Genetically modified potato event ST2400643 and its detection method

Abstract

The present invention belongs to the technical field of plant breeding, and relates to a transgenic potato event ST2400643 and a detection method thereof. The present invention provides a nucleic acid molecule for detecting a transgenic potato event ST2400643, wherein the sequence of the nucleic acid molecule is shown in SEQ ID NO:1-2 or its complementary sequence; or the sequence of the nucleic acid molecule is shown in SEQ ID NO:3 or its complementary sequence; the nucleic acid molecule is derived from the transgenic potato event ST2400643, and the potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132. The potato plant containing the transgenic potato event ST2400643 of the present invention has the following advantages: it can tolerate imidazolinone herbicides; it does not reduce potato yield; it enhances breeding efficiency, and can use molecular markers to track transgenic insertion fragments in the breeding population and its progeny.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding and relates to a transgenic potato event ST2400643 and a detection method thereof. Background Art

[0002] Potato (Solanum tuberosum L.) is the fourth largest food crop in the world after wheat, rice and corn. Biotechnology has been applied to potatoes to improve their agronomic traits and quality. An important agronomic trait in potato production is herbicide tolerance. It has been reported that glyphosate-resistant potatoes were produced by genetic modification, but potato products with exogenous herbicide-resistant genes are still limited in market acceptance; inserting exogenous gene editing tools into the potato genome to edit endogenous potato genes, such as acetolactate synthase (ALS) genes, to produce herbicide-resistant mutations in potatoes has broader application prospects.

[0003] The expression and function of foreign genes may be affected by the location of their insertion into potato chromosomes, which may be due to the proximity of chromatin structure or transcriptional regulatory components to the integration site. For this reason, it is usually necessary to screen a large number of transgenic potato events before it is possible to identify excellent events. It has been observed in plants that there are usually variations in the level and pattern of transgenic expression between single events that are identical in other aspects but have different chromosomal insertion sites of transgenes, which may result in differences in phenotypes or traits. The current guide editing system has a low efficiency in plants, especially dicots, even if the best expression regulatory components have been used. Therefore, by analyzing multiple single plant transformation events (introduced with gene editing tools), screening for events that successfully produced mutations in the StALS1 gene and had excellent herbicide resistance may then be used to introgress the desired traits into other genetic backgrounds using plant breeding methods, thereby producing a large number of different potato varieties containing the desired traits and appropriately adapted to specific local growing conditions.

[0004] It would be beneficial to be able to detect the presence of a specific transgenic event to determine whether the offspring of a sexual hybrid or asexual reproduction contains the target gene. In addition, methods for detecting specific transgenic events will also help to comply with relevant regulations, such as the need to obtain formal approval and labeling of foods derived from recombinant crops before they are put on the market. It is possible to detect the presence of transgenics by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods usually focus on commonly used genetic components, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, the above-mentioned method cannot be used to distinguish different events, particularly those transgenic events produced with the same DNA construct. Therefore, a pair of primers that span the junction of the inserted T-DNA and the flanking DNA are often used to identify transgenic specific events by PCR, specifically a first primer contained in the flanking sequence and a second primer containing the inserted sequence. Summary of the invention

[0005] The purpose of the present invention is to provide a transgenic potato event ST2400643, as well as a nucleic acid molecule and a detection method for detecting the presence of the transgenic potato event ST2400643 in a potato plant, which can accurately and quickly identify whether a biological sample contains a specific transgenic potato event ST2400643 DNA molecule.

[0006] To achieve the above object, on the one hand, the present invention provides a nucleic acid molecule for detecting transgenic potato event ST2400643, wherein the sequence of the nucleic acid molecule comprises any one or more sequences selected from the group consisting of SEQ ID NOs: 1-3 and complementary sequences thereof; the nucleic acid molecule is derived from transgenic potato event ST2400643, and the potato plant comprising the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microorganism Culture Collection (CGMCC for short, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, zip code 100101) with the deposit number CGMCC NO.46132, and is classified and named: potato Solanum tuberosum.

