Digital PCR Kit for Detecting Bloodstream Infection Pathogens

Abstract

The present invention provides a digital PCR kit for detecting blood stream infection pathogens. Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Stenotrophomonas maltophilia are simultaneously detected in one tube of the kit. The buffer system of the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, BSA, SSB, Taq DNA polymerase, UNG enzyme, primers, and probes. The volume concentration of glycerol in the buffer system is 4% - 8%, the mass-volume concentration of BSA in the buffer system is 0.2% - 0.8%, and the concentration of SSB in the buffer system is 2 - 4 ng / µL. In the buffer system of the present invention, the droplet stability is improved, the amplification efficiency is improved, low-concentration and high-concentration targets can be stably detected, and when a large volume of nucleic acid template is added, the droplets are stable and the amplification efficiency is not affected, meeting the clinical use effect.

Description

Technical Field

[0001] The present invention relates to the field of digital PCR detection, and particularly to a digital PCR kit for detecting pathogens in bloodstream infections. Background Art

[0002] Bloodstream infection (BSI) is a systemic inflammatory response syndrome (SIRS) caused by various pathogenic microorganisms and their toxins invading the blood circulation, and the pathogenic microorganisms exist transiently, intermittently or continuously in the circulating blood. As a severe systemic infectious disease, it is prone to induce sepsis and multiple organ dysfunction syndrome, with a high fatality rate, and has become one of the major public health burdens globally. The prognosis of patients with bloodstream infections is closely related to the timeliness and accuracy of diagnosis and the rational use of initial antimicrobial drugs.

[0003] Currently, the detection methods for pathogens in clinical practice are roughly divided into blood culture, sequencing technology, antigen detection methods, and molecular detection methods. Blood culture (BC) is the gold standard for pathogen detection and is inexpensive. However, blood culture also has obvious drawbacks such as complex operation, long culture cycle, high requirements for experimental conditions, difficult cultivation of some pathogens, and great influence by antibiotic treatment. Sequencing technology has the characteristics of comprehensive and broad-spectrum coverage, but it is expensive, requires more advanced supporting instruments, reagents, and professional operators, and the experimental operation is complex and the detection time is relatively long. Therefore, it is still difficult to popularize widely. The advantage of antigen detection technology is fast, simple to operate, and inexpensive, but it has disadvantages such as relatively subjective result reading, great influence by antibiotic treatment, and latex agglutination test relying on antigen expression.

[0004] Molecular diagnostic technology is based on primer amplification of target pathogens, and its detection does not rely on live bacteria, so it has high sensitivity and specificity. Although qPCR also has the above detection advantages, qPCR has weak interference ability and must rely on the detection of standards for quantification; however, on the premise of having the above molecular diagnostic advantages, ddPCR can well make up for the shortcomings of qPCR. ddPCR can achieve true absolute quantification, has strong anti-interference ability, can tolerate the influence of PCR inhibitors, is suitable for the detection of various complex samples, and is much cheaper than sequencing. The key is that it can give the detection result within 3 - 4 hours, so it can well meet the current clinical needs. Currently, considering several aspects such as detection speed, detection cost, detection operation steps, and large-scale popularization, ddPCR is the optimal detection method for pathogen detection at present. Summary of the Invention

[0005] To solve the above problems, the present invention provides a digital PCR kit for detecting blood-stream infection pathogens. The kit can simultaneously detect Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Stenotrophomonas maltophilia in one tube. The buffer system of the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, and primers and probes. The volume concentration of glycerol in the buffer system is 4%-8%, the mass-volume concentration of BSA in the buffer system is 0.2%-0.8%, and the concentration of SSB in the buffer system is 2-4 ng / µL.

[0006] In one embodiment, the mass-volume concentration of BSA in the buffer system is 0.2%-0.4%.

[0007] In one embodiment, the concentration of SSB in the buffer system is 2-3 ng / µL.

[0008] In one embodiment, the buffer system of the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, and primers and probes. The volume concentration of glycerol in the buffer system is 4%, the mass-volume concentration of BSA is 0.4%, the concentration of SSB is 3 ng / µL, the magnesium ion concentration is 6 mM, and the Taq enzyme concentration is 3 U.

[0009] In one embodiment, the kit contains the following primers and probes:

[0010] 。

[0011] In one embodiment, the final concentrations of the primers and probes for Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, Stenotrophomonas maltophilia, and Klebsiella pneumoniae in the buffer system of the kit are 500 nM and 250 nM, respectively.

