at 16°C for 12 hours.
[0068] Recombinant plasmid transformation and single-clone validation: 10 μL of the enzyme-ligated product was transformed into 100 μL of DH5α *E. coli* competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 1 minute, followed by an ice incubation for 1 minute. 500 μL of antibiotic-free LB broth was added to the product, and the cells were cultured at 37°C and 220 rpm for 1 hour. Subsequently, the competent cells were spread onto LB solid culture plates containing ampicillin antibiotic resistance using a spreader, and incubated upside down at 37°C for 12 hours.
[0069] Single colonies were selected and cultured by rotation in liquid LB medium containing ampicillin resistance for 12 hours. Plasmids were extracted using the Novizan plasmid extraction kit. LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, or LentiCRISPRv2-sgRNA3 were sequenced using hU6F primers (5'-GAGGGCCTATTTCCCATGATT-3'). The detection results are as follows: Figure 3 As shown, sgRNA1, sgRNA2, or sgRNA3 have been cloned into the LentiCRISPRv2 vector, indicating that the LentiCRISPRv2-sgRNA recombinant plasmid has been successfully constructed.
[0070] Example 3: Construction of sATP6v0d2 knockout cell line
[0071] Approximately 2 × 10⁵ porcine kidney PK15 cells were seeded in a 6-well plate and cultured. When the cell confluence reached 80%, 2 μg each of the LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, or LentiCRISPRv2-sgRNA3 recombinant plasmids constructed in Example 2 were dissolved in 200 μL jetPRIME buffer. 4 μL jetPRIME reagent was added to the above system, and after standing for 10 minutes, it was added to the PK15 cell culture medium.
[0072] Similarly, the LentiCRISPRv2 vector was transfected into PK15 cells as a control group.
[0073] Twenty-four hours after transfection, the original culture medium was discarded, and puromycin-containing medium was added to continue culturing the cells. The puromycin-containing medium was then changed every three days. During this process, some cells could be observed to gradually die under a microscope, and small clusters of resistant puromycin cells would survive in the plate.
[0074] Monoclonal cells were obtained using a limiting dilution method: the cells were digested with a digestion solution containing 0.25% trypsin and 0.02% EDTA, and then resuspended in culture medium. Based on cell counts, the cell suspension was aliquoted into each well of a 96-well plate, ensuring approximately one cell per well. After 3 days of culture, the cells were observed under a microscope. Wells containing multiple cells were excluded, and the wells with single cells were labeled and cultured for another 10 days; these cells were considered monoclonal cells. Subsequently, the monoclonal cell clusters were digested with a digestion solution and transferred to 48-well plates for further passage. Once the cells reached confluence, they were sequentially passaged to 24-well, 12-well, and 6-well plates for expansion culture.
[0075] Example 4: Identification of sATP6v0d2 knockout cell lines
[0076] The expression of ATP6v0d2 in cells was detected by immunoblotting and immunofluorescence using the ATP6v0d2 antibody (ab321809).
[0077] The immunoblotting procedure was as follows: Cell samples were washed twice with pre-cooled PBS at 4°C, RIPA (strong) cell lysis buffer was added, and protease inhibitors were supplemented. The cells were incubated on ice for 30 minutes to allow for complete cell lysis. Samples were collected in centrifuge tubes and centrifuged at 12000g for 15 minutes at 4°C. The supernatant was mixed with 6×SDS loading buffer and incubated in boiling water for 5 minutes to fully denature the proteins. SDS-PAGE electrophoresis was performed on the samples at a constant voltage of 100V for 1.5 hours. Subsequently, the proteins were transferred to a 0.45μm PVDF membrane at a constant current of 250mA. Blocking was performed with rapid blocking buffer at room temperature for 15 minutes. The membrane was then incubated with ATP6v0d2 antibody and GAPDH internal control antibody (diluted 1:2000) as primary antibodies at 4°C for 12 hours. HRP-labeled goat anti-rabbit IgG was then used as a secondary antibody and incubated at room temperature for 2 hours. After washing three times with TBST, data were acquired using ECL chemiluminescence reagent in a chemiluminescence analyzer.