[0007] If a nucleic acid molecule as described above is produced in amplification of DNA from a biological sample, the presence of transgenic potato event ST2400643 in the biological sample can be diagnosed.

[0008] Preferably, the sequence of the nucleic acid molecule is shown in SEQ ID NO: 1-2 or its complementary sequence; or the sequence of the nucleic acid molecule is shown in SEQ ID NO: 3 or its complementary sequence.

[0009] In another aspect, the present invention provides a DNA detection kit, comprising a first primer pair and a second primer pair, wherein when the first primer pair and the second primer pair are used together with DNA containing transgenic potato event ST2400643 for PCR amplification reaction, an amplicon for detecting transgenic potato event ST2400643 in a sample is generated.

[0010] The first primer pair is used to amplify the nucleic acid molecule of the sequence shown in SEQ ID NO: 1, the sequence of the forward primer is shown in SEQ ID NO: 5, and the sequence of the reverse primer is shown in SEQ ID NO: 6,

[0011] The second primer pair is used to amplify the nucleic acid molecule of the sequence shown in SEQ ID NO:2, the sequence of the forward primer is shown in SEQ ID NO:7, and the sequence of the reverse primer is shown in SEQ ID NO:8,

[0012] The potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee with the deposit number CGMCCNO.46132.

[0013] Preferably, the kit further comprises a third primer pair for amplifying the Cas9 gene or a fragment thereof, and / or a fourth primer pair for amplifying the NPTII gene or a fragment thereof, and / or a fifth primer pair for amplifying the StALS1 gene or a fragment thereof,

[0014] The sequence of the forward primer of the third primer pair is shown in SEQ ID NO:9, and the sequence of the reverse primer is shown in SEQ ID NO:10.

[0015] The sequence of the forward primer of the fourth primer pair is shown in SEQ ID NO: 12, and the sequence of the reverse primer is shown in SEQ ID NO: 13,

[0016] The sequence of the forward primer of the fifth primer pair is shown as SEQ ID NO:15, and the sequence of the reverse primer is shown as SEQ ID NO:16.

[0017] Preferably, when the kit comprises a third primer pair, the kit further comprises a third probe having a sequence as shown in SEQ ID NO: 11, which specifically binds to the amplification product of the third primer pair.

[0018] Preferably, when the kit comprises a fourth primer pair, the kit further comprises a fourth probe having a sequence as shown in SEQ ID NO: 14, which specifically binds to the amplification product of the fourth primer pair.

[0019] In another aspect, the present invention provides a method for detecting the presence of DNA of transgenic potato event ST2400643 in a sample, comprising:

[0020] (1) performing a nucleic acid amplification reaction on the sample to be tested using the kit as described above;

[0021] (2) detecting the presence of amplification products,

[0022] The amplification product includes a nucleic acid molecule of sequence SEQ ID NO: 1-2 or a complementary sequence thereof, indicating that the test sample contains the DNA of the transgenic potato event ST2400643; the potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132.

[0023] In another aspect, the present invention provides a method for protecting potato plants from damage caused by a herbicide, comprising:

[0024] (1) Planting transgenic potato plants containing transgenic potato event ST2400643;

[0025] (2) applying an effective dose of an imidazolinone herbicide, preferably imidazolinone herbicide;

[0026] The potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee with the deposit number CGMCCNO.46132.

[0027] In another aspect, the present invention provides a method for controlling weeds in a field where potato plants are planted, the method comprising applying an effective dose of an imidazolinone herbicide (preferably the imidazolinone herbicide is imipenem) to a field where transgenic potato plants are planted, wherein the transgenic potato plants comprise transgenic potato event ST2400643, and the potato plants comprising the transgenic potato event ST2400643 have been deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132.