[0012] In the present invention, three sets of primers and probes were designed and screened for Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, Stenotrophomonas maltophilia, and Klebsiella oxytoca respectively. On this basis, the preferred primers and probes for each pathogen were screened, and then the co-tube test was carried out to obtain the best primer and probe combination after co-tubing. After combination, in the detection of high-sensitivity bloodstream infection pathogens, since a large volume of plasma sample is required for nucleic acid extraction and the nucleic acid template loading amount in the system should be as large as possible, the stability of droplets is a key issue. During the extraction process of a large volume of plasma sample (1-5 ml, and in some cases more plasma), and when a large volume of nucleic acid template is added, the formation and stability of droplets may be interfered by the residual plasma components in the extracted nucleic acid, such as high-viscosity substances, proteins, or other particulate matters in the plasma, which easily lead to droplet rupture or fusion, thus affecting the accuracy and repeatability of the detection results.

[0013] When detecting nucleic acids extracted from a large volume of plasma, the number of droplets is absent or small, and the co-tube copy number of each target is lower than the expected target copy number. When detecting with a large volume of nucleic acid, the droplet stability decreases and the amplification efficiency is somewhat reduced. To improve the droplet stability and the amplification efficiency after co-tubing, the buffer system of the present invention was optimized. In the buffer system of the present invention, the volume concentration of glycerol is 4%-8%, and the mass-volume concentration of BSA is 0.2%-0.8%. The quantitative results are in line with expectations at high concentrations of the template, indicating an increase in the amplification efficiency. However, at low concentrations of the template, the quantification is still on the low side. When the concentration of SSB is 1 ng / μl, the quantification of low-copy templates is on the low side, and the quantification of high-copy templates is basically in line with expectations. When the concentration of SSB is increased to 2 ng / μl - 4 ng / μl, the quantitative results at both low-concentration and high-concentration templates increase significantly, and are also more than 50% higher than the expected copy number, indicating that SSB stabilizes single-stranded templates, disperses them into different droplets, and improves the detection efficiency. When the SSB is increased to 5 ng / μl, due to the excessive amount of SSB, it affects the competitive binding of primers and templates, and the quantitative copy number decreases instead. Therefore, the more appropriate concentration of SSB is 2 ng / μl - 4 ng / μl, especially 2 ng / μl - 3 ng / μl is preferred. In the buffer system of the present invention, through the cooperation of glycerol, BSA, and SSB, the droplet stability of the buffer system is improved, the amplification efficiency is increased, the nucleic acids extracted from plasma can be stably detected, and when a large volume of nucleic acid template is added, the droplets are stable and the amplification efficiency is not affected, and low-concentration and high-concentration targets can be stably detected, meeting the clinical use effect. Detailed implementation mode

[0014] To enable those skilled in the art to better understand the technical solutions in this application, the following will further illustrate the present invention in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all of them. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application.

[0015] Example 1 Primer and Probe Screening

[0016] Three pairs of primer-probes were designed respectively for the specific genes of the target bacteria to be detected (Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Stenotrophomonas maltophilia), and the primer-probes were screened using the basic system. Table 1 below shows the candidate primer-probe sequences.

[0017] Table 1. Primer-Probe Information

[0018]

[0019] 1. Preparation of Basic PCR Reaction System

[0020] Prepare the basic PCR reaction system according to the following table

[0021]

[0022] Among them, the final concentration of each primer is 500 nM, and the final concentration of each probe is 250 nM. The template uses nucleic acids extracted from the cultures of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Stenotrophomonas maltophilia (using the XinYi free DNA nucleic acid extraction kit to extract nucleic acids from 1 ml of bacterial culture), the nucleic acids are quantified and diluted, and then about 3000 copies / sample are added to the system. In addition, two kinds of mixed nucleic acids are used as cross-reaction templates, including 1) Cross-reaction template 1 (including nucleic acids of the other 4 pathogens, with a concentration of 2000 copies / µL for each pathogen) to evaluate the cross-reaction specificity between primer-probes; 2) Cross-reaction template 2 (mixed with nucleic acids of multiple other pathogens, including HIV, EBV, VZV, BKV, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Haemophilus influenzae, Candida albicans, with a concentration of 2000 copies / µL for each pathogen) to evaluate the specificity of primer-probes to other pathogens.