[0078] The immunofluorescence procedure was as follows: Cells were seeded onto a spreader slide, which was pre-treated with 100 ng / mL Fibronectin in an incubator for 3 hours to promote cell adhesion and spread. After 24 hours, the culture medium was discarded, and the cells were rinsed three times with pre-warmed PBS, followed by fixation with 4% paraformaldehyde (PFA) for 30 minutes. The PFA was removed, and the cells were washed three times with PBS, then permeated with 0.1% Triton X-100 for 5 minutes. The Triton was removed, and the cells were washed three times with PBS, then blocked with 5% skim milk powder for 20 minutes. A light-protected humidified chamber was used, lined with paper towels and a paraffin membrane. 30 μL of ATP6v0d2 antibody was added to the paraffin membrane, and the spreader slide was carefully placed on the primary antibody (cells facing down) using forceps, and incubated for 1 hour. The spreader slide was then placed back into the well plate (cells facing up) using forceps, and the cells were washed three times with PBS. Add 30 μL of Alexa 488 fluorescent secondary antibody to a paraffin membrane. Carefully place the slide onto the primary antibody using tweezers (cells side down) and incubate for 1 hour. Then, place the slide back onto the well plate using tweezers (cells side up) and wash three times with PBS. Clean the slide, dip a pipette tip into a small amount of Hoechst-containing mounting medium onto the slide, and carefully place the slide onto the mounting medium using tweezers (cells side down). Dry overnight in the dark. If the mounting medium is not dry after a long time, you can apply a layer of nail polish around the slide and wait for it to dry completely.
[0079] The results are as follows Figure 4 and Figure 5 As shown, by targeting the sATP6v0d2 gene with sgRNA1, sgRNA2, or sgRNA3 and combining it with CRISPR / Cas9 gene editing technology, the expression of sATP6v0d2 in porcine kidney PK15 cells was successfully knocked out, and three monoclonal cell lines were obtained and named sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3, respectively.
[0080] Example 5: Viability assay of sATP6v0d2 gene knockout cell lines
[0081] Wild-type PK15 cells and sATP6v0d2 gene knockout cells (sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3) were digested, counted, and seeded at 100 μL (2000 cells per well) into 96-well plates. After 12 hours of incubation, 10 μL of CCK-8 solution was added to each well, and the plates were incubated for another 2 hours. The absorbance at 450 nm was then measured using a microplate reader. Results are as follows: Figure 6As shown, the cell viability of the sATP6v0d2 gene knockout PK15 cell line was comparable to that of wild-type cells, with no significant difference, indicating that the knockout of the sATP6v0d2 gene does not affect the normal proliferation of host cells.
[0082] Example 6: Morphological Detection of sATP6v0d2 Gene Knockout Cells
[0083] Wild-type PK15 cells and sATP6v0d2 gene knockout cells (sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3) were digested, counted, and seeded into 12-well plates for 24 hours. The morphology of these cells was then examined using a phase-contrast microscope (20×). Results are as follows: Figure 7 As shown, there was no significant difference in cell morphology between the sATP6v0d2 gene knockout PK15 cell line and wild-type cells, indicating that the knockout of the sATP6v0d2 gene does not affect the normal growth of the host cells.
[0084] Example 7: Detection of migration ability of sATP6v0d2 gene knockout cells
[0085] Five thousand five cells were seeded into six-well plates and cultured until 100% cell confluence was achieved. A scratch assay was then performed. Using a 200 μL pipette tip, scratches were made vertically into the wells. The cells were washed with PBS to remove floating cells, and 2 mL of serum-free culture medium was added. Microscopic observation and photography were conducted at 0, 12, 24, and 36 hours post-scraping, and the migration rates of the two groups were calculated. Results are shown below. Figure 8 As shown, there was no significant difference in cell migration speed between the sATP6v0d2 gene knockout PK15 cell line and wild-type cells, indicating that the knockout of the sATP6v0d2 gene does not affect the normal growth of host cells.