[0028] The sequences provided by the present invention include the sequences listed in Table 1 below:

[0029] Table 1 Related sequences of the present invention

[0030]

[0031]

[0032] The potato plant containing the transgenic potato event ST2400643 of the present invention has the following advantages: it can tolerate imidazolinone herbicides; it does not reduce potato yield; it enhances breeding efficiency, and it is possible to use molecular markers to track transgenic insertion fragments in the breeding population and its progeny, which are specifically embodied in:

[0033] 1) Applying agricultural herbicides containing imazapic acid to potato plants containing transgenic potato event ST2400643 can be used for broad-spectrum weed control;

[0034] 2) Potato yield was not reduced. Specifically, potato plants containing transgenic potato event ST2400643 had high tolerance to the imazapic herbicide, protecting the plants from damage to as low as 0%; and plants containing this event showed excellent agronomic traits;

[0035] 3) The primers provided by the present invention can quickly, accurately and stably identify the presence of plant materials derived from the transgenic potato event ST2400643. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a structural diagram of the gene editing tool vector constructed in Example 1.

[0037] Figure 2 The figure shows the sequencing result of the mutation of the target site StALS1 gene edited by the transgenic potato event ST2400643 obtained in Example 2. The sequencing results show that compared with the StALS1 gene and its coding protein sequence of the wild-type potato, ST2400643 not only produces an AGC-ACT (S642T) mutation at the S642 site of the corresponding coding protein, but also produces a synonymous mutation (CA).

[0038] Figure 3 This is a schematic diagram of the composition structure and insertion site of the insertion sequence of the transgenic potato event ST2400643 obtained in Example 2.

[0039] Figure 4 It is a graph showing the detection results of agarose gel electrophoresis after PCR amplification of the samples, wherein M: DL2000 marker, and the molecular weight standards are 2kb, 1kb, 750bp, 500bp, 250bp, and 100bp from top to bottom; Lane 1 is the amplification product (550bp) using the DNA of the transgenic potato event ST2400643 as a template and 643-2-F1 / Flank-F4 as primers; Lane 2 is the amplification product using the Atlantic wild-type potato variety DNA as a control template and 643-2-F1 / Flank-F4 as primers; Lane 3 is the amplification product using ddH2O as a template and 643-2-F1 / Flank-F4 as primers.

[0040] Figure 5 It is a graph showing the results of agarose gel electrophoresis after PCR amplification of the samples, wherein M: DL2000 marker, and the molecular weight standards are 2kb, 1kb, 750bp, 500bp, 250bp, and 100bp from top to bottom; Lane 1 is the amplification product (552bp) using the DNA of the transgenic potato event ST2400643 as a template and Flank-R2 / 643-2-R as primers; Lane 2 is the amplification product using the DNA of the Atlantic wild-type potato variety as a control template and Flank-R2 / 643-2-R as primers; Lane 3 is the amplification product using ddH2O as a template and Flank-R2 / 643-2-R as primers.

[0041] Figure 6 The figure shows the results of a comparative experiment on herbicide resistance between transgenic potato plants containing transgenic potato event ST2400643 and wild-type non-transgenic potato plants (WT, Atlantic variety). The experimental plants were cultured on culture media containing 0 (control), 130 μg / L, and 260 μg / L of imipenem for 28 days and photographed. DETAILED DESCRIPTION

[0042] The present invention is further described in detail by way of examples below. Through these exemplary descriptions, the features and advantages of the present invention will become more clear and distinct.

[0043] Example 1: Construction of gene editing tool vector

[0044] Build as Figure 1 The gene editing tool vector of the structure shown above uses the commercially available pCambia2300 plasmid as its backbone. The following five fragment sequences were artificially synthesized at GenScript Biotech (Nanjing):

[0045] 1. PcUbi promoter: GenBank Accession No.: X64345.1, 1-982bp;

[0046] 2. Cas9n sequence with 3×flag tag and SV40NLS, see Xu et al., “A design optimized prime editor with expanded scope and capability in plants,” Nat Plants, 2022, 8, 45-52.;