[0023] 2. Digital PCR Workflow

[0024] 2.1. Microdroplet Preparation: Using a droplet generation chip (manufactured by Xinyi Manufacturing Technology (Beijing) Co., Ltd.) and a sample preparation instrument (manufactured by Xinyi Manufacturing Technology (Beijing) Co., Ltd.), add 30 µL of the PCR reaction system into the sample wells of the droplet generation chip, and add 180 µL of droplet generation oil into the oil wells. Place the chip and the 8-strip tube into the preparation instrument, cover it with a rubber pad, and perform microdroplet preparation.

[0025] 2.2. PCR Amplification: Place the 8-strip tube containing microdroplets on the PCR instrument for amplification. The amplification program is set as shown in the following table:

[0026]

[0027] 2.3. Microdroplet Detection: After PCR, place the 8-strip tube and the droplet detection chip (manufactured by Xinyi Manufacturing Technology (Beijing) Co., Ltd.) into the fixture. Add 430 µL and 500 µL of detection oil into the oil wells respectively, cover it with a rubber pad, and place the chip into the chip analyzer (manufactured by Xinyi Manufacturing Technology (Beijing) Co., Ltd.) for droplet detection.

[0028] 2.4. Data Analysis: Each of the tens of thousands of microdroplets prepared by the droplet generation chip and the sample preparation instrument is an independent PCR reactor. Most microdroplets do not contain the target gene to be detected or contain at least one target gene to be detected. After PCR amplification, the fluorescence signals of each channel of each microdroplet are detected by the chip analyzer, and the peak height of the microdroplet signal is recorded. Droplets containing the target gene to be detected will be detected with corresponding fluorescence signals. The fluorescence intensity in the microdroplets is digitized through the fluorescence classification threshold. Microdroplets with stronger fluorescence are judged as "1" (positive), and microdroplets with weaker fluorescence are judged as "0" (negative). Count the number of "1" and "0", and through Poisson distribution model correction, the total copy number of the target genes with each fluorescence label in the input template can be calculated.

[0029] 3. Screening Results

[0030] The working conditions of the primer-probe are investigated according to whether amplification occurs, the ratio of the positive signal to the background signal (signal-to-noise ratio), and the copy number. The screening results for each target are shown in Table 2 below. At least 1-2 sets of primer-probe combinations that can specifically amplify and have copy numbers consistent with expectations are screened out for each target.

[0031] Table 2 Screening Results for Each Target

[0032]

[0033] Example 2 Testing with Different Targets in a Combined Tube

[0034] The primer-probe combinations for single amplification selected as above are tested in a combined tube according to the following table. The final concentration of the primer is 500 nM, and the final concentration of the probe is 250 nM.

[0035]

[0036] The specific PCR reaction system preparation and the digital PCR workflow are the same as in Example 1. The nucleic acid mixtures extracted from Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Stenotrophomonas maltophilia are used as templates to determine the combined tube detection situation. In addition, the specificity after combined tube is determined using the cross-reaction template 2 in Example 1. The screening results are shown in Table 3. The combined tube test results show that Klebsiella pneumoniae did not amplify normally in Combinations 1 and 3, there was non-specific amplification in Combination 2, and all amplified normally in Combination 4, and the amplification signals were basically consistent with the expected results. Therefore, Combination 4 was used as the subsequent combined tube combination, and the primer-probe combinations screened after the combined tube combination are as shown in Table 4 below.

[0037] Table 3. Detection Results of Combined Tube Screening

[0038]

[0039] Table 4. Primer-Probe Combinations Screened after Combined Tube Combination

[0040]