[0086] Example 8: Detection of acidic lysosomal environment in sATP6v0d2 gene knockout cells
[0087] ATP6v0d2 is an important component of V-ATPase, and its loss of function will disrupt the acidic environment of lysosomes. In order to verify whether sATP6v0d2 knockout in PK15 cells affects the acidic environment of lysosomes, this invention uses the LysoTracker Red probe to label the acidic internal environment of lysosomes.
[0088] 1×10⁵ cells were seeded onto a slide and cultured for 12 hours. The culture medium was discarded and replaced with medium containing 100 nM LysoTracker Red and Hoechst nuclear dye. The cells were incubated for 1 hour, then the medium was discarded again. The cells were washed twice with pre-warmed PBS buffer, and finally, phenol red-free cell culture medium was added. Data were acquired under a laser confocal microscope, and the fluorescence signal intensity was statistically analyzed. Results are as follows: Figure 9 As shown, compared with wild-type cells, the LysoTracker Red fluorescence intensity in the sATP6v0d2 gene knockout PK15 cell line was significantly reduced, indicating that the knockout of the sATP6v0d2 gene disrupted the acidic lysosomal internal environment of the cell.
[0089] Example 9: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus replication
[0090] 1×10⁵ wild-type and sATP6v0d2 knockout cells were seeded into 12-well plates. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated with Japanese encephalitis virus cell culture medium containing MOI of 0.1 for 2 hours to allow the virus to invade the host cells. After that, the virus solution was discarded, and the cells were washed twice with pre-warmed PBS to ensure that no invading virus was washed away. Finally, the cells were cultured again with culture medium containing 2% fetal bovine serum. After 24 hours, the culture medium supernatant and cells were collected separately for the detection of Japanese encephalitis virus copy number.
[0091] Total RNA was extracted from culture supernatant and cell samples using Takara RNAiso Plus reagent, and reverse transcribed into cDNA using Novizan HiScript IV 1st Strand cDNA Synthesis Kit. Primers were then designed based on the mRNA sequence of the Japanese encephalitis virus (JE) E protein encoding gene. The upstream primer was 5'-ACTGACATCTCGACGGTGGC-3', and the downstream primer was 5'-CTCCCAATCGCTTTACTGGT-3'. Quantitative real-time PCR was performed to detect JE virus copy number according to the Novizan ChamQ SYBR qPCR Master Mix instructions, with each assay repeated in triplicate. The reaction mixture consisted of: 2×ChamQSYBR qPCR Master Mix, 10 μL; 10 μM upstream primer, 0.4 μL; 10 μM downstream primer, 0.4 μL; 50×ROXReference Dye, 0.4 μL; cDNA, 2 μL; and ultrapure water to a final volume of 20 μL. After preparing the system, mix thoroughly and place it in an ABI quantitative fluorescence instrument for amplification. The reaction conditions were 95℃ for 10 seconds; 60℃ for 30 seconds; 40 cycles. The viral copy number in each sample was obtained by plotting the Ct value against a standard curve. The results are as follows: Figure 10 As shown, 24 hours after viral infection, the copy number of Japanese encephalitis virus in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.
[0092] Example 10: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus E protein
[0093] 1×10⁵ wild-type and sATP6v0d2 knockout cells were seeded into 12-well plates. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated with Japanese encephalitis virus cell culture medium containing MOI of 0.1 for 2 hours to allow the virus to invade the host cells. After that, the virus solution was discarded, and the cells were washed twice with pre-warmed PBS to ensure that no invading virus was washed away. Finally, the cells were cultured in medium containing 2% fetal bovine serum for 24 hours. The cells were then collected for the detection of Japanese encephalitis virus E protein expression level.
[0094] Cell samples were collected and processed using the immunoblotting method described in Example 4, followed by SDS-PAGE gel electrophoresis. The level of Japanese encephalitis virus E protein was detected using Abcam's Japanese encephalitis virus E protein antibody (ab41671) and GAPDH internal control antibody as primary antibodies, and HRP-labeled goat anti-mouse IgG as secondary antibody. The grayscale values of the protein bands were analyzed using the ImageJ-GelAnalyzer software plugin. The results are as follows: Figure 11As shown, 24 hours after viral infection, the level of Japanese encephalitis virus E protein in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.