[0047] 3. M-MLV-RT+SV40NLS sequence, Cas9n-M-MLV-RT and linker sequence, see Xu et al., “A design optimized prime editor with expanded scope and capability in plants,” Nat Plants, 2022, 8, 45-52.;

[0048] 4. NptII+t35S sequence, see pCambia2300 plasmid;

[0049] 5. Three sgRNA expression cassettes from AtU6-26p to polyT, the target sequences are as follows (the PAM sequence is in brackets):

[0050] ASST1013+esgRNA:AAGATCTCTTCCTCGTTAGC(AGG);

[0051] ASST1015+esgRNA:CTAGACAGATAGAACACTTT(TGG);

[0052] SST1012-pegRNA:CTTGGGAATGGTGGTTCAAT(GGG);

[0053] SST1014-pegRNA:GTTCTACCTATGATTCCCAG(CGG),

[0054] The above five fragments were connected to the outer backbone of pCambia2300T-DNA through NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to obtain the PS0967 gene editing tool vector.

[0055] The target of editing by the above gene editing tool vector is the S642 (AGC) site of the StALS1 gene.

[0056] Example 2: Construction of transgenic potato plants containing transgenic potato event ST2400643

[0057] (1) Pre-culture of stem segments: potato plants (wild-type Atlantic varieties) that have been subcultured in culture bottles for 21-28 days are taken, the youngest top stems of the plants are removed, and the remaining stems are cut into 0.5-2 mm long stem segments without axillary buds using a scalpel; the cut stem segments are placed on a pre-culture medium (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 6.0 g / L agar powder, pH 5.8) and cultured for 2 days at 23±2°C, with a photoperiod of 16 hours of light and 8 hours of darkness, and a light intensity of 2000 Lux.

[0058] (2) Prepare infection working solution: Use LB solid medium containing kanamycin to culture Agrobacterium LBA4404 containing the gene editing tool vector constructed in Example 1, collect it into a 50ml centrifuge tube with a disposable inoculation loop, and shake the bacterial block with a vortexer to prepare it to be evenly dispersed in the infection medium. Prepare infection medium, the ingredients are: 4.43g / L MS salts and vitamins + 20g / L sucrose + 10g / L glucose + 2.5mg / L 6-BA + 0.5mg / L 2,4-D + 6mM CaCl2 + 50μM AS pH = 5.6. The OD of the infection medium is 600 The values ​​are all around 0.3.

[0059] (3) Infection: After the pre-culture, collect the potato stem segments from the pre-culture medium into a new culture dish, add the prepared infection working solution, and infect at room temperature for 15 minutes. During this period, shake the culture dish continuously to ensure that the stem segments are in full contact with the bacterial solution (the room temperature must be below 28°C during infection). After the infection, use a disposable sterile pipette to discard the bacterial solution, and use sterile filter paper to absorb the remaining bacterial solution.

[0060] (4) Co-cultivation: Place two layers of sterile filter paper in a new culture dish, add 2 ml of co-cultivation medium (4.43 g / LMS (containing vitamins) + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH = 5.6), and ensure that there are no bubbles between the filter paper and the culture dish and between the two layers of filter paper. Place the stem segments from step (3) in it, about 30 stem segments per dish. Seal the culture dish with 3M sterile breathable tape to prevent excessive evaporation of water and excessive drying of the stem segments. Place the culture dish in an incubator and culture in the dark at 23°C for 3 days.

[0061] (5) Recovery culture: After the co-culture, the stem segments were transferred to a recovery medium containing antibiotics but no selection agent (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 2.5 mg / L

[0062] 6-BA+0.5mg / L 2,4-D+agar 6.0g / L+250mg / L cephalosporin+100mg / L timentin, pH=5.8) and recovered culture for 7 days. The culture conditions were 23±2°C, 16 hours of light, 8 hours of darkness, and a light intensity of 2000Lux.

[0063] (6) Resistance callus screening culture: The stem segments after the recovery culture was completed were transferred to the resistance callus induction medium containing 260 μg / L imazapic acid (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cephalosporin).