[0041] Example 3. Screening of Different Detection Systems

[0042] In the above embodiments, the nucleic acid used for primer-probe screening and primer-probe combination screening is the nucleic acid extracted from bacterial cultures. The amount of template added to the system is 1 μl. However, in the detection of pathogens in bloodstream infections with high sensitivity, a large volume of plasma sample is required for nucleic acid extraction, and the amount of nucleic acid template added to the system should be as large as possible. Therefore, the stability of droplets is a key issue. During the extraction of a large volume of plasma sample (1 - 5 ml, and in some cases more plasma), and when a large volume of nucleic acid template is added, the formation and stability of droplets may be interfered by the residual plasma components in the extracted nucleic acid, such as high-viscosity substances, proteins, or other particulate matters in plasma, which can easily cause droplet rupture or fusion, thus affecting the accuracy and repeatability of the detection results. According to reports, the concentration of pathogens in plasma is generally 10 - 10,000 pathogen copies / ml plasma. To achieve a sensitivity of 10 pathogen copies / ml, in this embodiment, 1 ml of simulated plasma sample (a mixture of 5 pathogen nucleic acids, including a low concentration of 20 copies / ml plasma and medium-high concentrations of 3000 copies / ml plasma, with the bacterial solution incorporated into the plasma matrix) is used for extraction, and the nucleic acid elution volume is 40 μL (a smaller elution volume is used to concentrate the nucleic acid concentration as much as possible). Then, as large a volume of nucleic acid as possible is added to the system to ensure sensitivity. In this embodiment, 20 μL of nucleic acid template is added. Based on the detection system in Example 1 as the basic system, the detection system is optimized to screen out a detection system that ensures high droplet stability and amplification efficiency. To increase the strength of the droplet membrane, a highly viscous liquid needs to be coated on the surface of the droplet so that the droplet is not easily broken and fused under pressure fluctuations. Measures such as increasing the amount of glycerol or using BSA (bovine serum albumin) can prevent droplet coalescence and aggregation, ensuring the dispersibility of droplets. Among them, glycerol is a highly viscous liquid, and BSA can reduce the non-specific adsorption of nucleic acids or reagents, improving sensitivity. BSA further enhances droplet stability through its synergistic effect with the highly viscous liquid.

[0043] In addition, since the present invention detects the free nucleic acids of pathogens in blood, the content of pathogen nucleic acids is relatively low, as described above. Therefore, to further improve the detection sensitivity, single-stranded binding protein (SSB) is additionally added to the system. SSB binds to single-stranded DNA to prevent it from reannealing or forming secondary structures. For cell-free DNA (cfDNA) in plasma, its concentration is low and the fragments are short. SSB can prevent the self-renaturation of these short fragments after denaturation, which would otherwise reduce the primer binding efficiency.

[0044] Furthermore, during droplet PCR detection, since SSB can stabilize the single-stranded structure of the template, single-stranded nucleic acid templates are distributed into different droplets, further increasing the detection copy number. Compared with the conventional situation where double-stranded templates enter the same droplet, theoretically, the copy number can be doubled. SSB can also reduce the occurrence of non-specific amplification, especially in the case of complex backgrounds (such as other DNA or proteins present in plasma). In summary, SSB can improve the amplification efficiency by stabilizing single-stranded templates and polymerase, especially in the detection of cell-free DNA in plasma at low template concentrations. However, too high a concentration of SSB may inhibit primer annealing, thereby reducing the PCR efficiency. Therefore, the optimal concentration of SSB needs to be optimized for a specific reaction system.

[0045] The volume of the microdroplets generated using the digital PCR platform and supporting consumables (sample preparation instrument, chip analyzer, supporting microdroplet generation chip and generation oil, microdroplet detection chip and detection oil) of Singleron Biotechnologies (Beijing) Co., Ltd. is approximately 0.5 nL. The theoretical number of microdroplets generated in a 30 μL reaction system is approximately 60,000. When analyzing and detecting the microdroplets, the more droplets detected (but not exceeding the theoretically generated number of droplets), the higher the detection sensitivity and stability. Especially when detecting low-copy targets (less than 50 copies in the system), if droplets containing the target are lost, the quantitative result will be on the low side. When the target copy number is high (higher than 50 copies), the detection result is corrected using the Poisson distribution formula, and the number of detected droplets has little impact on the quantitative result. However, generally, it is required to detect at least more than 50% of the generated droplets for the detection result to be stable and reliable, that is, when the number of detected droplets reaches more than 30,000, the detection result meets the standard.

[0046] (1) Optimize the glycerol concentration. The system formulations are shown in Table 5, with a total of 5 systems. The final glycerol concentrations are 1%, 2%, 4%, 8%, and 10% respectively. The detection results are shown in Table 6. Among them, when the glycerol concentration is 1%, droplet fusion occurs and no droplets are detected; at a concentration of 2% and above, droplets can be detected, and the number of detected droplets increases with the increase in glycerol concentration. When the glycerol concentration reaches 4% and above, the number of droplets is more than 30,000. However, when the glycerol concentration is 10%, the number of droplets reaches 70,000, exceeding the theoretical number of droplets. Therefore, the glycerol concentration of 4% - 8% meets the droplet number requirement, but the detected copy number is low at low copies, indicating that the amplification efficiency is affected when increasing the template input volume (20 μL), and further optimization is required.