[0095] Example 11: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus infection rate
[0096] One × 10⁵ wild-type and sATP6v0d2 knockout cells were seeded onto a climbing slide. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated for 2 hours with Japanese encephalitis virus cell culture medium containing MOI of 0.1 to allow the virus to invade the host cells. After that, the virus solution was discarded, and the cells were washed twice with pre-warmed PBS to ensure that no invading virus was washed away. Finally, the cells were cultured again with culture medium containing 2% fetal bovine serum. After 24 hours, the cells were fixed for the detection of Japanese encephalitis virus E protein distribution levels.
[0097] Cell samples were collected and processed using the immunofluorescence method described in Example 4. The distribution of Japanese encephalitis virus E protein was detected using Abcam's Japanese encephalitis virus E protein antibody (ab41671) as the primary antibody and Alexa 488-labeled goat anti-mouse IgG as the secondary antibody. The fluorescence intensity of the Alexa 488 signal was analyzed using ImageJ software. The results are as follows: Figure 12 As shown, 24 hours after viral infection, the infection rate of Japanese encephalitis virus in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.
[0098] The results in summary demonstrate that the method of this invention successfully constructed the sATP6v0d2 gene knockout PK15 cell line, which effectively resists infection by Japanese encephalitis virus. This invention, through optimization of sgRNA, constructed three target cell lines: sATP6v0d2-KO1, sATP6v0d2-KO2, and sATP6v0d2-KO3. The method of this invention is simple and efficient, and the constructed sATP6v0d2 knockout cell lines can provide tools and materials for research on ATP6v0d2 gene function and Japanese encephalitis virus infection, while also having significant implications for disease control in the swine industry.
[0099] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for constructing a sATP6v0d2 gene knockout PK15 cell line, characterized in that, Includes the following steps: Step 1: Design sgRNA sequences targeting the sATP6v0d2 gene: sgRNA1, sgRNA2, or sgRNA3; sgRNA1 and sgRNA2 are located in the first exon region of the sATP6v0d2 gene, and sgRNA3 is located in the second exon region of the sATP6v0d2 gene; the targeting sequence of sgRNA1 is: CGCTGAGCTGTACTTCAATG; the targeting sequence of sgRNA2 is: CAATGTGGACCATGGCTACC; the targeting sequence of sgRNA3 is: CAAGAAGTTGCCGTAATCAG; Step 2: Design primers for sgRNA. Add CACCG to the 5' end of the sgRNA-F primer, add AAAC to the 5' end of the sgRNA-R primer, and add C to the 3' end of the sgRNA-R primer to synthesize sgRNA primers. Step 3: Anneal the sgRNA primers from Step 2 to obtain double-stranded sgRNA fragments. Use BsmBI restriction endonuclease to digest the LentiCRISPRv2 vector to obtain a linearized LentiCRISPRv2 vector with sticky ends. Step 4: The double-stranded sgRNA from Step 3 is recombined into the linearized LentiCRISPRv2 vector described above via enzyme ligation. Step 5: Transfect the recombinant plasmid from Step 4 into PK15 cells; Step 6: Use puromycin to screen successfully transfected cells; Step 7: Use the extreme dilution method to screen and obtain PK15 monoclonal cell lines with sATP6v0d2 knockout.
2. The method for constructing the sATP6v0d2 gene knockout PK15 cell line according to claim 1, characterized in that: The sgRNA1 is a double-stranded fragment formed by annealing primers sgRNA1-F and sgRNA1-R: sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3'; sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3'.
3. The method for constructing the sATP6v0d2 gene knockout PK15 cell line according to claim 1, characterized in that: The sgRNA2 is a double-stranded fragment formed by annealing primers sgRNA2-F and sgRNA2-R: sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3'; sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3'.
4. The method for constructing the sATP6v0d2 gene knockout PK15 cell line according to claim 1, characterized in that: The sgRNA3 is a double-stranded fragment formed by annealing sgRNA3-F and sgRNA3-R primers: sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG- 3'; sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3'.
Citation Information
Patent Citations
Construction method of MAP3K8 gene knockout PK-15 cell line and application thereof
CN110862968A