[0064] +100 mg / L timentin + 260 μg / L imidazopyrin, pH = 5.8), to induce resistant callus, the culture conditions are the same as step (5). Imidazopyrin can also be replaced by other imidazolinone herbicides.

[0065] (7) Regeneration of resistant buds: 14 days after resistant callus induction, the stem segments were transferred to a resistant bud induction medium containing 260 μg / L imazapic acid (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 1.0 mg / L zeatin + 0.01 mg / L NAA + 6.0 g / L agar + 250 mg / L cephalosporin).

[0066] +100 mg / L timentin +260 μg / L imipenem, pH=5.8) for induction of resistant buds, cultured for 21 days, culture conditions are the same as step (5). 2-3 subcultures are required for the occurrence of resistant buds. Generally, adventitious buds are produced in stem segments at the end of the second subculture.

[0067] (8) Rooting culture of regenerated seedlings: The regenerated shoots were cultured on rooting medium (5.688 g / L MS salts and vitamins + 30 g / L sucrose + 250 mg / L cephalosporin + 260 μg / L imazapic acid + 5 g / L carrageenan, pH = 5.8).

[0068] Thus, a transgenic potato plant comprising the transgenic potato event ST2400643 was constructed.

[0069] Example 3: Taqman detection of transgenic potato event ST2400643

[0070] About 100 mg of leaves of the transgenic potato plants constructed in Example 2 were taken, and their genomic DNA was extracted using the Polymer M5 HiPerPlant Genomic DNA Kit and dissolved in 50 μl of water as a test sample. For specific methods, refer to the product manual. The genomic DNA concentration of the above sample was measured using NanoDrop 2000 (ThermoScientific), and the concentration value was adjusted to a range of 50-100 ng / μl using ddH2O.

[0071] The copy number of the inserted gene was detected by Taqman probe fluorescence quantitative PCR method, with samples of known copy number identified as standards and samples of wild-type potato plants (Atlantic variety, non-transgenic, transformed recipient) as controls. The sequences of fluorescence quantitative PCR primers and probes were:

[0072] Primer and probe sequences used to detect Cas9 gene:

[0073] Primer Cas9-F: ATCTGCTACCTCCAGGAGAT, as shown in SEQ ID NO: 9 in the sequence listing;

[0074] Primer Cas9-R: TACTTCTCGTGGTAGGCGAC, as shown in SEQ ID NO: 10 in the sequence listing;

[0075] Probe Cas9-Probe: ACTCCTCGAGGCGGTGGAAGAAG, as shown in SEQ ID NO: 11 in the sequence listing.

[0076] Primer and probe sequences used to detect NPTII gene:

[0077] Primer NPTII-F: ATGATCTCGTCGTGACCCAT, as shown in SEQ ID NO: 12 in the sequence listing;

[0078] Primer NPTII-R: GCACGAGGAAGCGGTCA, as shown in SEQ ID NO: 13 in the sequence listing;

[0079] Probe NPTII-Probe: CACCCAGCCGGCCACAGTCGAT, as shown in SEQ ID NO: 14 in the sequence listing.

[0080] 1 μl of sample DNA was used as a template, and real-time fluorescence quantitative PCR was performed using Novozyme Taq Pro U+Mμltiple Probe QPCRMix according to the reaction system and conditions in the instruction manual, and data were analyzed using SDS2.3 software (Applied Biosystems). After analysis, the transgenic potato event ST2400643 was a single copy insertion.