[0047] Table 5. Formulation table of detection systems with different glycerol concentrations

[0048]

[0049] Table 6. Detection results with different glycerol concentrations

[0050]

[0051] (2)Optimize the BSA concentration. The system preparation is shown in Table 7. There are a total of 5 systems. Under the condition of fixing the glycerol concentration at 4%, systems with different BSA concentrations are prepared. The final BSA concentrations are 0.1%, 0.2%, 0.4%, 0.8%, and 1% respectively. The detection results are shown in Table 8. The number of droplets is normal in different systems, between 40,000 and 60,000. Among them, when the BSA concentration is 0.1%, the quantification of both low-copy templates and high-copy templates is low, which may be due to insufficient amplification efficiency. When the BSA concentration is increased to 0.2% - 0.8%, the quantification results meet the expectations for high-concentration templates, indicating that the amplification efficiency has increased. However, when the template concentration is low, the quantification is still low, indicating that for the detection of plasma pathogen-free DNA, the detection efficiency needs to be further improved when the template concentration is low. When the BSA is increased to 1%, since the amount of BSA is too high, it affects the amplification conditions of taq enzyme, and the quantified copy number decreases instead. Therefore, the more appropriate BSA concentration is 0.2% - 0.8%, especially 0.2% - 0.4% is more preferred.

[0052] Table 7. Preparation Table of Detection Systems with Different BSA Concentrations

[0053]

[0054] Table 8. Detection Results with Different BSA Concentrations

[0055]

[0056] (3)Optimize the SSB concentration. The system preparation is shown in Table 9. There are a total of 5 systems. Under the conditions of fixing the glycerol concentration at 4% and the BSA concentration at 0.4%, systems with different SSB concentrations are prepared. The final SSB concentrations are 1 ng / μl, 2 ng / μl, 3 ng / μl, 4 ng / μl, and 5 ng / μl respectively. The detection results are shown in Table 10. The number of droplets is normal in different systems, between 40,000 and 60,000. Among them, when the SSB concentration is 1 ng / μl, the quantification of low-copy templates is low, and the quantification of high-copy templates basically meets the expectations, indicating that the SSB concentration is still insufficient. When the SSB concentration is increased to 2 ng / μl - 4 ng / μl, the quantification results of both low-concentration templates and high-concentration templates increase significantly, and are more than 50% higher than the expected copy number, indicating that SSB stabilizes single-stranded templates and is dispersed into different droplets, improving the detection efficiency. When the SSB is increased to 5 ng / μl, since the amount of SSB is on the high side, it affects the competitive binding of primers and templates, and the quantified copy number decreases instead. Therefore, the more appropriate SSB concentration is 2 ng / μl - 4 ng / μl, especially 2 ng / μl - 3 ng / μl is more preferred.

[0057] Table 9. Preparation Table of Detection Systems with Different SSB Concentrations

[0058]

[0059] Table 10. Detection results of different SSB concentrations

[0060]

[0061] (4)Optimize other components in the detection system

[0062] Fix the glycerol concentration in the system at 4%, the BSA concentration at 0.4%, and the SSB at 3 ng / μl, and optimize the concentrations of other components in the multiplex system. The Mg 2+ concentrations include 4 mM, 6 mM, and 8 mM; the Taq enzyme concentrations include 2 U, 3 U, and 4 U. The system preparation table can be seen in System 13 of Table 9. Prepare according to System 13 by changing the Mg2+ and Taq enzyme concentrations. There are a total of 8 combinations, as shown in Table 11-1 and Table 11-2. When screening each optimized combination, evaluate and screen the multiplex system combinations from aspects such as amplification efficiency, copy number, and total number of droplets (droplet stability).

[0063] Table 11-1. Preparation table of detection systems with different amounts of Taq enzyme and MgCl2 concentrations

[0064]

[0065] Table 11-2. Preparation table of detection systems with different amounts of Taq enzyme and MgCl2 concentrations

[0066]

[0067] Use System 13 as a reference to prepare Systems 16 - 23, and detect the nucleic acid mixtures extracted from the simulated plasma of 5 pathogens respectively. Add 20 μL of the template nucleic acid amount, and use a high-copy template (about 2000 copies / system). The specific PCR reaction system preparation and digital PCR workflow are the same as above, and the screening results are as follows.