[0081] Example 4: Sequence analysis of StALS1 target site of transgenic potato event ST2400643

[0082] Take about 100 mg of leaves of the transgenic potato plant constructed in Example 2, use the Polymer M5HiPerPlant Genomic DNA Kit to extract its genomic DNA, and dissolve it in 50 μl of water as a test sample. For specific methods, refer to its product manual. Take 1 μl of the above DNA as a template, use the Novogene high-fidelity PCR 2×KeyPo Master Mix (DyePlus) to perform PCR reaction, and amplify a 448 bp fragment of the StALS1 target region. The amplification primers are:

[0083] Primer StALS1-F: GGTTGACATTGATGGTGAC, as shown in SEQ ID NO: 15 in the sequence listing;

[0084] Primer StALS1-R: GCCTAGAACTAGTTATGTAG, as shown in SEQ ID NO: 16 in the sequence listing;

[0085] The fragments amplified and purified were subjected to Sanger sequencing. The sequencing results showed that the encoded protein had an overlapping peak at the S642 (AGC) position. Further cloning and sequencing showed that the transgenic potato event ST2400643 contained the AGC-ACT (S642T) mutation (see Figure 2 ).

[0086] Example 5: Detection of the insertion site of transgenic potato event ST2400643

[0087] 1. Genomic DNA Extraction

[0088] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 1 gram of young leaves of the transgenic potato plant constructed in Example 2 was taken, ground into powder in liquid nitrogen, and then 0.5 mL of CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid), pH 8.0] preheated at 65°C was added, mixed thoroughly, and incubated at 65°C for 90 min; an equal volume of phenol / chloroform was added for extraction, and the mixture was centrifuged at 12000 rpm for 10 min; the supernatant was aspirated, an equal volume of isopropanol was added, the mixture was gently mixed, and the mixture was allowed to stand at -20°C for 30 min; the supernatant was discarded, and 0.5 mL The precipitate was washed with 70% ethanol; centrifuged at 12000 rpm for 5 min; blown dry in a clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer, the DNA concentration was measured and adjusted to between 50-100 ng / μL.

[0089] 2. Analysis of flanking DNA sequences

[0090] The sequences of the 5' and 3' junctions of the insert fragment and potato genome were determined by Hi-Tail PCR and DNA sequence analysis. Two specific primers were designed near the LB position on the vector. The primer sequences were: Flank-R1: 5'-TATATGACCGTTTGGGCCGT-3' (SEQ ID NO:

[0091] 4); Flank-R2: 5'-TGGATTCGAATTCAAGCTTGG-3' (SEQ ID NO:

[0092] 7). For degenerate primer sequences and specific experimental methods, see Liu and Chen., “High-Efficiency Thermal Asymmetric Interlaced PCR for Amplification of Unknown Flanking Sequences,” BioTechniques, 2007, 43(5), 649–656.

[0093] The Hi-Tail PCR amplification system and procedure are shown in Tables 2 and 3, respectively.

[0094] Table 2 Hi-Tail PCR amplification system

[0095]

[0096] Table 3Hi-Tail PCR amplification program

[0097]

[0098]

[0099] The Tail II PCR product was analyzed by electrophoresis on a 1.2% agarose gel, and fragments longer than 500 bp were selected for sequencing. The sequencing results showed that the LB sequence of T-DNA was adjacent to a sequence of about 430 bp. Sequence alignment was performed using the published potato genome information (http: / / spuddb.uga.edu / ) SpudDB Potato Genomics Resource, and it was found to be highly homologous to a sequence on chromosome chr04.

[0100] With reference to the published potato genome sequence, amplification primers were designed upstream and downstream of this homologous sequence: 643-2-F1 (SEQ ID NO: 5) and 643-2-R (SEQ ID NO: 8), which were used in combination with primers near the RB end and LB end of T-DNA for amplification, i.e., 643-2-F1 (SEQ ID NO: 5) / Flank-F4 (SEQ ID NO: 6) and 643-2-R (SEQ ID NO: 8) / Flank-R2 (SEQID NO: 7), to amplify the genome sequence of transgenic potato event ST2400643 to obtain fragments of 550 bp and 552 bp, respectively, and the potato genome sequence joined to the inserted sequence was obtained by sequencing.