[0068] (1)Number of droplets

[0069] Statistical results of the total number of droplets to evaluate whether the system has an impact on droplet stability.

[0070]

[0071] From the above results, it can be seen that different systems have little impact on droplet stability. The total number of droplets in the 8 systems is greater than 30000, and the results are all credible. Further analyze the results later.

[0072] (2)Amplification efficiency evaluation

[0073] In this experimental group, the nucleic acid template was high-concentration nucleic acid (20 µL of the template was added), and the copy number quantification results were statistically analyzed to evaluate the amplification efficiency of the system. The results are shown in the following table:

[0074]

[0075] As can be seen from the above results, when the system was System 19 (glycerol concentration was 4%, BSA concentration was 0.4%, SSB was 3 ng / µL, Mg 2+ concentration was 6 mM, and Taq enzyme concentration was 3 U), the copy numbers of each target were optimal. And according to the detection results, there was no significant difference in the fluorescence signal differences among the systems. Considering the above results, the final system was determined to be System 19, with a glycerol concentration of 4%, a BSA concentration of 0.4%, an SSB concentration of 3 ng / µL, Mg 2+ concentration of 6 mM, and Taq enzyme concentration of 3 U.

[0076] It should be understood that the disclosed invention is not limited to the specific methods, protocols, and materials described, as these can vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the invention, which is limited only by the appended claims.

[0077] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. These equivalents are also encompassed by the appended claims.

Claims

1. A digital PCR kit for detecting bloodstream infection pathogens, characterized in that: The kit can simultaneously detect Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli and Stenotrophomonas maltophilia in one tube. The buffer system of the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, primers and probes. The volume concentration of glycerol in the buffer system is 4%-8%, the mass volume concentration of BSA in the buffer system is 0.2%-0.8%, and the concentration of SSB in the buffer system is 2-4 ng / µL. The kit contains the following primers and probes, and the primers and probes for Klebsiella pneumoniae are as follows: the upstream primer is SEQ ID No.1: AAGGTCAACAGAACATTCCAGGCAG, the downstream primer is SEQ ID No.2: ACTTTCCTCTGGGCCCTGCCAC, and the probe is SEQ ID No.3: ACTTTCCTCTGGGCCCTGCCAC; The primers and probe used for Acinetobacter baumannii were as follows: the upstream primer was SEQ ID No. 4: GAAGTGATTCTGAAGATCCAAC, the downstream primer was SEQ ID No. 5: AGTATACAGTGCAACTTCAACT, and the probe was SEQ ID No. 6: TTACATAAAGAACCTGCGACA; The primers and probe used for Pseudomonas aeruginosa were as follows: the upstream primer was SEQ ID No.7: CACAACACTTATGTGTACAACTTC, the downstream primer was SEQ ID No.8: GAGTAATGTGAAGATCTTAAT, and the probe was SEQ ID No.9: TAGTACATTAACGCAGCGATTG; The primers and probe used for E. coli were as follows: the upstream primer was SEQ ID No. 10: GTCTCCAAGGCCAACTTCTCCAT, the downstream primer was SEQ ID No. 11: CGGTCCCTTGATGCCTGTCCTTG, and the probe was SEQ ID No. 12: CAGGAACCTACAGATGTTATGGTAGC; The primers and probe used for Stenotrophomonas maltophilia are as follows: the upstream primer is SEQ ID No. 13: GGAAATTAAAGAAGATGTCTTT, the downstream primer is SEQ ID No. 14: ATGGGTGACTTCCTTATGACTG, and the probe is SEQ ID No. 15: CAAGGAACATAATTAATGGT.

2. The digital PCR kit according to claim 1, characterized in that: The mass volume concentration of BSA in the buffer system is 0.2%-0.4%.

3. The digital PCR kit according to claim 2, characterized in that: The SSB concentration in the buffer system is 2-3 ng / µL.

4. The digital PCR kit according to claim 3, characterized in that: The buffer system of the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, primers and probes. The volume concentration of glycerol in the buffer system is 4%, the mass volume concentration of BSA is 0.4%, the concentration of SSB is 3ng / µL, the concentration of magnesium ions is 6mM, and the concentration of Taq enzyme is 3U.

5. The digital PCR kit according to claim 1, characterized in that: The final concentrations of the primers and probes of Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, Stenotrophomonas maltophilia and Klebsiella pneumoniae in the buffer system of the kit are 500 nM and 250 nM respectively.

Images