[0101] According to the sequence of the junction obtained above, the sequence alignment was performed using the published potato genome information (http: / / spuddb.uga.edu / index.shtml) Solanum tuberosum Group Phureja DM1-3v6.1. It was found that in the transgenic potato event ST2400643, the junction of the vector T-DNA sequence (RB end) and the 5' end of the potato chromosome 4 genome was at position 26574966, and the junction of the 3' end was at position 26574994, with a 27bp sequence deletion in the middle (chr04:26574967~chr04:26574993), and a 13bp sequence insertion at the 3' end. The entire exogenous fragment insertion sequence can be considered to be a nearly complete T-DNA part, with an 11bp deletion of the LB sequence but an additional 13bp insertion, and the entire RB and its adjacent 9bp inside the T-DNA deleted, but these deletions do not involve components related to the Cas9n and gRNA expression cassettes. Schematic diagram of the inserted sequence and flanking sequence is shown in Figure 3The continuous nucleotide sequence including the 5' flanking sequence, the integrated T-DNA portion, the additional inserted 13 bp and the 3' flanking sequence is shown in SEQ ID NO: 3.

[0102] 3. Detection method of genetically modified potato event ST2400643

[0103] Two pairs of DNA primers were used for PCR amplification to detect transgenic potato event ST2400643. DNA of transgenic potato event ST2400643 was used as a template, 643-2-F1 (SEQ ID NO: 5) and Flank-F4 (SEQ ID NO: 6) were used as primers, annealed at 55°C, extended at 72°C for 1 min, and a 550 bp fragment from RB to the flanking sequence of the potato genome was amplified (SEQ ID NO: 1). DNA of transgenic potato event ST2400643 was used as a template, Flank-R2 (SEQ ID NO: 7) and 643-2-R (SEQ ID NO: 8) were used as primers, annealed at 55°C, extended at 72°C for 1 min, and a 552 bp fragment from LB to the flanking sequence of the potato genome was amplified (SEQ ID NO: 2). When the two DNA primer pairs were used in the PCR reaction of non-transformed potato genomic DNA and non-transgenic potato event ST2400643 potato genomic DNA, no fragment was amplified. The results of amplifying the transgenic potato event ST2400643 and the wild-type Atlantic potato samples using the two DNA primer pairs were as follows: Figure 4 and Figure 5 shown.

[0104] Example 6: Herbicide tolerance testing of transgenic potato event ST2400643

[0105] The T0 seedlings of the transgenic potato plants constructed in Example 2 were propagated, and a stem segment with one leaf and one leaf node was cut off with scissors and inserted into MS medium (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 6.0 g / L agar powder, pH 5.8) according to the plant biology direction. The propagation coefficient was 1:4. After two transfers, the tissue culture seedlings were determined to contain T-DNA insertion and StALS1-S642T mutations by the methods described in Examples 3 and 4, and can be used for herbicide resistance experiments.

[0106] For the transgenic potato event ST2400643 and the wild-type control, three tissue culture seedlings with the same growth were taken, cut into stem segments at a ratio of 1:4, with a total of 12 stem segments, and inoculated in MS medium containing 0, 130μg / L, and 260μg / L imipenem for culture testing. The culture conditions were 23°C, 16 hours of light, and 8 hours of darkness. After culturing on the medium containing herbicides for 2 and 4 weeks, the tissue culture seedlings were observed, and it can be seen that the wild-type stem segments did not grow and gradually died, while the stem segments of the transgenic potato event ST2400643 could grow normally, and there was no obvious inhibition compared with the growth rate of the stem segments inoculated on the medium without herbicides ( Figure 6 , Table 4). Therefore, the transgenic potato event ST2400643 has excellent resistance to the imazapic herbicide. The transgenic potato event ST2400643 grown on a medium without herbicides has the same growth rate as the wild-type potato (Atlantic), and no abnormal phenotype is found.

[0107] Table 4 Imazapic acid herbicide tolerance test results

[0108]

[0109]

[0110] In summary, the regenerated transgenic potato plants were detected for the presence of Cas9 and NPTII genes by TaqMan analysis (see Example 3), and their copy numbers were characterized; based on the copy number of the target gene, good tolerance to the imazapic herbicide and agronomic trait performance (see Example 6), the selected transgenic potato event ST2400643 was excellent through screening, having a single copy transgene, good tolerance to the imazapic herbicide and excellent agronomic trait performance.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A nucleic acid molecule for detecting transgenic potato event ST2400643, characterized in that: The sequence of the nucleic acid molecule is shown in SEQ ID NO: 1-2 or its complementary sequence; or the sequence of the nucleic acid molecule is shown in SEQ ID NO: 3 or its complementary sequence; The nucleic acid molecule is derived from the transgenic potato event ST2400643, and the potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132.

2. A DNA detection kit, characterized in that: The kit comprises a first primer pair and a second primer pair, and when the first primer pair and the second primer pair are used together with DNA containing the transgenic potato event ST2400643 for PCR amplification reaction, an amplicon for detecting the transgenic potato event ST2400643 in a sample is generated. The first primer pair is used to amplify the nucleic acid molecule of the sequence shown in SEQ ID NO: 1, the sequence of the forward primer is shown in SEQ ID NO: 5, and the sequence of the reverse primer is shown in SEQ ID NO: 6, The second primer pair is used to amplify the nucleic acid molecule of the sequence shown in SEQ ID NO: 2, the sequence of the forward primer is shown in SEQ ID NO: 7, and the sequence of the reverse primer is shown in SEQ ID NO: 8, The potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with the deposit number CGMCCNO.46132.

3. The kit according to claim 2, characterized in that The kit further comprises a third primer pair for amplifying the Cas9 gene or a fragment thereof, and / or a fourth primer pair for amplifying the NPTII gene or a fragment thereof, and / or a fifth primer pair for amplifying the StALS1 gene or a fragment thereof, The sequence of the forward primer of the third primer pair is shown in SEQ ID NO:9, and the sequence of the reverse primer is shown in SEQ ID NO:

10. The sequence of the forward primer of the fourth primer pair is shown in SEQ ID NO: 12, and the sequence of the reverse primer is shown in SEQ ID NO: 13, The sequence of the forward primer of the fifth primer pair is shown as SEQ ID NO:15, and the sequence of the reverse primer is shown as SEQ ID NO:

16.

4. The kit according to claim 3, characterized in that When the kit comprises a third primer pair, the kit further comprises a third probe having a sequence as shown in SEQ ID NO: 11, which specifically binds to the amplification product of the third primer pair. When the kit comprises a fourth primer pair, the kit further comprises a fourth probe having a sequence as shown in SEQ ID NO: 14, which specifically binds to the amplification product of the fourth primer pair.

5. A method for detecting the presence of DNA of transgenic potato event ST2400643 in a sample, characterized in that: include: (1) using the kit according to any one of claims 2 to 4 to perform a nucleic acid amplification reaction on a sample to be tested; (2) detecting the presence of amplification products, The amplification product includes a nucleic acid molecule of sequence SEQ ID NO: 1-2 or a complementary sequence thereof, indicating that the test sample contains the DNA of the transgenic potato event ST2400643; the potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132.

6. A method for protecting potato plants from damage caused by herbicides, characterized in that include: (1) Planting transgenic potato plants containing transgenic potato event ST2400643; (2) applying an effective dose of imidazolinone herbicide, The potato plant containing the transgenic potato event ST2400643 has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee with the deposit number CGMCCNO.46132. in: In step (2), the imidazolinone herbicide is imazapic acid.

7. A method for controlling weeds in a field growing potato plants, characterized in that The method comprises applying an effective dose of an imidazolinone herbicide to a field planted with transgenic potato plants, wherein the transgenic potato plants comprise transgenic potato event ST2400643, and the potato plants comprising the transgenic potato event ST2400643 have been deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee with the deposit number CGMCC NO.46132, and the imidazolinone herbicide is imipenem.

Images